CN111662906A

CN111662906A - Novel terminator and application thereof

Info

Publication number: CN111662906A
Application number: CN202010606719.5A
Authority: CN
Inventors: 周哲敏; 崔文璟; 周丽; 刘中美; 令狐梅
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2018-12-18
Filing date: 2018-12-18
Publication date: 2020-09-15
Anticipated expiration: 2038-12-18
Also published as: CN111718934B; CN111662906B; CN109652418B; CN109652418A; CN111690649B; CN111690649A; CN111718934A

Abstract

The invention discloses a novel terminator and application thereof, belonging to the technical field of genetic engineering. The invention firstly characterizes the activity of a single terminator, obtains a series of novel terminators capable of improving the yield of target protein by combining and connecting terminators with different activities in series, takes a green fluorescent protein gene as an upstream gene of the terminator, takes a red fluorescent protein gene as a downstream gene of the terminator and characterizes the regulation level of the terminator on the upstream and downstream genes. The results show that these novel terminators are excellent in both the effect of increasing the expression level of the upstream gene and the effect of suppressing the expression level of the downstream gene. The method has important application value in producing target protein in bacillus subtilis.

Description

Novel terminator and application thereof

The invention relates to a new terminator and divisional application of the application with the application number of CN201811547733.1 and the application date of 2018, 12 and 18.

Technical Field

The invention relates to a novel terminator and application thereof, belonging to the technical field of genetic engineering.

Background

The transcription terminator is located downstream of the gene or operon and is responsible for the dissociation of RNA polymerase and the release of transcribed RNA, which serves as a segment of RNA sequence that terminates transcription. In prokaryotes, there are two types of transcription terminators, one of which is protein factor-dependent and requires the help of factors Rho, NusA and tau to function; the other is a hairpin that functions independently of any protein factor but rather by its own reverse palindromic sequence. Transcription terminators play an important role in maintaining mRNA stability and increasing the half-life of mRNA due to their special secondary structure and characteristics located downstream of the target gene: terminating the transcription process, releasing RNA polymerase and improving the utilization efficiency of the RNA polymerase; as a spacer sequence, it plays the role of an insulating element between adjacent expression units.

Previously, studies on terminators have focused mainly on prediction and identification, and the role of terminators in the regulation of gene expression or genetic circuits has been receiving attention in recent years. The terminator not only prevents transcription readthrough, but also contributes significantly to the improvement of the stability of upstream mRNA. However, most of the terminator regulatory element studies have so far been mainly focused on E.coli, and only a small part of the literature mentions applications in other microorganisms, such as Saccharomyces cerevisiae and the like.

Bacillus subtilis is a production host widely used as food enzyme preparation and important nutritional chemicals, and the product is certified as "general regulated as safe" (GRAS) level by the FDA. Therefore, the terminator which can regulate and control gene expression in the bacillus subtilis, is stable and high in activity is provided, and has important application value for preparing target protein, especially protein used in the food field.

Disclosure of Invention

The first purpose of the invention is to provide an element for regulating gene expression, which is formed by connecting two or three of TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, ST1.5b or TB6S2 in series, wherein the nucleotide sequences of TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, ST1.5b and TB6S2 are respectively shown in SEQ ID NO.1-SEQ ID NO. 16.

In one embodiment of the invention, two or three of TB5, TB2, TB6S2, st1.5b or TB10 are connected in series.

In one embodiment of the invention, the sequence is represented by SEQ ID NO.18 to SEQ ID NO. 29.

It is a second object of the present invention to provide a vector comprising the above-mentioned element.

The third purpose of the invention is to provide a genetically engineered bacterium expressing the vector.

A fourth object of the present invention is to provide a method for regulating the expression of a target protein in Bacillus subtilis, wherein the element of any one of claims 1 to 3 is co-expressed with a target protein gene.

In one embodiment of the present invention, the Bacillus subtilis comprises Bacillus subtilis168, Bacillus subtilis WB400, Bacillus subtilis WB600 or Bacillus subtilis WB 800.

In one embodiment of the invention, the protein of interest comprises an enzyme.

The fifth purpose of the invention is to provide the application of the regulatory element or the genetically engineered bacterium in preparing the target protein.

The sixth purpose of the invention is to provide the application of the regulatory element or the genetically engineered bacterium in the fields of food, pharmacy or chemical industry.

The invention firstly characterizes the activity of a single terminator, and finds that the expression quantity of upstream GFP is improved by 1.68 times and the expression quantity of downstream mcherry is reduced by 27.4 times when the TB5 terminator is added compared with the method without adding the terminator. A series of novel terminators capable of improving the yield of target proteins are obtained by combining and connecting TB5 terminators with other terminators in series, wherein a green fluorescent protein gene is used as an upstream gene of the terminator, a red fluorescent protein gene is used as a downstream gene of the terminator, and the regulation level of the upstream and downstream genes by the terminator is represented. The results show that the novel terminators have good effect on inhibiting the downstream gene expression level, for example, the downstream mcherry expression level is reduced by 337.58 times compared with that of a control when the TB2-TB5-TB5 terminator is added. The method has important application value in producing target protein in bacillus subtilis.

Drawings

FIG. 1: PCR validation of the test plasmid PBP43-GFP-mcherry, where M: DNA molecular weight standard; 1: the original plasmid size; 2: the size of a single enzyme-digested fragment of BamH I; 3: the size of the fragment after single digestion of SacII.

FIG. 2: characterization of single terminator termination efficiency, wherein TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, and ST1.5b respectively represent the termination efficiency of each terminator determined after insertion of the terminator TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, and ST1.5b between GFP and mcherry of plasmid PBP 43-GFP-mcherry.

