CN111705049B

CN111705049B - Novel chitosanase CHI1, encoding gene and application thereof

Info

Publication number: CN111705049B
Application number: CN202010493734.3A
Authority: CN
Inventors: 程凡升
Original assignee: Qingdao Agricultural University
Current assignee: Qingdao Agricultural University
Priority date: 2020-06-03
Filing date: 2020-06-03
Publication date: 2021-04-13
Anticipated expiration: 2040-06-03
Also published as: JP2021185912A; CN111705049A; JP7011132B2

Abstract

The invention discloses a novel chitosanase CHI1, an encoding gene and application thereof, wherein the novel chitosanase has an amino acid sequence shown as Seq ID No:1 or an amino acid sequence with at least 95% of sequence identity and basically the same enzyme activity. The new chitosanase is derived from the metagenome of the contents of the digestive tract of the yellow croaker. The coding gene of the novel chitosanase has a nucleotide sequence shown as Seq ID No. 2. The method for producing the novel chitosanase CHI1 comprises the following steps: fermenting the culture capable of expressing the new chitosanase under the condition suitable for producing the new chitosanase, and separating and purifying the fermentation product to obtain the chitosanase. The novel chitosanase provided by the invention has high activity and high stability, and can be produced in large scale by fermentation of engineering bacteria, so that the chitosanase can be conveniently applied to industrial oligosaccharide production.

Description

Novel chitosanase CHI1, encoding gene and application thereof

Technical Field

The invention relates to the technical field of biological engineering, in particular to novel chitosanase CHI1, an encoding gene thereof and application thereof.

Background

Chitosan (chitosan), also known as chitosan, etc., has a chemical name of beta- (1,4) -2-amino-2-deoxy-beta-D-glucose, which is a natural high molecular compound obtained by deacetylation of chitin, and is formed by connecting glucosamine or a small amount of acetylglucosamine residues through beta- (1,4) -glycosidic bonds, and has a molecular formula of (C6H11NO4) n, wherein the relative molecular mass is hundreds of thousands to millions. The main sources of chitin are the epidermis of arthropods and the shell of mollusks, also present in the cell walls of fungi, bacteria, lower algae. Chitin is also the highest nitrogen content organic renewable resource except protein, and the abundance degree of the chitin is second to that of cellulose. However, chitin is large in molecular weight and insoluble in water, so that the chitin cannot be effectively developed and utilized, and huge resource waste is caused.

Chitosan oligosaccharide (oligosaccharide) is an oligosaccharide with the polymerization degree of 2-20 generated by degrading chitosan physically, chemically or enzymatically, and is formed by connecting acetylglucosamine or glucosamine through beta-1, 4-glycosidic bonds. Compared with chitosan, the chitosan oligosaccharide has low molecular weight, and has wide application as a functional oligosaccharide in the fields of medicine, food, cosmetics, agriculture and the like. In medicine, for example: reducing cholesterol, resisting tumor, lowering blood pressure, treating burn and scald, stopping bleeding, regulating immunity, regulating intestinal flora, etc.; in food applications, such as: antibacterial effect, and can be directly used as health food, functional food additive, food antistaling agent and antiseptic; in cosmetic applications, such as: has effects in keeping moisture, scavenging oxygen anion free radicals, and delaying aging; in agriculture, for example: nitrogen fertilizer containing high nitrogen content, activating plant cells, inducing plant defensin production in plants, improving disease resistance of plants, inhibiting growth of pathogenic microorganisms, and enhancing broad-spectrum disease resistance of plants.

Because many unique functions of chitosan are revealed only by degradation into chitosan oligosaccharide. Therefore, the method for efficiently degrading chitosan is very critical. At present, the production of chitooligosaccharides and chitooligosaccharides is roughly classified into chemical, biological and physical methods. The physical method and the chemical method can generate a large amount of waste water and waste in the production process, and can also consume a large amount of water resources, so that the method does not meet the policy of national energy conservation and emission reduction. From the aspects of environmental protection, energy conservation and high efficiency, the chitosan oligosaccharide prepared by degrading chitosan by the biological enzyme method has the advantages of mild degradation conditions of the enzyme method, which are incomparable to the physical method and the chemical method, and the hydrolysis process and the product distribution are easy to control without pollution, thus becoming a hotspot of research of people.

The source of the chitosanase is wide, the chitosanase is found in bacteria, fungi, cyanobacteria, viruses and plants, researchers obtain the chitosanase by separating from various microorganisms in sequence, for example, the activity of chitinase produced by Bacillus cereus TKU006 screened by Wangs, ChaoC and the like in 2009 is only 0.14U/mL, and the strain Bacillus cereus HMX-21 with the highest activity is screened from wastewater of a sewage treatment plant by a transparent ring method in Xiashan research on breeding, fermentation and separation and purification of chitosanase/chitosanase producing strains, and enzymology property, the activity of the strain Bacillus cereus HMX-21 is only 0.56U/mL, Wangs and TsenW are equal to the screened chitosanase producing strain Acinetobacter calcosticus TKU024 screened in 2011, and the maximum activity of crude enzyme liquid is 0.39U/mL. Huanliang et al screening and identification of chitosanase-producing strain discloses a Mitsraria strain with highest enzyme activity, which is screened from soil samples, and the enzyme activity is only 0.729U/mL.

The conventional strain screening has great workload, and a large amount of gene information can be leaked by the method, so that huge microbial gene resources cannot be excavated and fully utilized, and a chitosan enzyme gene with high novelty is difficult to obtain.

