CN109652418A

CN109652418A - A kind of new terminator and its application

Info

Publication number: CN109652418A
Application number: CN201811547733.1A
Authority: CN
Inventors: 周哲敏; 崔文璟; 周丽; 刘中美; 令狐梅
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2018-12-18
Filing date: 2018-12-18
Publication date: 2019-04-19
Anticipated expiration: 2038-12-18
Also published as: CN111718934A; CN111662906B; CN111690649B; CN111718934B; CN111662906A; CN111690649A; CN109652418B

Abstract

The invention discloses a kind of new terminator and its applications, belong to gene engineering technology field.The present invention first characterizes the activity of single terminator, concatenated mode is combined by the terminator of different activities, a series of novel terminators that destination protein yield can be improved are obtained, using green fluorescence protein gene as terminator upstream gene, using red fluorescent protein gene as terminator downstream gene, characterization terminator is horizontal to the regulation of upstream and downstream gene.The result shows that these novel terminators are for improving upstream gene expression quantity and downstream gene expression amount being inhibited to have good effect.This in bacillus subtilis produce destination protein have important application value.

Description

A kind of new terminator and its application

Technical field

The present invention relates to a kind of new terminator and its applications, belong to gene engineering technology field.

Background technique

Transcription terminator is located at the downstream of gene or operon, is responsible for the dissociation of RNA polymerase and releases the RNA of transcription To play one section of RNA sequence for terminating transcription.In prokaryotes, transcription terminator there are two types of type, one is albumen because Sub- dependent form needs the help competence exertion of these factors of Rho, NusA and tau to act on；Another kind be do not depend on any albumen because Son but rely on its own reversed palindromic sequence formed hairpin structure play a role.Transcription terminator due to its special two Level structure and feature positioned at target gene downstream play important in terms of maintaining mRNA stability and the half-life period for improving mRNA Effect: terminating transcription, discharges RNA polymerase, improves the utilization efficiency of RNA polymerase；As intervening sequence, in neighboar lists Up to the role for serving as insulation component between unit.

Before, prediction and identification aspect are concentrated mainly on for the research of terminator, and terminator is adjusting gene expression Or the effect in hereditary route, it just attracted attention in recent years.Terminator can not only prevent read-through, but also in raising The stability of trip mRNA has significant contribution.However, so far, most of terminator controlling element researchs are concentrated mainly on big In enterobacteria, only sub-fraction document refers to the application in other microorganisms, such as saccharomyces cerevisiae.

Bacillus subtilis (Bacillus subtilis) is that one kind is widely used as Food enzyme and important nutrient laden The production host of product, product are " generally regarded as safe " (GRAS) security level by FDA certification.Cause This, provides a kind of terminator that can regulate and control gene expression in bacillus subtilis, stabilization, high activity, for preparing purpose egg Albumen that is white, especially using in field of food has important application value.

Summary of the invention

The first purpose of the invention is to provide a kind of controlling gene expression element, be by TB1, TB2, TB3, TB4, Two or three in TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, ST1.5b or TB6S2 are gone here and there Connection, the TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, ST1.5b, The nucleotide sequence of TB6S2 is respectively as shown in SEQ ID NO.1-SEQ ID NO.16.

It in one embodiment of the invention, is by two or three in TB5, TB2, TB6S2, ST1.5b or TB10 It connects.

In one embodiment of the invention, which is characterized in that shown in the NO.18-SEQ ID of ID containing SEQ NO.29 Sequence.

A second object of the present invention is to provide a kind of carriers containing said elements.

Third object of the present invention is to provide the genetic engineering bacteriums for expressing above-mentioned carrier.

Fourth object of the present invention be to provide it is a kind of regulation bacillus subtilis in destination protein expression method, will weigh Benefit requires the 1-3 any element and destination protein gene co-expressing.

In one embodiment of the invention, the bacillus subtilis include Bacillus subtilis 168, Bacillus subtilis WB400, Bacillus subtilis WB600 or Bacillus subtilis WB800.