FIG. 3: characterization of single terminator upstream GFP fluorescence intensity, where GM denotes the reference plasmid, TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, and ST1.5b denote upstream GFP fluorescence intensity of each terminator measured after insertion of the terminator TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, and ST1.5b between GFP and mcherry of the plasmids PBP43-GFP-mcherry, respectively.

FIG. 4: characterization of single terminator downstream mcherry fluorescence intensity, where GM denotes the reference plasmid, TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, and ST1.5b denote the downstream mcherry fluorescence intensity of each terminator, measured after insertion of the terminator TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, and ST1.5b between the GFP and the mcherry of the plasmids PBP43-GFP-mcherry, respectively.

FIG. 5: characterization of termination efficiency of tandem terminators, where TB6S2-TB10, TB5-TB10, TB6S2-TB10 and TB2-TB5 represent the termination efficiency of double tandem terminators; wherein TB6S2-ST1.5b-TB10, TB6S2-TB5-TB10, TB5-ST1.5b-TB10, TB5-TB5-TB10, TB6S2-ST1.5b-TB5, TB6S2-TB5-TB5, TB2-ST1.5b-TB5 and TB2-TB5-TB5 represent the termination efficiency of the triple tandem terminator.

FIG. 6: characterization of GFP fluorescence intensity upstream of tandem terminators, where TB6S2-TB10, TB5-TB10, TB6S2-TB10 and TB2-TB5 represent fluorescence intensity of GFP upstream of double tandem terminators; wherein TB6S2-ST1.5b-TB10, TB6S2-TB5-TB10, TB5-ST1.5b-TB10, TB5-TB5-TB10, TB6S2-ST1.5b-TB5, TB6S2-TB5-TB5, TB2-ST1.5b-TB5 and TB2-TB5-TB5 represent the fluorescence intensity of GFP upstream of the triple tandem terminator.

FIG. 7: characterization of the mCherry fluorescence intensity downstream of the tandem terminator, wherein TB6S2-TB10, TB5-TB10, TB6S2-TB10 and TB2-TB5 represent the mChery fluorescence intensity downstream of the double tandem terminator; wherein TB6S2-ST1.5b-TB10, TB6S2-TB5-TB10, TB5-ST1.5b-TB10, TB5-TB5-TB10, TB6S2-ST1.5b-TB5, TB6S2-TB5-TB5, TB2-ST1.5b-TB5 and TB2-TB 5-5 represent the mCherry fluorescence intensity downstream of the triple tandem terminator.

FIG. 8: characterization of the termination efficiency of terminator TB5 versus rrnBT1, where G-M-TB5 was used as a control for G-rrnBT1-M-TB5, and G-TB5-M-TB 5; G-M-rrnBT1 as a control for G-rrnBT1-M-rrnBT1 and G-TB5-M-rrnBT 1; G-M-TB5 and G-M-rrnBT1 showed termination efficiencies without addition of a terminator between GFP and mcherry; G-rrnBT1-M-TB5 and G-rrnBT1-M-rrnBT1 indicate the termination efficiency of the terminator rrnBT 1; G-TB5-M-TB5 and G-TB5-M-rrnBT1 showed termination efficiency of terminator TB 5.

FIG. 9: characterization of terminator TB5 and fluorescence intensity of upstream GFP of rrnBT1, G-M-TB5 and G-M-rrnBT1 indicate fluorescence intensity of upstream GFP without addition of terminator; G-rrnBT1-M-TB5 and G-rrnBT1-M-rrnBT1 indicate the fluorescence intensity of GFP upstream of the terminator rrnBT 1; G-TB5-M-TB5 and G-TB5-M-rrnBT1 indicate the fluorescence intensity of GFP upstream of the terminator TB 5.

FIG. 10: characterization of the fluorescence intensity of the terminator TB5 and mCherry downstream of rrnBT 1; G-M-TB5 and G-M-rrnBT1 indicate the fluorescence intensity of downstream mcherry without addition of terminator; G-rrnBT1-M-TB5 and G-rrnBT1-M-rrnBT1 indicate the fluorescence intensity of mcherry downstream of the terminator rrnBT 1; G-TB5-M-TB5 and G-TB5-M-rrnBT1 indicate the fluorescence intensity of mCherry downstream of the terminator TB 5.

Detailed Description

(I) culture Medium

LB Medium (g.L)^-1): tryptone (Tryptone) 10; yeast extract (Yeast extract) 5; sodium chloride (NaCl) 10.

Transformation method of (II) bacillus subtilis168

Selecting a single colony of bacillus subtilis168, inoculating the single colony into 2mL of SPI culture medium, and carrying out shake culture at 37 ℃ for 12-14 h; mu.L of the culture was inoculated into 5mL of SPI medium, and OD measurement was started after shaking culture at 37 ℃ for 4 to 5 hours₆₀₀. When OD is reached₆₀₀About 1.0, 200. mu.L of the suspension was transferred to 2mL of SPI medium at 37 ℃ and 100 r.min^-1Shaking for 1.5 hr, adding 20 μ L of 100 × EGTA (ethylene glycol bis (α -aminoethyl ether) tetraacetic acid) solution into the tube, and incubating at 37 deg.C for 100r min^-1Culturing in a shaking table for 10min, and subpackaging 500 mu L per l.5mL centrifuge tube; adding proper amount of plasmid verified to be correct by sequencing into the tube, blowing, sucking, mixing uniformly, and placing at 37 deg.C for 100r min^-1Culturing for 2h in a shaking table; after the culture is finished, sucking about 200 mu L of the bacterial liquid, uniformly coating the bacterial liquid on a corresponding selective plate, and culturing at 37 ℃ overnight for 12-14 h.