Disclosure of Invention

Aiming at the problems, the intestinal microorganisms of the small yellow croakers are taken as research objects, total DNA is extracted to construct a metagenome library, and screening based on function as guide is carried out to obtain a chitosanase CHI1 gene with high activity and high stability, wherein the chitosanase belongs to glycoside hydrolase GH8 family; the chitosanase has high thermal stability and pH stability, and can be widely applied to oligosaccharide production. The invention also provides engineering bacteria capable of expressing the chitosanase in large quantity and a production method of the chitosanase, and the engineering bacteria can be used for industrial fermentation to produce the chitosanase CHI1 in large batch.

The technical scheme of the invention is as follows:

the present invention provides a novel chitosanase CHI1 having the amino acid sequence shown in Seq ID No:1 or an amino acid sequence with at least 95% sequence identity to the amino acid sequence shown in Seq ID No:1 and having substantially the same enzymatic activity. The above enzymes include not only the enzyme of sequence Seq ID No:1 but also other enzymes which have been further modified in the sequence of this enzyme but still have substantially the same enzymatic activity. The enzyme modification comprises intramolecular cross-linking of the enzyme for improving enzyme stability, side chain group modification, or addition of purification tags at two ends of the sequence, and the like.

Since the novel chitosanase gene is easily mutated during replication of the microbial genome, mutants of the chitosanase are also within the scope of the present application. The chitosanase mutants having the same activity are at least 95% homologous to the amino acid sequence shown in Seq ID No.1, and more preferably, the mutants have 92%, 94%, 95%, 96%, 97%, 98% or 99% identity to the corresponding native sequence of the chitosanase. The enzyme mutants may be point mutations, deletion mutations or addition mutations, and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acids may be changed relative to the original protein sequence.

The chitosanase enzyme of the present application, whose sequence is shown in Seq ID No:1, was named CHI 1. The enzyme is obtained by screening from an intestinal metagenome library of the yellow croaker by the applicant, and compared with the existing sequence, the comparison similarity is only 72 percent, which shows that the genetic relationship with the existing gene is far, and the novelty is high.

The encoding gene CHI1 (870 bp in length) of the chitosanase is cloned and analyzed by bioinformatics and detected by electrophoresis to obtain: CHI1 has molecular weight of 33.08kDa, and belongs to glycoside hydrolase GH8 family, with good hydrophilicity and stability. After heterologous expression, the enzymatic properties are determined, and the optimal reaction temperature is 60 ℃ and the optimal pH value is 5.0. Mn2+ promoted a significant improvement in the activity of this enzyme. The optimum colloidal chitosan concentration for chitosanase CHI1 was 1.5%, but it did not have the ability to hydrolyze chitin. The chitosanase CHI1 was endo-chitosanase with Km value of 2.87mg/mL, Vmax value of 0.49. mu. mol/min, and specific activity of 2.71U/mg.

Preferably, the encoding gene of the new chitosanase is derived from the metagenome of the contents of the digestive tract of the yellow croaker.

The present invention also provides a gene encoding the above novel chitosanase, which has the nucleotide sequence shown in Seq ID No. 2 or a sequence having at least 95% sequence identity with the nucleotide sequence shown in Seq ID No. 2. The coding gene of the novel chitosanase comprises not only a nucleotide sequence shown as SeqID No. 2, but also a mutant sequence with homology of at least 95% with the sequence of Seq ID No. 2. More preferably, the mutation sequence is 92%, 94%, 95%, 96%, 97%, 98% or 99% identical to the native sequence of the respective chitosanase described above. The above-mentioned mutant sequence may be a point mutation, a deletion mutation or an addition mutation, and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides may be changed with respect to the original nucleotide sequence.

The meanings of the said have are: the coding gene can be a nucleotide sequence with a sequence only as shown in SeqIDNO:2, or a derivative sequence obtained by modifying and processing the nucleotide sequence shown in SeqIDNO:2, such as adding enzyme cutting sites or enhancers at two ends of the gene sequence.

The invention also provides a recombinant expression vector which is formed by connecting the encoding gene of the novel chitosanase to an expression vector. Can be used for transforming host expression strains and producing novel chitosanase.

Preferably, the expression vector is a pEASY series vector, a pET series vector or a pGEM series vector.

The engineering bacterium is obtained by transforming the recombinant expression vector into an expression vector (host bacterium), and can efficiently express the novel chitosanase.

The invention also provides a method for producing the novel chitosanase, which comprises the following steps: and (3) fermenting the culture capable of expressing the new chitosanase under the condition suitable for producing the new chitosanase, and separating and purifying a fermentation product to finally obtain the chitosanase.

Preferably, the method for producing chitosanase by using the engineering bacteria comprises the following steps:

(1) construction of engineering bacteria: amplifying chitosanase target gene by using specific primer, recovering target gene, connecting it to expression vector to construct recombinant expression vector, and converting the recombinant expression vector into host bacterium to obtain the engineering bacterium for producing high-activity chitosanase.

Wherein, the template adopted by amplification is a recombinant vector carrying the coding sequence of the chitosanase.

Preferably, the gene-specific primers used for amplifying the chitosanase CHI1 are:

CHI1-F:ATGATGAGCGTGCTGGCAC；

CHI1-R:CGCAGACGCCGTATAAGACG

(2) fermentation of engineering bacteria: the screened engineering bacteria are cultured into seed liquid, the seed liquid is inoculated into LB liquid culture medium containing ampicillin (50 mu g/mL) with the inoculation amount of 1 percent, when the seed liquid is cultured with shaking at 37 ℃ and 250r/min until OD600 is 0.6, IPTG with the final concentration of 1mM is added, the induction is carried out at the low temperature of 20 ℃, the seed liquid is cultured with shaking at 250r/min for 16 hours, and the bacterial body is precipitated or further cultured in an expanding way.