In one embodiment of the invention, the destination protein includes enzyme.

Fifth object of the present invention is to provide above-mentioned controlling elements or genetic engineering bacterium in preparing destination protein Using.

Sixth object of the present invention is to provide above-mentioned controlling elements or genetic engineering bacterium to lead in food, pharmacy or chemical industry The application in domain.

The present invention first characterizes the activity of single terminator, when discovery addition TB5 terminator is not than adding terminator, Upstream GFP expression quantity improves 1.68 times, and downstream mcherry expression quantity reduces 27.4 times.By by TB5 terminator and other Terminator is combined concatenated mode, has obtained a series of novel terminators that destination protein yield can be improved, glimmering with green Aequorin is as terminator upstream gene, using red fluorescent protein gene as terminator downstream gene, characterizes terminator It is horizontal to the regulation of upstream and downstream gene.The result shows that these novel terminators are for inhibiting downstream gene expression amount to have very well Effect, such as add TB2-TB5-TB5 terminator when, the downstream mcherry expression quantity than control has dropped 337.58 times.This is right Destination protein is produced in bacillus subtilis has important application value.

Detailed description of the invention

Fig. 1: test plasmid PBP43-GFP-mcherry PCR verifying, wherein M:DNA molecular weight standard；1: original matter Grain size；2:BamH I single endonuclease digestion post-fragment size；II single endonuclease digestion post-fragment size of 3:Sac.

Fig. 2: single terminator terminates the characterization of efficiency, wherein TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, ST1.5b be illustrated respectively in plasmid PBP43-GFP-mcherry GFP and mcherry it Between be inserted into terminator TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, After ST1.5b, the termination efficiency of each terminator of measurement.

Fig. 3: the characterization of single terminator upstream GFP fluorescence intensity, wherein GM is indicated referring to plasmid, TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, ST1.5b are illustrated respectively in plasmid PBP43-GFP- Terminator TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10 are inserted between the GFP and mcherry of mcherry, After ST1, ST2, ST3, ST1.5a, ST1.5b, the upstream GFP fluorescence intensity of each terminator of measurement.

Fig. 4: the characterization of single terminator downstream mcherry fluorescence intensity, wherein GM is indicated referring to plasmid, TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, ST1.5b are illustrated respectively in plasmid PBP43- Terminator TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, TB9 are inserted between the GFP and mcherry of GFP-mcherry, After TB10, ST1, ST2, ST3, ST1.5a, ST1.5b, the downstream mcherry fluorescence intensity of each terminator of measurement.

Fig. 5: series terminations terminates the characterization of efficiency, wherein TB6S2-TB10, TB5-TB10, TB6S2-TB10 and TB2- The termination efficiency of TB5 expression two-in-series terminator；Wherein TB6S2-ST1.5b-TB10, TB6S2-TB5-TB10, TB5- ST1.5b-TB10, TB5-TB5-TB10, TB6S2-ST1.5b-TB5, TB6S2-TB5-TB5, TB2-ST1.5b-TB5, TB2- The termination efficiency of TB5-TB5 expression three series terminations.

Fig. 6: the characterization of the sub- upstream GFP fluorescence intensity of series terminations, wherein TB6S2-TB10, TB5-TB10, TB6S2- TB10 and TB2-TB5 indicates the fluorescence intensity of two-in-series terminator upstream GFP；Wherein TB6S2-ST1.5b-TB10, TB6S2- TB5-TB10, TB5-ST1.5b-TB10, TB5-TB5-TB10, TB6S2-ST1.5b-TB5, TB6S2-TB5-TB5, TB2- The fluorescence intensity of ST1.5b-TB5, TB2-TB5-TB5 the expression sub- upstream GFP of three series terminations.