(III) Green fluorescent protein GFP fluorescence detection

12000g of a detection sample is centrifuged for 5min, thalli are collected, PBS buffer solution is washed for 3 times, the thalli suspension with certain concentration is diluted by PBS, 200 mu L to a 96-hole enzyme label plate is taken, and the enzyme label plate is placed into a Synergy TM H4 fluorescence microplate reader to detect fluorescence. The program is set as follows: detecting the concentration of the thallus at 600 nm; excitation at 495nm, emission at 525nm, gain at 60, and fluorescence intensity measured.

(IV) Red fluorescent protein mcherry fluorescence detection

12000g of a red fluorescent protein mcherry fluorescence detection sample is centrifuged for 5min, thalli are collected, PBS buffer is washed for 3 times, the thalli are diluted to thalli suspension with certain concentration by PBS, 200 mu L of the thalli suspension is taken to a 96-hole enzyme label plate, and the thalli suspension is placed into a Synergy TM H4 fluorescence enzyme label instrument to detect fluorescence. The program is set as follows: detecting the concentration of the thallus at 600 nm; excitation light 587nm, emission light 610nm, gain 80, detection of fluorescence intensity.

(V) method for measuring termination efficiency

Here we quantify the proportion of the transcriptional extension complex that does not pass through the terminator element by the Termination Efficiency (TE). The TE value of the terminator element that disrupts all the arriving transcription complexes is 1. The TE of the spacer sequences for GFP and mCherry is 0. Because the protein level of the expressed fluorescent reporter gene cannot be directly used to measure the TE value. We used downstream mcherry (FI)_DW) And upstream GFP (FI)_UP) The ratio of fluorescence of (A) to (B) to estimate the terminator read-Through (TR). Namely TR-FI_DW/FI_UP. Reference readthrough values (TR) were established using standardized test sequences (i.e., GFP and mCherry spacer sequences)_REF) Then all TR measurements are normalized: TR (transmitter-receiver)_NORM＝TR/TR_REFAnd estimating the termination efficiency by using TE 1-TR_NORM。

(VI) construction method of reference plasmid PBP43-GFP-mcherry

The mecher-rrnBT 1 sequence with a spacer TCCGCGGGATTACGGATCCT (shown as SEQ ID No. 30) was synthesized by the company, a primer with a homologous sequence was designed using PBSG03 (the construction method is shown in Guan C, Cui W, Cheng J, et al. restriction and evaluation of an auto-regulatory gene expression system in Bacillus subtilis [ J ]. Microbiological Cell industries, 2015,14(1):150) as a template, the mecher-rrnBT 1 sequence was assembled downstream of the GFP gene, a plasmid with the correct sequence was obtained by sequencing, then the plasmid was used as a template, the primers were designed to replace the srfA promoter with the P43 promoter, and a reference plasmid PBP 43-GFP-mischer with the correct sequence was obtained by sequencing.

Example 1: single terminator plasmid construction and fluorescent protein recombinant expression

(1) The primer sequences with the cleavage sites were designed and synthesized by the company.

(2) Annealing the synthesized primer sequences (shown in table 1) by temperature gradient to form double chains, then connecting the annealed DNA double chain sequences with reference plasmids PBP43-GFP-mcherry by using BamH I and SacII to obtain fragments, digesting the fragments by using T4 ligase to construct test plasmids PBP43-GFP-Term-mcherry carrying terminators (shown in table 2), carrying out DNA sequencing, wherein the result of the DNA sequencing shows that the terminators are successfully connected to the digestion sites between GFP and mcherry of the test plasmids PBP43-GFP-mcherry, and the verification of plasmid digestion electrophoresis is shown in figure 1 to prove that the new shuttle vector of Escherichia coli-Bacillus subtilis is successfully constructed.

(3) Transferring the obtained recombinant plasmid with correct sequencing verification into bacillus subtilis168, performing static culture at 37 ℃ for 12-14h, then selecting a single colony to be cultured in 5mL of LB seed culture medium at 37 ℃; according to the final OD₆₀₀0.02 transfer to a 250mL Erlenmeyer flask containing 50mL LB medium, 200rpm, 37 degrees C, culture 24 h.

The termination efficiency (FIGS. 2 and 3) and fluorescence intensity (FIGS. 3 and 4; tables 4 and 5) of the selected terminators were measured, indicating that the expression levels of GFP and mcherry were different for different terminators, indicating that different terminators had different characteristics. The termination efficiency of the terminators TB4, TB5, TB6, TB7, TB9 and ST1 is high, and accordingly, the expression level of GFP at the upstream of the terminators is increased, and the expression of mCherry at the downstream is inhibited. Among them, the expression level of upstream GFP was increased by 1.68 times and the expression level of downstream mCherry was decreased by 27.4 times when TB5 terminator was added, compared with the case where no terminator was added.

TABLE 1 primer Table

TABLE 2 Single terminator sequences

TABLE 3 Single terminator termination efficiency

TABLE 4 Single terminator upstream GFP fluorescence intensity

Terminator name	Upstream GFP fluorescence intensity (Fl)_GFP/OD₆₀₀)
		Control (GM)	4930
ST1	13369
		ST1.5a	11112
ST1.5b	6752
		ST2	6687
ST3	11647
		TB1	5088
TB2	8906
		TB3	4670
TB4	10897
		TB5	13203
TB6	11933
		TB7	13689
TB8	10645
		TB9	12658
TB10	6914
		TB6S2	5659

TABLE 5 Single terminator downstream mCherry fluorescence intensity

Example 2: double-tandem and triple-tandem terminator plasmid construction and fluorescent protein recombinant expression

(1) The primer sequences with BamH I, Sac II, XhoI and SacI cleavage sites were synthesized by the company (see Table 1).