(3) Separation and purification of chitosanase: and (3) breaking the cell wall of the bacterial precipitates, quickly centrifuging the cell wall breaking liquid at 4 ℃ at 12000r/min for 20 minutes, and collecting the supernatant. Purifying the supernatant by a Ni-NTA column method, and dialyzing to obtain the high-purity recombinant chitosan enzyme solution.

Wherein, cell wall breaking adopts the supersound broken wall, and the ultrasonic apparatus parameter sets for: power 400W, 5 seconds of operation, 5 seconds apart, 60 times of operation.

The dialysis bag has a molecular weight cut-off of 20 kDa.

Preferably, the expression vector used in the above method is a pEASY series vector, a pET series vector or a pGEM series vector. In the specific examples, pEASY vectors are exemplified.

The host bacteria used as the expression strain is Escherichia coli BL21 or Escherichia coli Rosetta. The escherichia coli is a model strain, the high-density fermentation condition is mature, the enzyme production period is short, and the escherichia coli is widely applied to the field of microbial fermentation industry.

The invention also provides application of the novel chitosanase in oligosaccharide preparation and aquatic product leftover treatment. Due to the high activity of the chitosanase provided by the invention, after the engineering bacteria are utilized to carry out mass production of new chitosanase, the chitosanase is conveniently applied to the production process of oligosaccharide, the application value of chitosan is improved, and the cost is reduced to treasure.

In addition, the chitosanase can be used for preparing fungal protoplasts, so that the prepared fungal protoplasts can be directly applied to genetic hybridization experiments of strains, and the chitosanase is particularly more effective to zygomycetes of which the cell wall component is chitosan. The chitosanase can also be applied to inhibiting plant pathogenic bacteria, and the chitosan is used for degrading the cell walls of the plant pathogenic fungi, so that the chitosanase can be applied to the prevention and treatment research of pathogenic bacteria harm.

The invention has the following beneficial effects:

1. the novel chitosanase CHI1 provided by the invention has high enzymatic activity, the specific activity is 2.71U/mg, and the specific activity is generally higher than that of the existing chitosanase; the enzyme has good temperature stability and pH stability, the optimum pH value of the enzyme is about 5, but the pH stability is high, the influence of small-amplitude change of the pH value on the enzyme activity is small, and when the pH value is reduced to 4.0, the residual activity is about 90 percent; even when the buffer pH was raised to 10, the CHI1 enzyme was still not completely inactivated. The novel chitosanase has the application advantage of higher pH stability in production, and CHI1 has high specificity to a substrate.

2. Through recombinant expression and construction of engineering bacteria, a large amount of target enzyme genes are expressed in the engineering bacteria, so that the yield is high, the enzyme activity is high, and the requirement of industrial production is met.

Drawings

FIG. 1 is an electrophoretogram of metagenomic DNA of contents of the digestive tract of a little yellow croaker;

FIG. 2 is an electrophoretogram after purification of metagenomic DNA;

FIG. 3 is a plate screen of chitosanase positive clones;

FIG. 4 shows the result of electrophoresis of the PCR amplification product of gene CHI 1;

wherein, M is Marker; 1, PCR product of CHI1 gene;

FIG. 5 shows the colony PCR amplification product of recombinant chitosanase CHI 1;

wherein, Marker; 1-4, cloning results of colonies of different recombinant vectors;

FIG. 6 shows the multiple sequence alignment of CHI1 with a GH8 family chitosanase;

FIG. 7 shows the results of hydrophobicity prediction for chitosanase CHI 1;

FIG. 8 is a three-dimensional structural model of chitosanase CHI 1;

FIG. 9 shows SDS-PAGE of induced expression and purification of CHI 1; wherein, (A) M, Marker; 1, induction of expression result of CHI 1; 2 and 3, CHI1 did not induce results; (B) m, Marker; 1, CHI1 purification results;

FIG. 10 shows the results of determination of optimum pH for CHI 1;

FIG. 11 shows the results of measurement of optimum temperature of CHI 1;

FIG. 12 shows the effect of different metal ion treatments on the viability of CHI 1;

FIG. 13 shows the results of the substrate specificity test of CHI 1.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. In the present invention, the equipment and materials used are commercially available or commonly used in the art, if not specified. The methods in the following examples are conventional in the art unless otherwise specified.

Example 1 construction of a metagenomic library of intestinal contents of yellow croaker

1.1 extraction of metagenome DNA of intestinal contents of yellow croaker

(1) Sample pretreatment and DNA extraction

The fish sample is processed on a sterile operating table, the surface of the fish and the tools such as tweezers are firstly wiped by 75% alcohol, and the fish is cut forward upwards along the anus in an arc shape by a dissecting scissors. The outer wall of the digestive tract was wiped with 75% alcohol and rinsed several times with sterile rinsing solution (0.9% sterile saline). The digestive tract was separated with sterile scissors, rinsed with sterile irrigation fluid and the contents of the digestive tract were collected. Then, the metagenomic DNA of the contents in the digestive tract of the yellow croaker is extracted by using a CTAB method, and the extracted metagenomic DNA is subjected to electrophoresis detection, and the result is shown in FIG. 1.

(2) DNA concentration and quality detection

The quality of the purified DNA was checked by electrophoresis of the extracted DNA, the results of which are shown in FIG. 2. The detection of DNA samples mainly comprises 2 aspects:

firstly, analyzing the purity and integrity of DNA by agarose gel electrophoresis;

② the purity (OD260/280, OD230/280 ratio) and concentration of DNA are detected by Nanodrop.