Fig. 7: the characterization of the sub- downstream mcherry fluorescence intensity of series terminations, wherein TB6S2-TB10, TB5-TB10, TB6S2-TB10 and TB2-TB5 indicates two-in-series terminator downstream mcherry fluorescence intensity；Wherein TB6S2-ST1.5b-TB10, TB6S2-TB5-TB10, TB5-ST1.5b-TB10, TB5-TB5-TB10, TB6S2-ST1.5b-TB5, TB6S2-TB5-TB5, TB2-ST1.5b-TB5, TB2-TB5-TB5 indicate the sub- downstream mcherry fluorescence intensity of three series terminations.

Fig. 8: terminator TB5 terminates the characterization of efficiency with rrnBT1, and wherein G-M-TB5 is as G-rrnBT1-M-TB5, and The control of G-TB5-M-TB5；Control of the G-M-rrnBT1 as G-rrnBT1-M-rrnBT1 and G-TB5-M-rrnBT1；G-M- TB5 and G-M-rrnBT1 indicates termination efficiency when terminator being not added between GFP and mcherry；G-rrnBT1-M-TB5 and The termination efficiency of G-rrnBT1-M-rrnBT1 expression terminator rrnBT1；G-TB5-M-TB5 and G-TB5-M-rrnBT1 is indicated eventually The only termination efficiency of sub- TB5.

Fig. 9: terminator TB5 indicates to exist with the characterization of the upstream rrnBT1 GFP fluorescence intensity, G-M-TB5 and G-M-rrnBT1 The fluorescence intensity of upstream GFP when terminator is not added；G-rrnBT1-M-TB5 and G-rrnBT1-M-rrnBT1 indicates terminator rrnBT1 The fluorescence intensity of upstream GFP；G-TB5-M-TB5 and G-TB5-M-rrnBT1 indicates the fluorescence intensity of terminator TB5 upstream GFP.

Figure 10: terminator TB5 with the characterization of the downstream rrnBT1 mcherry fluorescence intensity；G-M-TB5 and G-M-rrnBT1 table Show the fluorescence intensity of the downstream mcherry when terminator is not added；G-rrnBT1-M-TB5 and G-rrnBT1-M-rrnBT1 is indicated eventually The only fluorescence intensity of the sub- downstream rrnBT1 mcherry；G-TB5-M-TB5 and G-TB5-M-rrnBT1 indicates the downstream terminator TB5 The fluorescence intensity of mcherry.

Specific embodiment

(1) culture medium

LB culture medium (gL^-1): tryptone (Tryptone) 10；Yeast extract (Yeast extract) 5；Chlorination Sodium (NaCl) 10.

(2) 168 method for transformation of bacillus subtilis

It chooses single colonie bacillus subtilis 168 to be seeded in the SPI culture medium of 2mL, 37 DEG C of shaking table culture 12-14h；From training It supports in object and takes 100 μ L, be seeded in 5mL SPI culture medium, start to survey OD after 37 DEG C of shaking table culture 4-5h₆₀₀.Work as OD₆₀₀About When 1.0, pipettes 200 μ L bacterium solutions and be forwarded in the SPI culture medium of 2mL, in 37 DEG C, 100rmin^-1Shaking table is incubated for 1.5h；Xiang Guan 20 100 × EGTA of μ L of middle addition (bis- (alpha-amido ethylether) tetraacethyls of ethylene glycol) solution, in 37 DEG C, 100rmin^-1Shaking table 500 μ L are dispensed after middle culture 10min per l.5mL centrifuge tube；Xiang Guanzhong, which is added, passes through sequence verification correctly appropriate plasmid, pressure-vaccum Mixing is placed in 37 DEG C, 100rmin^-1Shaking table in cultivate 2h；Culture terminates, and draws about 200 μ L of bacterium solution and uniformly applies accordingly Selective plate, 37 DEG C are incubated overnight 12-14h.

(3) green fluorescent protein GFP fluorescence detection

It will test sample 12000g centrifugation 5min, collect thallus, PBS buffer solution is washed 3 times, is diluted to a certain concentration with PBS Thallus suspension, take 200 μ L to 96 hole elisa Plates, be put into Synergy TM H4 fluorescence microplate reader detection fluorescence.Program setting Are as follows: 600nm detects cell concentration；Exciting light 495nm emits light 525nm, gain 60, fluorescence intensity.