(2) Construction of the double tandem terminator plasmid: four terminator sequences used for double tandem are annealed and connected into a double strand through temperature gradient, then the annealed DNA double strand and a reference plasmid PBP43-GFP-mcherry are connected through T4 ligase, fragments obtained through BamH I and SacII enzyme digestion are obtained, test plasmids PBP43-GFP-Terms-mcherry carrying double tandem terminators (table 6) are obtained, DNA sequencing is carried out, the result of the DNA sequencing shows that the terminator fragments are successfully connected to enzyme digestion sites between GFP and mcherry of the test plasmids PBP43-GFP-mcherry, and the new Escherichia coli-Bacillus subtilis shuttle vector is successfully constructed.

(3) Constructing a triple tandem terminator on the basis of the double tandem terminator plasmid: primer sequences with XhoI and SacI cleaved sequences were synthesized by the company (Table 1). Annealing the synthesized terminator sequence through temperature gradient to form a double chain, then connecting the annealed DNA double chain with a fragment obtained by XhoI and SacI enzyme digestion of a double-tandem plasmid PBP43-GFP-Terms-mcherry by using T4 ligase to construct a test plasmid PBP43-GFP-Terms-mcherry carrying the terminator, and performing DNA sequencing, wherein the DNA sequencing result shows that the triple-tandem terminator (shown in a table 6) is successfully connected to the enzyme digestion site between the GFP and the mcherry of the test plasmid PBP43-GFP-mcherry, and the new Escherichia coli-Bacillus subtilis shuttle vector is successfully constructed.

(3) Transferring the obtained recombinant plasmid with correct sequencing verification into bacillus subtilis168, performing static culture at 37 ℃ for 12-14h, then selecting a single colony to be cultured in 5mL of LB seed culture medium at 37 ℃; according to the final OD₆₀₀Transferred to 50mL LB medium at a rate of 0.02The cells were incubated in a 250mL Erlenmeyer flask at 200rpm and 37 ℃ for 24 hours.

The termination efficiencies (FIG. 5; Table 7) and fluorescence intensities (FIG. 6, FIG. 7 and tables 7 and 8) of the selected double-tandem and triple-tandem terminators were measured, indicating that the termination efficiencies of the terminators can be significantly changed by different tandem modes. For example, the termination efficiency of the terminator can be improved by concatenating a weak terminator (TB10, TB6S2, TB2) with a strong terminator (TB5), a novel terminator with different termination efficiency is obtained, and a termination library is enriched.

The novel promoter has better inhibiting effect on the expression of downstream genes, such as the downstream mcherry expression quantity is reduced by 337.58 times compared with that of a control when a TB2-TB5-TB5 terminator is added. By the three-tandem mode, transcription read-through can be completely inhibited, downstream mcherry is hardly expressed, and some meaningless transcription can be avoided in gene expression, so that the utilization of intracellular resources is improved to the maximum extent.

TABLE 6 Dual tandem, triple tandem terminator sequence Listing

TABLE 7 Dual and triple tandem terminator termination efficiencies

Terminator	Efficiency of termination
		TB6S2-TB10	0.65
TB6S2-ST1.5b-TB10	0.67
		TB6S2-TB5-TB10	0.90
TB5-TB10	0.95
		TB5-ST1.5b-TB10	0.95
TB5-TB5-TB10	0.99
		TB6S2-TB5	0.82
TB6S2-ST1.5b-TB5	0.82
		TB6S2-TB5-TB5	0.97
TB2-TB5	0.98
		TB2-ST1.5b-TB5	0.99
TB2-TB5-TB5	0.9

TABLE 8 fluorescent intensity of GFP upstream of double-tandem and triple-tandem terminators

TABLE 9 Mcherry fluorescence intensity downstream of double and triple tandem terminators

Terminator	Downstream mcherry fluorescence intensity (Fl)_mcherry/OD₆₀₀)
		TB6S2-TB10	5696
TB6S2-ST1.5b-TB10	5534
		TB6S2-TB5-TB10	1971
TB5-TB10	1578
		TB5-ST1.5b-TB10	1416
TB5-TB5-TB10	196
		TB6S2-TB5	3599
TB6S2-ST1.5b-TB5	3455
		TB6S2-TB5-TB5	562
TB2-TB5	438
		TB2-ST1.5b-TB5	112
TB2-TB5-TB5	45

Example 3: the characteristics of the selected terminator TB5 were compared with those of the conventional terminator rrnBT1

(1) Construction of plasmid PBP43-GFP-rrnBT 1-mcherry: plasmid PBP43-GFP-mcherry is taken as a template, a single-chain rrnBT1 terminator sequence synthesized by the company is annealed by temperature gradient to form a double chain, then the annealed double-chain terminator sequence and fragments obtained by enzyme digestion of plasmid PBP43-GFP-mcherry by BamH I and SacII are connected by T4 ligase digestion to construct plasmid PBP43-GFP-rrnBT 1-mcherry;

(2) construction of plasmid PBP43-GFP-mcherry-TB 5: a reference plasmid PBP43-GFP-mcherry is taken as a template, a TB5 terminator sequence is designed on a primer, a terminator rrnBT1 at the downstream of the mcherry is replaced by a terminator TB5 through whole plasmid PCR, and a plasmid PBP43-GFP-mcherry-TB5 is constructed;