The experimental results are as follows: from the results of fig. 1 and 2, it is clear that the proposed genome is slightly degraded, mainly because the contents of the animal intestinal tract are complex, and may contain various enzymes that survive, which is not favorable for DNA extraction and preservation. After the extracted gene is purified, an electrophoresis band is single, clear and free of dispersion, the ratio of OD260/OD280 is 1.83 when measured, and the measured value is in the range of 1.8-2.0, which shows that RNA pollution, protein, phenol and other impurities are less in pollution; the ratio of OD260/OD230 is 1.68 and less than 2.0, which indicates that the sample has certain small molecules and salts; the concentration of nucleic acid was determined by the instrument to be 376.6 ng/. mu.L. The quality of the extracted DNA meets the requirement of constructing the metagenomic library.

1.2DNA cleavage and recovery

(1) The extracted fish intestinal tract content DNA is subjected to enzyme digestion treatment according to the following enzyme digestion reaction system. The enzyme digestion reaction system is as follows: 88 mu L of fish intestinal content DNA; sau3AI 2 μ L; 10 × Sau3AI Buffer10 μ L.

The enzyme digestion reaction conditions are as follows: inactivation was carried out at 37 ℃ for 2 hours and at 75 ℃ for 5 minutes. And detecting the enzyme digestion effect by electrophoresis.

(2) And (3) DNA recovery after enzyme digestion: the 1000-and 4000-bp fragments were recovered by gel cutting using a gel recovery kit.

1.3 cleavage of the vector

And simultaneously carrying out corresponding enzyme digestion treatment on the vector, wherein the enzyme digestion reaction system is as follows:

pUC 1986. mu.L; BamHI 2 μ L; 10 × BamHI Buffer10 μ L. The enzyme digestion reaction conditions are as follows: inactivation was carried out at 37 ℃ for 2 hours and at 75 ℃ for 5 minutes. And (4) carrying out electrophoresis detection.

1.4 CIAP treatment of vectors

In order to remove the phosphate group at the end of the vector DNA fragment and reduce the self-ligation of the vector, CIAP treatment is carried out, and the specific operations are as follows:

(1) preparing the following reaction solution in a micro-centrifuge tube, and fixing the volume to 50 mu L, wherein

DNA Fragment 15pmol，

10×Alkaline Phosphatase Buffer 5μL；

CIAP(10-30units/μL)1-2μL；

Add ddH₂O make up to 50. mu.L.

(2) The reaction was carried out at 37 ℃ for 15 minutes and at 50 ℃ for 15 minutes. Finally, the enzyme was inactivated by treatment at 75 ℃ for 10 minutes.

1.5 ligation of DNA to plasmid vector

The BamH I enzyme-dephosphorylated cloning vector and incompletely digested genomic fragment were ligated with T4DNA Ligase overnight at 16 ℃.

The ligation reaction system at 50. mu.L was: 30 mu L of DNA after single enzyme digestion; 3 mu L of pUC19 vector after enzyme digestion; 10 XT 4DNA Ligase Buffer 5. mu.L; T4DNALigase2.5. mu.L; ddH₂O 9.5μL。

1.6 transformation of E.coli E.coil Blue2 Strain

And transforming the ligation product into an Escherichia coli E.coil Blue2 strain, coating a corresponding plate, and constructing a metagenome library. And (3) performing library construction detection to obtain a metagenomic library with the library capacity 1891, randomly selecting 15 metagenomic libraries, performing colony PCR amplification to successfully obtain 11 positive clones, wherein the average insert length is 1500 bp.

Example 2 screening of intestinal metagenomic library chitosanase from yellow croaker

The screening method comprises the following steps: from the numerous clones of the library, white positive colonies were picked and spotted on LB (Amp + IPTG + X-gal) medium plates containing 1% colloidal chitosan, and cultured at 37 ℃ for 1-2d to observe whether there was a hydrolysis loop around the colonies. After the bacteria grow out, standing and dyeing the bacteria by using 1mg/mL Congo red solution for 10-15 minutes, decoloring, obtaining a bacterial colony with a transparent ring as a target bacterial colony, and carrying out streak purification on the target bacterial colony to obtain a single bacterial colony of the target bacteria. The clone with the hydrolysis loop is extracted into plasmid and the plasmid is sequenced by Shanghai biological engineering company Limited.

The experimental results are as follows: after a large number of screenings, 1 strain (shown in figure 3) with the best effect and the ability of degrading chitosan is found to have a plurality of different custard clones, the gene coded by the custard clone is named as CHI1, and the sequence information of the gene CHI1 is specifically shown in Seq ID No:2 in the sequence table.

Example 3 bioinformatic analysis of the Chitosan Gene CHI1

Various biological information analyses of the chitosanase gene CHI1 were carried out according to the different tools in Table 1 below:

TABLE 1 bioinformatics analysis tools

3.1 multiple sequence alignment results

CHI1 was aligned to multiple sequences of family 8 chitosanase, and the alignment was shown in FIG. 6. The comparison result shows that the sequence information of the chitosanase CHI1 protein is shown as SEQ ID No.1 in the sequence table in sequence, the chitosanase belongs to glycoside hydrolase 8 family, and the comparison of the primary structure of the chitosanase CHI1 shows that the most similar sequence is WP-053425757.1 which is chitosanase from Rheinheimera sp, and the similarity is 72 percent; the above results illustrate that: CHI1 has low similarity with the known sequence, and is a new chitosan enzyme gene.