(3) construction of plasmid PBP43-GFP-rrnBT1-mcherry-TB 5: annealing a single-chain rrnBT1 terminator sequence synthesized by a company into a double chain by using a plasmid PBP43-GFP-mcherry-TB5 as a template through temperature gradient, and then connecting the annealed double-chain terminator sequence with a fragment obtained by digestion of the plasmid PBP43-GFP-mcherry-TB5 with BamHI and Sac II by using T4 ligase to construct a plasmid PBP43-GFP-rrnBT1-mcherry-TB 5;

(4) construction of plasmid PBP43-GFP-TB5-mcherry-TB 5: plasmid PBP43-GFP-mcherry-TB5 is used as a template, a single-chain TB5 terminator sequence synthesized by the company is annealed by temperature gradient to form a double chain, and then the annealed double-chain terminator sequence is connected with a fragment obtained by enzyme digestion of plasmid PBP43-GFP-mcherry-TB5 by BamH I and Sac II by T4 ligase to construct plasmid PBP43-GFP-TB5-mcherry-TB 5;

(5) transferring the obtained recombinant plasmid with correct sequencing verification into bacillus subtilis168, performing static culture at 37 ℃ for 12-14h, then selecting a single colony to be cultured in 5mL of LB seed culture medium at 37 ℃; according to the final OD₆₀₀0.02 transfer to a 250mL Erlenmeyer flask containing 50mL LB medium, 200rpm, 37 degrees C, cultured for 24 hours. The termination efficiency (FIG. 8; Table 10) and fluorescence intensity (FIG. 9, FIG. 10 and Table 11 and Table 12) of the terminator were determined, wherein G-M-TB5 is a reference for G-rrnB1-M-TB5 and G-TB5-M-TB5, wherein G-M-rrnB1 is a reference for G-rrnB1-M-rrnB1 and G-TB5-M-rrnB1, and the fluorescence detection results show that the termination efficiency of the selected terminator TB5 is higher than that of the conventional terminator rrnBT1, and the downstream mCherry expression is better inhibited.

TABLE 10 comparison of termination efficiency of terminator TB5 with rrnBT1

Plasmids	Efficiency of termination
		PBP43-GFP-mcherry-TB5(G-M-TB5)	0
PBP43-GFP-rrnBT1-mcherry-TB5(G-rrnBT1-M-TB5)	0.83
		PBP43-GFP-TB5-mcherry-TB5(G-TB5-M-TB5)	0.97
PBP43-GFP-mcherry-rrnBT1(G-M-rrnBT1)	0
		PBP43-GFP-rrnBT1-mcherry-rrnBT1(G-rrnBT1-M-rrnBT1)	0.83
PBP43-GFP-TB5-mcherry-rrnBT1(G-TB5-M-rrnBT1)	0.97

TABLE 11 comparison of upstream GFP fluorescence intensity of terminator TB5 with rrnBT1

Plasmids	Upstream GFP fluorescence intensity (Fl)_GFP/OD₆₀₀)
		PBP43-GFP-mcherry-TB5(G-M-TB5)	9485
PBP43-GFP-rrnBT1-mcherry-TB5(G-rrnBT1-M-TB5)	18433
		PBP43-GFP-TB5-mcherry-TB5(G-TB5-M-TB5)	21708
PBP43-GFP-mcherry-rrnBT1(G-M-rrnBT1)	9841
		PBP43-GFP-rrnBT1-mcherry-rrnBT1(G-rrnBT1-M-rrnBT1)	18975
PBP43-GFP-TB5-mcherry-rrnBT1(G-TB5-M-rrnBT1)	23465

TABLE 12 comparison of downstream mCherry fluorescence intensities of terminator TB5 with rrnBT1

Plasmids	Downstream mcherry fluorescence intensity (Fl)_mcherry/OD₆₀₀)
		PBP43-GFP-mcherry-TB5(G-M-TB5)	11091
PBP43-GFP-rrnBT1-mcherry-TB5(G-rrnBT1-M-TB5)	3592
		PBP43-GFP-TB5-mcherry-TB5(G-TB5-M-TB5)	639
PBP43-GFP-mcherry-rrnBT1(G-M-rrnBT1)	11275
		PBP43-GFP-rrnBT1-mcherry-rrnBT1(G-rrnBT1-M-rrnBT1)	3629
PBP43-GFP-TB5-mcherry-rrnBT1(G-TB5-M-rrnBT1)	655

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> a novel terminator and uses thereof