3.2 results of analysis of physicochemical Properties of protein

The physicochemical properties of CHI1 are shown in Table 2, and the predicted molecular weight is 33.08kDa, and the predicted isoelectric point is 6.76.

The common amino acid composition of CHI1 does not contain cysteine C, and the highest content of amino acid composition is leucine L, which reaches 10.7%, and the second content is tryptophan S, which has a content of 9.7%. Contains 31 acidic amino acids (D + E), 31 basic amino acids (R + K), and has an aliphatic amino acid index of 88.21. The atomic composition is C1514H2293O427N399S5, the instability coefficient of the amino acid sequence is 29.97, which indicates that the protein is stable; the hydrophilicity index was-0.214, indicating that it is a hydrophilic protein.

TABLE 2 physicochemical Properties of chitosanase CHI1

3.3 results of hydrophobicity analysis

The hydrophobicity of proteins plays an important role in maintaining the formation and stability of the tertiary structure of proteins. The chitosanase sequence was analyzed by ProtScale, and the predicted results are shown in FIG. 7, where the positive and negative values indicate hydrophobicity and hydrophilicity. On the whole, CHI1 hydrophilic amino acids are distributed more uniformly and the number ratio is obviously more than that of hydrophobic amino acids, which shows that the protein has better hydrophilicity, and the enzyme can be further presumed to belong to soluble protein and is consistent with the analysis result of physicochemical properties.

3.4 subcellular structure prediction results

TABLE 3CHI1 chitosanase subcellular structure

The subcellular structure prediction is to determine whether the protein sequence has a signal peptide secretion pathway by performing prediction analysis on a known mitochondrial target peptide fragment (mTP), a chloroplast transit peptide fragment (cTP) and a Signal Peptide (SP) with a secretion pathway in a leader chain at the N end of the sequence. According to the analysis of the subcellular structure of chitosanase in Table 3, the signal peptide index with secretory pathway reached 0.942, indicating that CHI1 chitosanase has signal peptide with secretory pathway, which is consistent with the signal peptide prediction result.

3.5 protein Secondary and Tertiary Structure prediction results

The chitosanase CHI1 consisted mainly of an alpha helix and random coil. The percentage of total residues of 9 alpha helices was 45.52%, and the percentage of residues of 8 beta sheets was 8.96%; the percentage of random crimp was 45.52%. The results of molecular docking are shown in fig. 8, which shows that: the amino acid residues involved in substrate binding are: leu224, Trp70, Glu31, Ala86, Asp88, consistent with multiple sequence alignments.

Example 4 cloning of Chitosan Gene CHI1 and construction of expression vector

4.1 primer design

According to the sequence of chitosanase, primer CHI1-F, CHI1-R was designed by using PrimerPremier5.0 software, and the chitosanase gene CHI1 was specifically amplified using the pair of primers and high fidelity pfu enzyme as template. The exact set of amplification conditions is shown in Table 5 below. The results of electrophoresis of the amplification products are shown in FIG. 4.

CHI1-F:ATGATGAGCGTGCTGGCAC；

CHI1-R:CGCAGACGCCGTATAAGACG；

TABLE 5PCR reaction procedure

And selecting the most appropriate annealing temperature for PCR reaction according to the amplification result of gel imaging.

4.2 construction of expression vector for Chitosan Gene

(1) And (3) PCR product purification: PCR products were recovered according to gel DNA recovery kit instructions. The electrophoretogram is shown in FIG. 5.

(2) Ligation of the PCR product to the vector

The following reagents were added to a 0.2mL EP vial and the PCR instrument was temperature-controlled at 37 ℃ for 10 minutes.

TABLE 6 ligation reaction System

(3) Screening for Positive clones

mu.L of the ligation product was added to 50. mu.L of E.coli competent TransT1, ice-cooled for 30 minutes, heat-shocked at 42 ℃ for 30 seconds, and immediately placed on ice for 2 minutes. Add 250 u L of LB liquid medium equilibrated to room temperature, 200 r/min, 37 ℃ incubation for 1 h. mu.L of the suspension was spread evenly on a solid medium containing ampicillin (final concentration: 30. mu.g/mL) and incubated at 37 ℃ for 8-10 hours. Selecting white pure colony as template, Primer T7 Promoter Primer and T7 Terminator Primer, amplifying at 94 deg.c for pre-denaturation, denaturation at 94 deg.c for 2 min, annealing at 55 deg.c for 30 sec, extension at 72 deg.c for 30 sec, and 35 cycles; extension at 72 ℃ for 10 minutes, storage at 4 ℃, and electrophoretic analysis of the amplified product (see the result in FIG. 5) to further determine positive clones, which were sequenced by Shanghai Bioengineering Co., Ltd.

(4) Transformation of expression vectors to screen for correct clones, plasmid extraction with reference to mass extraction kit and transformation into e.coli competent BL21(DE 3).

Example 5 inducible expression and purification of recombinant chitosanase CHI1

5.1 Induction Process of recombinant chitosanase

5.1.1 Experimental methods:

(1) single colonies transformed with the correct expression vector were picked and inoculated into 10mL of LB liquid medium containing ampicillin (50. mu.g/mL) and cultured overnight at 37 ℃ with shaking at 250 r/min.

(2) The next day, the overnight cultured bacterial liquid is inoculated into 100mL LB liquid culture medium containing ampicillin (50 mug/mL) according to the inoculation amount of 1%, the mixture is cultured at 37 ℃ under the shaking of 250r/min until OD600 is 0.6, 10mL of sample is taken as an uninduced sample, the sample is centrifuged at 10000r/min for 1 minute, cell precipitation is collected, cell disruption and protein extraction are immediately carried out, and induction of gene expression by cold stress is prevented.