<160>81

<170>PatentIn version 3.3

<210>1

<211>44

<212>DNA

<213> Artificial Synthesis

<400>1

caaacagcgg gaggatacag ccaattcttt tttttatgct ataa 44

<210>2

<211>36

<212>DNA

<213> Artificial Synthesis

<400>2

gaaaggactg catagccagt cttttctttt atttta 36

<210>3

<211>49

<212>DNA

<213> Artificial Synthesis

<400>3

taatagaatg gtatttaaat gagaatgcta tcaatttttt gtagtcagc 49

<210>4

<211>40

<212>DNA

<213> Artificial Synthesis

<400>4

agaaaccggt ctggctgcca gccggtttct ttttttattc 40

<210>5

<211>41

<212>DNA

<213> Artificial Synthesis

<400>5

caggacaccg ttcaaattga acggtgtttt tctttgaaaa g 41

<210>6

<211>45

<212>DNA

<213> Artificial Synthesis

<400>6

acaaagctgc attcaatagt tgaatgcagc tttttcatta ttgga 45

<210>7

<211>82

<212>DNA

<213> Artificial Synthesis

<400>7

gtgaacattt gaaatccggc cctctctata gtatccttta cttcagatga aggatactag 60

agggggcttt ttttatgtca at 82

<210>8

<211>62

<212>DNA

<213> Artificial Synthesis

<400>8

agcaaggact gctgaaaggg ctgacataag ccttttgccg gcggtccttt tttaattctg 60

at 62

<210>9

<211>47

<212>DNA

<213> Artificial Synthesis

<400>9

ctcaatccct tggcactaaa agtgtcaggg gattttttat gttaata 47

<210>10

<211>55

<212>DNA

<213> Artificial Synthesis

<400>10

caaaagagga gttagtgcct ctgctcaggc actactcctc tttttgggat tttct 55

<210>11

<211>28

<212>DNA

<213> Artificial Synthesis

<400>11

ccctcctgta ctaggagggt attttttt 28

<210>12

<211>26

<212>DNA

<213> Artificial Synthesis

<400>12

gggagcctca aggctccctt tagttt 26

<210>13

<211>30

<212>DNA

<213> Artificial Synthesis

<400>13

gatcacaaag agtaggtgta gcctactcgc 30

<210>14

<211>26

<212>DNA

<213> Artificial Synthesis

<400>14

gggcgggtct tcccgcccta cttttt 26

<210>15

<211>37

<212>DNA

<213> Artificial Synthesis

<400>15

tgccctgaat ggcttagttg ctgttcaggg cattttt 37

<210>16

<211>45

<212>DNA

<213> Artificial Synthesis

<400>16

acaaactgcc cggtcctacg gtacgggttc tttttcatta ttgga 45

<210>17

<211>87

<212>DNA

<213> Artificial Synthesis

<400>17

caaataaaac gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg 60

gtgaacgctc tcctgagtag gacaaat 87

<210>18

<211>130

<212>DNA

<213> Artificial Synthesis

<400>18

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgaggag 60

tccgagctcc aaaagaggag ttagtgcctc tgctcaggca ctactcctct ttttgggatt 120

ttctggatcc 130

<210>19

<211>126

<212>DNA

<213> Artificial Synthesis

<400>19

ccgcggcagg acaccgttca aattgaacgg tgtttttctt tgaaaagctc gaggagtccg 60

agctccaaaa gaggagttag tgcctctgct caggcactac tcctcttttt gggattttct 120

ggatcc 126

<210>20

<211>116

<212>DNA

<213> Artificial Synthesis

<400>20

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgaggag 60

tccgagctcc aggacaccgt tcaaattgaa cggtgttttt ctttgaaaag ggatcc 116

<210>21

<211>107

<212>DNA

<213> Artificial Synthesis

<400>21

ccgcgggaaa ggactgcata gccagtcttt tcttttattt tactcgagga gtccgagctc 60

caggacaccg ttcaaattga acggtgtttt tctttgaaaa gggatcc 107

<210>22

<211>125

<212>DNA

<213> Artificial Synthesis

<400>22

ccgcgggaaa ggactgcata gccagtcttt tcttttattt tactcgagga gtaggctaca 60

cctactcttt gtgagctcca ggacaccgtt caaattgaac ggtgtttttc tttgaaaagg 120

gatcc 125

<210>23

<211>142

<212>DNA

<213> Artificial Synthesis

<400>23

ccgcgggaaa ggactgcata gccagtcttt tcttttattt tactcgagca ggacaccgtt 60

caaattgaac ggtgtttttc tttgaaaagg agctccagga caccgttcaa attgaacggt 120

gtttttcttt gaaaagggat cc 142

<210>24

<211>144

<212>DNA

<213> Artificial Synthesis

<400>24

ccgcggcagg acaccgttca aattgaacgg tgtttttctt tgaaaagctc gaggagtagg 60

ctacacctac tctttgtgag ctccaaaaga ggagttagtg cctctgctca ggcactactc 120

ctctttttgg gattttctgg atcc 144

<210>25

<211>161

<212>DNA

<213> Artificial Synthesis

<400>25

ccgcggcagg acaccgttca aattgaacgg tgtttttctt tgaaaagctc gagcaggaca 60

ccgttcaaat tgaacggtgt ttttctttga aaaggagctc caaaagagga gttagtgcct 120

ctgctcaggc actactcctc tttttgggat tttctggatc c 161

<210>26

<211>148

<212>DNA

<213> Artificial Synthesis

<400>26

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgaggag 60

taggctacac ctactctttg tgagctccaa aagaggagtt agtgcctctg ctcaggcact 120

actcctcttt ttgggatttt ctggatcc 148

<210>27

<211>165

<212>DNA

<213> Artificial Synthesis

<400>27

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgagcag 60

gacaccgttc aaattgaacg gtgtttttct ttgaaaagga gctccaaaag aggagttagt 120

gcctctgctc aggcactact cctctttttg ggattttctg gatcc 165

<210>28

<211>134

<212>DNA

<213> Artificial Synthesis

<400>28

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgaggag 60