(3) Adding IPTG with the final concentration of 1mM into the residual bacterial liquid, inducing at the low temperature of 20 ℃, shaking and culturing for 16 hours at the speed of 250r/min, taking the bacterial liquid as a sample after induction, collecting the bacterial precipitation by the method (2), and freezing and storing at the temperature of 20 ℃ for later use.

(4) The induced precipitate was resuspended in a predetermined amount of PBS (pH8.0), an equal volume of 2 XSDS loading buffer was added, boiled for 10 minutes, separated by SDS-PAGE electrophoresis, stained with Coomassie stain for 3 hours, and then the induction was observed by destaining.

(5) And selecting bacteria with successful induced expression to reduce, carrying out enlarged culture to collect thalli precipitates, storing at 20 ℃, and preparing for further analysis and purification.

5.1.2 results of the experiment

Electrophoresis detection results of the induced expression products: SDS-PAGE analysis of CHI1 is shown in FIG. 9, where the band for CHI1 is between the 25kDa and 35kDa bands, approximately 33kDa, similar to the predicted size.

5.2 extraction, purification and detection of target chitosanase

5.2.1 disruption of the walls of the recombinant bacteria and extraction of intracellular proteins

(1) The culture solution (100mL) of the recombinant bacteria is centrifuged at 5000r/min for 20 minutes at normal temperature, the bacteria are collected, 4mL of balance buffer solution (pH8.0) is added into the recombinant bacteria, and the mixture is vortexed and mixed evenly.

(2) And (3) placing the thallus suspension in a small 10mL beaker, and breaking cell walls by using an ultrasonic instrument under the ice bath condition, wherein the parameters of the ultrasonic instrument are set as follows: the power is 400W, the work is 5s, the interval is 5s, and the work is 60 times.

(3) Quickly centrifuging the cell wall breaking solution at 4 deg.C and 12000r/min for 20 min, collecting supernatant, verifying enzyme activity, and storing at-20 deg.C.

5.2.2 purification of recombinant proteins

Purifying the recombinant chitosanase by a Ni-NTA column method, preparing a large amount of cell wall breaking liquid supernatant containing target protein for many times, loading the cell wall breaking liquid supernatant onto the Ni-NTA column, washing, eluting and the like to finally obtain the high-purity target protein, and specifically operating as follows:

(1) column assembling: resuspending the medium, adding a proper amount of the medium into the chromatographic column according to the amount of the protein to be purified, and standing.

(2) Balancing: the column is equilibrated with 5-10 column volumes of equilibration buffer. For His-tagged recombinant proteins with strong binding ability, or for improving specific binding equilibrium buffer, imidazole (10-20mM) can be added at low concentration.

(3) Loading: the sample buffer was identical to the equilibration buffer. The sample is centrifuged or filtered using a 0.45 μm filter to avoid clogging the column.

(4) Washing: after the sample loading is finished, washing the chromatographic column by using 5-10 times of column volume of equilibrium buffer solution, and collecting effluent liquid.

(5) And (3) elution: the protein of interest was eluted with different concentrations of imidazole. Imidazole with different concentrations is prepared by equilibrium buffer solution for gradient elution.

5.2.3 dialysis treatment

Because the protein eluent after passing through the column contains high-concentration imidazole, the imidazole is removed by dialysis, and the specific operation is as follows:

(1) the dialysis bag was cut into small pieces of appropriate length (10-20 cm). The dialysis bag was boiled in a large volume of 2% (W/V) sodium bicarbonate and 10mM EDTA (pH8.0) for 10 minutes.

(2) The dialysis bag was thoroughly washed with distilled water. The mixture was boiled in 1mM EDTA (pH8.0) for 10 minutes and then washed with distilled water. After cooling, the dialysis bags were stored at 4 ℃ and it was necessary to ensure that they were always immersed in the solution. The dialysis bag must be gloved from this time on.

(3) Transferring the protein solution into a bag, clamping with a dialysis bag clamp, and dialyzing at 4 deg.C in pure water or buffer solution. The solution was changed every 1 hour.

5.2.4 SDS-PAGE detection of the expression product of recombinant chitosanase CHI1

The experimental method comprises the following steps: the expression product before induction, the expression product after induction and the expression product after purification are subjected to a conventional SDS-PAGE detection, and the yield and purity of the expression product in each case are analyzed.

The experimental results are as follows: the purified product of chitosanase CHI1, after the above purification and dialysis treatment, was subjected to electrophoresis, and the results are also shown in FIG. 9. The purified protein of CHI1 has clear band and no tailing, which shows that the enzyme has good purification effect and provides a good foundation for next determination of enzymatic properties.

Example 7 investigation of the enzymatic Properties of the recombinant chitosanase CHI1

9.1 optimum pH and pH stability

(1) The experimental method comprises the following steps:

measuring the optimum pH value: 0.1mL of the enzyme solution obtained by separation and purification and 0.9mL of colloidal chitosan are uniformly mixed, the influence of the reaction system on the activity of the chitosan enzyme under different pH (3-11) values is measured, and the enzyme activity is measured according to the method in the example 1. The highest enzyme activity is determined as 100%, and the relative enzyme activity of the xylanase under different pH values is calculated.

Measuring the pH value stability: mixing the chitosanase and buffer solutions with different pH values, standing for 1h, measuring the activity of residual chitosan, taking the highest enzyme activity as 100%, and calculating the relative enzyme activity of the chitosanase.

(2) The experimental results are as follows:

as shown in FIG. 10, the optimum pH of the recombinant chitosanase CHI1 was about 5, but its pH stability was high; when the pH value is reduced to 4.0, the residual activity is about 90 percent; even when the buffer pH was raised to 10, the CHI1 enzyme was still not completely inactivated, and its viability remained at 36.32% and 19.73% under the optimal pH conditions; this indicates that the pH stability of the recombinant chitosanase CHI1 was good.

Most of other chitosanases currently available are substantially inactivated under the condition of large variation of pH, such as Bacillus sp.TS Chitosanase which is competent expressed by Escherichia coli by Zhou et al (published in 2015 "Extra cellular expression of Chitosase from Bacillus sp.TS in Escherichia coli") and the optimum pH is also 5.0, but when the pH is decreased to 4.0 and increased to 7.5, the activity is remarkably reduced and the activity is almost lost. In the study, the residual enzyme activities of CHI1 were 61.59% and 43.55% after 1h at pH 5.0, and 63.25% and 44.21% after 1h at pH 6.0, which indicates that the pH stability is good.

9.2 optimum reaction temperature and temperature stability

(1) The experimental method comprises the following steps:

measurement of optimum reaction temperature: 0.1mL of enzyme solution and 0.9mL of colloidal chitosan are uniformly mixed, the enzyme activity is measured at different temperatures of 30-80 ℃, the enzyme activity of the chitosan at the optimal temperature is taken as 100%, and the relative enzyme activity of the chitosanase under different temperature conditions is calculated.

Measuring the temperature stability: and (3) placing the enzyme solution at the optimum temperature for 1 hour, measuring the residual enzyme activity, taking the original enzyme activity as 100%, and calculating the relative enzyme activity of the chitosanase.

(2) The experimental results are as follows:

as shown in the measurement results in FIG. 11, the optimal temperatures of the recombinant chitosanase CHI1 were all 60 ℃, the influence of different temperatures on chitosanase was large, and when the temperature was increased to 80 ℃, the enzyme activity of the obtained CHI1 was only 20.17% of the optimal temperature. After CHI1 was treated at 60 ℃ for 1h, the residual enzyme activities were 61.59% and 43.55%.

9.3 Metal ions and surfactants

(1) The experimental method comprises the following steps: mixing the enzyme solution with different metal ion buffer solution (Mg) with concentration of 0.5M²⁺、Zn²⁺、Mn²⁺、K⁺、Na⁺、Li⁺、Ca²⁺、Cu²⁺、Fe³⁺) Mixing, blank is inactivated enzyme solution, and buffer solution without metal ions is used as control group. The surfactant is selected from SDS and EDTA, and the concentration is 0.5M. The relative enzyme activity of the chitosanase was calculated for the different treatments.

(2) The experimental results are as follows: as shown in FIG. 12, Mn²⁺The enzyme activity of CH1 can be obviously improved by nearly 2 times; EDTA and SDS both significantly inhibit enzyme activity, Li⁺And K⁺There was no promoting effect on CHI 1.

9.4 substrate specificity

(1) The experimental method comprises the following steps: mixing 0.9mL of different substrates with 0.1mL of chitosan solution to determine the activity of the chitosan enzyme, wherein the different substrates comprise colloidal chitosan, colloidal chitin, powdered chitosan, powdered chitin, sodium carboxymethylcellulose (CMC) and casein. The highest enzyme activity is taken as 100 percent, and the relative enzyme activity of the chitosanase under different substrates is calculated.

(2) The experimental results are as follows: the results of the substrate specificity measurement are shown in FIG. 13, and CHI1 has no ability to hydrolyze chitin, and the optimum substrate concentration is 1.5% when colloidal chitosan is used as the substrate.

9.5 recombinant chitosanase kinetic constants

The kinetic constants are determined by a double reciprocal plot method, a Lineweaver-Burk double reciprocal plot is made by taking 1/S (mg/ml) as an abscissa and 1/V (min/mu mol) as an ordinate, and the corresponding kinetic constants are calculated according to the double reciprocal plot.

According to the double reciprocal method, the Km value of the chitosanase CHI1 is 2.87mg/mL, the Vmax value is 0.49 mu mol/min, and the specific activity is 2.71U/mg. TLC (thin layer chromatography) showed no monosaccharide present in the product after 24h hydrolysis, indicating that CHI1 is an endo-chitosanase.

Sequence listing

<110> Qingdao agricultural university

<120> novel chitosanase CHI1, encoding gene and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 290

<212> PRT

<213> chitosanase CHI1(chitosanase 1)