taggctacac ctactctttg tgagctccag gacaccgttcaaattgaacg gtgtttttct 120

ttgaaaaggg atcc 134

<210>29

<211>151

<212>DNA

<213> Artificial Synthesis

<400>29

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgagcag 60

gacaccgttc aaattgaacg gtgtttttct ttgaaaagga gctccaggac accgttcaaa 120

ttgaacggtg tttttctttg aaaagggatc c 151

<210>30

<211>880

<212>DNA

<213> Artificial Synthesis

<400>30

tccgcgggat tacggatcct aaacacaata gatagcagta gaaggaggta gagtatggtt 60

tctaaaggcg aagaagataa catggctatc atcaaagaat tcatgcgttt caaagttcat 120

atggaaggct ctgttaacgg ccatgaattc gaaatcgaag gcgaaggcga aggccgtcct 180

tacgaaggca cacaaacagc taaacttaaa gttacaaaag gcggccctct tcctttcgct 240

tgggatatcc tttctcctca attcatgtac ggctctaaag cttacgttaa acatcctgct 300

gatatccctg attaccttaa actttctttc cctgaaggct tcaaatggga acgtgttatg 360

aacttcgaag atggcggcgt tgttacagtt acacaagatt cttctcttca agatggcgaa 420

ttcatctaca aagttaaact tcgtggcaca aacttccctt ctgatggccc tgttatgcaa 480

aaaaaaacaa tgggctggga agcttcttct gaacgtatgt accctgaaga tggcgctctt 540

aaaggcgaaa tcaaacaacg tcttaaactt aaagatggcg gccattacga tgctgaagtt 600

aaaacaacat acaaagctaa aaaacctgtt caacttcctg gcgcttacaa cgttaacatc 660

aaacttgata tcacatctca taacgaagat tacacaatcg ttgaacaata cgaacgtgct 720

gaaggccgtc attctacagg cggcatggat gaactttaca aataagggcc catggtacgc 780

gtgctagagg catcaaataa aacgaaaggc tcagtcgaaa gactgggcct ttcgttttat 840

ctgttgtttg tcggtgaacg ctctcctgag taggacaaat 880

<210>31

<211>44

<212>DNA

<213> Artificial Synthesis

<400>31

caaacagcgg gaggatacag ccaattcttt tttttatgct ataa 44

<210>32

<211>50

<212>DNA

<213> Artificial Synthesis

<400>32

gatcttatag cataaaaaaa agaattggct gtatcctccc gctgtttggc 50

<210>33

<211>36

<212>DNA

<213> Artificial Synthesis

<400>33

gaaaggactg catagccagt cttttctttt atttta 36

<210>34

<211>42

<212>DNA

<213> Artificial Synthesis

<400>34

gatctaaaat aaaagaaaag actggctatg cagtcctttc gc 42

<210>35

<211>49

<212>DNA

<213> Artificial Synthesis

<400>35

taatagaatg gtatttaaat gagaatgcta tcaatttttt gtagtcagc 49

<210>36

<211>55

<212>DNA

<213> Artificial Synthesis

<400>36

gatcgctgac tacaaaaaat tgatagcatt ctcatttaaa taccattcta ttagc 55

<210>37

<211>40

<212>DNA

<213> Artificial Synthesis

<400>37

agaaaccggt ctggctgcca gccggtttct ttttttattc 40

<210>38

<211>46

<212>DNA

<213> Artificial Synthesis

<400>38

gatcgaataa aaaaagaaac cggctggcag ccagaccggt ttctgc 46

<210>39

<211>41

<212>DNA

<213> Artificial Synthesis

<400>39

caggacaccg ttcaaattga acggtgtttttctttgaaaa g 41

<210>40

<211>47

<212>DNA

<213> Artificial Synthesis

<400>40

gatccttttc aaagaaaaac accgttcaat ttgaacggtg tcctggc 47

<210>41

<211>45

<212>DNA

<213> Artificial Synthesis

<400>41

acaaagctgc attcaatagt tgaatgcagc tttttcatta ttgga 45

<210>42

<211>51

<212>DNA

<213> Artificial Synthesis

<400>42

gatctccaat aatgaaaaag ctgcattcaa ctattgaatg cagctttgtg c 51

<210>43

<211>82

<212>DNA

<213> Artificial Synthesis

<400>43

gtgaacattt gaaatccggc cctctctata gtatccttta cttcagatga aggatactag 60

agggggcttt ttttatgtca at 82

<210>44

<211>88

<212>DNA

<213> Artificial Synthesis

<400>44

gatcattgac ataaaaaaag ccccctctag tatccttcat ctgaagtaaa ggatactata 60

gagagggccg gatttcaaat gttcacgc 88

<210>45

<211>62

<212>DNA

<213> Artificial Synthesis

<400>45

agcaaggact gctgaaaggg ctgacataag ccttttgccg gcggtccttt tttaattctg 60

at 62

<210>46

<211>68

<212>DNA

<213> Artificial Synthesis

<400>46

gatcatcaga attaaaaaag gaccgccggc aaaaggctta tgtcagccct ttcagcagtc 60

cttgctgc 68

<210>47

<211>47

<212>DNA

<213> Artificial Synthesis

<400>47

ctcaatccct tggcactaaa agtgtcaggg gattttttat gttaata 47

<210>48

<211>53

<212>DNA

<213> Artificial Synthesis

<400>48

gatctattaa cataaaaaat cccctgacac ttttagtgcc aagggattga ggc 53

<210>49

<211>55

<212>DNA

<213> Artificial Synthesis

<400>49

caaaagagga gttagtgcct ctgctcaggc actactcctc tttttgggat tttct 55

<210>50

<211>61

<212>DNA

<213> Artificial Synthesis

<400>50

gatcagaaaa tcccaaaaag aggagtagtg cctgagcaga ggcactaact cctcttttgg 60

c 61

<210>51

<211>28

<212>DNA

<213> Artificial Synthesis

<400>51

ccctcctgta ctaggagggt attttttt 28

<210>52

<211>34

<212>DNA

<213> Artificial Synthesis

<400>52

gatcaaaaaa ataccctcct agtacaggag gggc 34

<210>53

<211>26

<212>DNA

<213> Artificial Synthesis

<400>53

gggagcctca aggctccctt tagttt 26

<210>54

<211>32

<212>DNA

<213> Artificial Synthesis

<400>54

gatcaaacta aagggagcct tgaggctccc gc 32

<210>55

<211>24

<212>DNA

<213> Artificial Synthesis

<400>55

gagtaggcta cacctactct ttgt 24

<210>56

<211>30

<212>DNA

<213> Artificial Synthesis

<400>56

gatcacaaag agtaggtgta gcctactcgc 30

<210>57

<211>26

<212>DNA

<213> Artificial Synthesis

<400>57

gggcgggtct tcccgcccta cttttt 26

<210>58

<211>32

<212>DNA

<213> Artificial Synthesis

<400>58

gatcaaaaag tagggcggga agacccgccc gc 32

<210>59

<211>37

<212>DNA

<213> Artificial Synthesis

<400>59

tgccctgaat ggcttagttg ctgttcaggg cattttt 37

<210>60

<211>43

<212>DNA

<213> Artificial Synthesis

<400>60

gatcaaaaat gccctgaaca gcaactaagc cattcagggc agc 43

<210>61

<211>55

<212>DNA

<213> Artificial Synthesis

<400>61

ggcaggacac cgttcaaatt gaacggtgtt tttctttgaa aagctcgagg agtcc 55

<210>62

<211>51

<212>DNA

<213> Artificial Synthesis

<400>62

ctcgagcttt tcaaagaaaa acaccgttca atttgaacgg tgtcctgccg c 51

<210>63

<211>59

<212>DNA

<213> Artificial Synthesis

<400>63

ggacaaactg cccggtccta cggtacgggt tctttttcat tattggactc gaggagtcc 59

<210>64

<211>55

<212>DNA

<213> Artificial Synthesis

<400>64

ctcgagtcca ataatgaaaa agaacccgta ccgtaggacc gggcagtttg tccgc 55

<210>65

<211>50

<212>DNA

<213> Artificial Synthesis

<400>65

gggaaaggac tgcatagcca gtcttttctt ttattttact cgaggagtcc 50

<210>66

<211>46

<212>DNA

<213> Artificial Synthesis

<400>66

ctcgagtaaa ataaaagaaa agactggcta tgcagtcctt tcccgc 46

<210>67

<211>51

<212>DNA

<213> Artificial Synthesis

<400>67

tcgagcagga caccgttcaa attgaacggt gtttttcttt gaaaaggagc t 51

<210>68

<211>43

<212>DNA

<213> Artificial Synthesis

<400>68

ccttttcaaa gaaaaacacc gttcaatttg aacggtgtcc tgc 43

<210>69

<211>62

<212>DNA

<213> Artificial Synthesis

<400>69

gagctccaaa agaggagtta gtgcctctgc tcaggcacta ctcctctttt tgggattttc 60

tg 62

<210>70

<211>72

<212>DNA

<213> Artificial Synthesis

<400>70

gatccagaaa atcccaaaaa gaggagtagt gcctgagcag aggcactaac tcctcttttg 60

gagctcggac tc 72

<210>71

<211>34

<212>DNA

<213> Artificial Synthesis

<400>71

aattcgagta ggctacacct actctttgtg agct 34

<210>72

<211>26

<212>DNA

<213> Artificial Synthesis

<400>72

cacaaagagt aggtgtagcc tactcg 26

<210>73

<211>51

<212>DNA

<213> Artificial Synthesis

<400>73

aattccagga caccgttcaa attgaacggt gtttttcttt gaaaaggagc t 51

<210>74

<211>43

<212>DNA

<213> Artificial Synthesis

<400>74

ccttttcaaa gaaaaacacc gttcaatttg aacggtgtcc tgg 43

<210>75

<211>87

<212>DNA

<213> Artificial Synthesis

<400>75

caaataaaac gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg 60

gtgaacgctc tcctgagtag gacaaat 87

<210>76

<211>93

<212>DNA

<213> Artificial Synthesis

<400>76

gatcatttgt cctactcagg agagcgttca ccgacaaaca acagataaaa cgaaaggccc 60

agtctttcga ctgagccttt cgttttattt ggc 93

<210>77

<211>60

<212>DNA

<213> Artificial Synthesis

<400>77

caggacaccg ttcaaattga acggtgtttt tctttgaaaa gtctgtgcgg tatttcacac 60

<210>78

<211>42

<212>DNA

<213> Artificial Synthesis

<400>78

ccgttcaatt tgaacggtgt cctgatgcct ctagcacgcg ta 42

<210>79

<211>45

<212>DNA

<213> Artificial Synthesis

<400>79

acaaactgcc cggtcctacg gtacgggttc tttttcatta ttgga 45

<210>80

<211>51

<212>DNA

<213> Artificial Synthesis

<400>80

gatctccaat aatgaaaaag aacccgtacc gtaggaccgg gcagtttgtg c 51

<210>81

<211>20

<212>DNA

<213> Artificial Synthesis

<400>81

tccgcgggat tacggatcct 20

Claims

1. An element for regulating gene expression, which is TB7, wherein the nucleotide sequences of TB7 are respectively shown in SEQ ID NO. 7.

2. A vector comprising the element of claim 1.

3. A genetically engineered bacterium expressing the vector of claim 3.

4. A method for regulating the expression of a protein of interest in bacillus subtilis, wherein the element of any one of claims 1 to 2 is co-expressed with the gene of the protein of interest.

5. The method of claim 4, wherein the Bacillus subtilis comprises Bacillus subtilis168, Bacillus subtilis WB400, Bacillus subtilis WB600, or Bacillus subtilis WB 800.

6. The method of claim 4, wherein the protein of interest comprises an enzyme.

7. Use of the element of claim 1 or the genetically engineered bacterium of claim 4 for the preparation of a protein of interest.

8. The use of the genetically engineered bacterium of claim 4 in the preparation of a protein of interest.

9. Use of the element according to claim 1 in the food, pharmaceutical or chemical field.

10. The genetically engineered bacterium of claim 4 for use in the fields of food, pharmaceutical or chemical industry.