<400> 1

Met Met Ser Val Leu Ala Arg Leu Leu Leu Ile Ile Ser Ser Leu Trp

1 5 10 15

Ile Gln Thr Val Met Ala Asp Gln Ser Asp Trp Thr Leu Tyr Lys Ser

20 25 30

Arg Phe Val Ser Ser Asp Gly Arg Val Ile Asp Thr Tyr Asn Asn Lys

35 40 45

Ile Ser His Ser Glu Gly Gln Gly Trp Gly Met Leu Phe Ala Glu Ala

50 55 60

Asn Asn Asp Gln His Ser Phe Asp Leu Ile Trp Ser Trp Thr Arg Lys

65 70 75 80

Asn Leu Ala Arg Thr Asp Ala Phe Leu Phe Ser Trp Arg Tyr Asp Pro

85 90 95

Glu Leu Arg Pro Ala Val Lys Asp Pro Asn Asn Ala Ser Asp Gly Asp

100 105 110

Ile Leu Ile Ala Trp Ala Leu Gln Arg Ala Ala Lys Arg Trp Lys Asn

115 120 125

Arg Asn Tyr Glu Thr Ala Ser Ala Ala Ile Arg Ala Asp Ile Gln Arg

130 135 140

Leu Leu Ile Lys Asp Phe Gly Gly Phe Thr Val Leu Leu Pro Gly Leu

145 150 155 160

Lys Gly Phe Ser Asp Lys Glu Ser Ile Asp Ile Asn Leu Ser Tyr Trp

165 170 175

Val Ile Pro Ala Phe Ile Ser Phe Ala Met Val Glu Pro Glu Gln Asn

180 185 190

Trp Ser Lys Leu Val Thr Asp Gly Gln Lys Leu Leu Ala Ala Ser Arg

195 200 205

Phe Gly Ser Tyr Gly Leu Pro Ser Asp Trp Ile Arg Leu Ser Asp Lys

210 215 220

Gly Gln Leu Ala Pro Ser Pro Asn Trp Pro Ala Arg Phe Ser Tyr Asp

225 230 235 240

Ala Val Arg Ile Pro Leu Tyr Phe Ile Trp Gly Ser Ala Leu Thr Asn

245 250 255

Asp Leu Arg Gln Pro Phe Thr Asp Phe Trp Lys Asn Asn Glu Leu Ile

260 265 270

Leu Pro Trp Val Asp Val Val Thr Gly Glu Lys Ala Ser Tyr Thr Ala

275 280 285

Ser Ala

290

<210> 2

<211> 870

<212> DNA

<213> chitosanase CHI1 gene (gene of chitosanase 1)

<400> 2

atgatgagcg tgctggcacg cctgctgctg attatcagct ctctgtggat tcagactgtc 60

atggcagacc agtctgactg gactctgtac aagtcccgct tcgtcagctc tgacggtcgt 120

gttatcgata cctacaacaa caagatctcc cactccgagg gccagggttg gggtatgctg 180

ttcgctgaag ctaacaacga ccagcatagc ttcgacctga tctggagctg gactcgtaag 240

aacctggcac gtaccgacgc attcctgttc tcttggcgtt acgaccctga actgcgtcct 300

gcagttaaag acccaaacaa cgcatccgac ggcgatatcc tgatcgcttg ggctctgcaa 360

cgtgctgcta aacgttggaa aaaccgtaac tacgaaacgg cgtccgctgc tatccgtgcc 420

gatatccagc gtctgctgat caaagacttc ggtggcttta ccgttctgct gccaggtctg 480

aaaggtttca gcgacaaaga aagcatcgac atcaacctgt cctattgggt tattccggcg 540

ttcattagct ttgccatggt ggaaccggaa cagaactggt ccaaactggt gaccgatggc 600

cagaaactgc tggccgcgtc ccgtttcggc tcttacggtc tgccgtctga ttggattcgc 660

ctgtctgata aaggtcagct ggccccgtct ccgaactggc cggcgcgctt ctcttatgat 720

gcggtacgca tcccgctgta ctttatctgg ggctccgcgc tgaccaatga tctgcgccaa 780

ccgtttaccg atttctggaa aaataatgaa ctgattctgc cgtgggtaga tgtagttacc 840

ggcgagaaag cgtcttatac ggcgtctgcg 870

Claims

1. New chitosanase CHI1, characterized in that the enzyme sequence is the amino acid sequence shown in Seq ID No: 1.

2. The novel chitosanase CHI1 of claim 1, wherein the gene encoding the enzyme is derived from the metagenome of the gut content of yellow croaker.

3. The gene encoding the novel chitosanase CHI1 of claim 1, wherein the coding gene is the nucleotide sequence shown in SeqIDNO: 2.

4. A recombinant expression vector comprising the gene according to claim 3 or the gene encoding the amino acid sequence according to claim 1 linked to an expression vector.

5. The recombinant expression vector of claim 4, wherein the expression vector is a pEASY series vector, a pET series vector, or a pGEM series vector.

6. An engineered bacterium transformed with the recombinant expression vector of claim 4 and capable of expressing the novel chitosanase of claim 1.

7. A method for producing the novel chitosanase of claim 1, comprising the steps of: fermenting the engineering bacteria of claim 6 under the condition suitable for producing the new chitosanase, and separating and purifying the fermentation product to finally obtain the chitosanase.

8. The method of claim 7, comprising the steps of:

(1) construction of engineering bacteria: amplifying chitosanase target gene by using specific primer, recovering the target gene, connecting the target gene to an expression vector to construct a recombinant expression vector, and transforming the recombinant expression vector to host bacteria to obtain engineering bacteria for producing high-activity chitosanase;

(2) fermentation of engineering bacteria: inoculating the engineering bacteria seed liquid into LB liquid culture medium containing antibiotics in an inoculation amount of 1%, shaking and culturing at 37 ℃ and 250r/min until OD600=0.6, adding IPTG with a final concentration of 1mM, inducing at 20 ℃ at low temperature, shaking and culturing at 250r/min for 16 hours, and carrying out thallus precipitation or further amplification culture;

(3) separation and purification of chitosanase: breaking cell wall of the thallus precipitate, quickly centrifuging cell wall broken liquid at 4 ℃ at 12000r/min for 20 minutes, and collecting supernatant; purifying the supernatant by a Ni-NTA column method, and dialyzing to obtain the high-purity recombinant chitosan enzyme solution.

9. The method according to claim 8, wherein the expression vector is a pEASY series vector, a pET series vector, or a pGEM series vector; the host bacteria are Escherichia coli BL21 or Escherichia coli Rosetta.

10. The use of the novel chitosanase of claim 1 in the treatment of aquatic product offal, the preparation of oligosaccharides or the control of phytopathogenic fungi.