(4) red fluorescent protein mcherry fluorescence detection

12 000g of red fluorescent protein mcherry fluorescence detection sample is centrifuged 5min, collects thallus, and PBS buffer solution is washed 3 times, It is diluted to certain density thallus suspension with PBS, takes 200 μ L to 96 hole elisa Plates, is put into the detection of Synergy TM H4 fluorescence microplate reader Fluorescence.Program setting are as follows: 600nm detects cell concentration；Exciting light 587nm emits light 610nm, gain 80, fluorescence intensity.

(5) measuring method of efficiency is terminated

The ratio that we do not pass through the transcription elongation complex of termination subcomponent with efficiency (TE) quantization is terminated herein.It is broken The TE value of the termination subcomponent of the transcription complex of bad all arrival is 1.The TE of the intervening sequence of GFP and mcherry is 0.Cause Measurement TE value can not be directly used in for the protein level of the fluorescent reporter gene of expression.We use downstream mcherry (FI_DW) with Upstream GFP (FI_UP) fluorescence ratio estimate that terminator reads over rate (TR).That is TR=FI_DW/FI_UP.Use standardized test sequence Column (i.e. the intervening sequence of GFP and mcherry), which establish to refer to, reads over value (TR_REF), then all TR measured values are standardized: TR_NORM=TR/TR_REF, and estimation terminates efficiency, TE=1-TR in the following manner_NORM。

(6) referring to the construction method of plasmid PBP43-GFP-mcherry

By mcherry-rrnBT1 sequence (such as SEQ ID of company anamorphic zone intervening sequence TCCGCGGGATTACGGATCCT Shown in NO.30), with PBSG03, (construction method is shown in Guan C, Cui W, Cheng J, et al.Construction and development of an auto-regulatory gene expression systemin Bacillus subtilis [J] .Microbial Cell Factories, 2015,14 (1): 150) being template, and design has the primer of homologous sequence, will Mcherry-rrnBT1 sequence assembling is to the downstream of GFP gene, and sequencing obtains the plasmid of correct sequence, later again with this plasmid For template, srfA promoter is replaced with P43 promoter by design primer, and sequencing obtains the reference plasmid PBP43- of correct sequence GFP-mcherry。

Embodiment 1: single terminator plasmid construction and fluorescin recombinant expression

(1) primer sequence with restriction enzyme site is designed, is synthesized by company.

(2) primer sequence of synthesis (being shown in Table 1) is connected into double-strand through temperature gradient annealing, later by the DNA after annealing Double-stranded sequence connects with the segment T4 ligase obtained referring to plasmid PBP43-GFP-mcherry through II digestion of BamH I and Sac It connects, building carries the test plasmid PBP43-GFP-Term-mcherry of terminator (being shown in Table 2), and carries out DNA sequencing, and DNA is surveyed Sequence is the result shows that terminator is successfully connected to the digestion position between the GFP and mcherry of test plasmid PBP43-GFP-mcherry Point, plasmid enzyme restriction electrophoresis verifying such as Fig. 1, it was demonstrated that successfully construct new E.coli-B.subtilis shuttle vector.

(3) the correct recombinant plasmid of obtained sequence verification is transferred in bacillus subtilis 168, at 37 DEG C, stands training After supporting 12-14h, picking single bacterium is fallen in 5mL LB seed culture medium, and 37 DEG C are cultivated；By whole OD₆₀₀It is forwarded to and contains for 0.02 In the 250mL triangular flask of 50mL LB culture medium, 200rpm, 37 DEG C of temperature, culture is for 24 hours.

Measure the termination efficiency (Fig. 2 and table 3) and fluorescence intensity (Fig. 3, Fig. 4 of the terminator screened；Table 4, table 5), it says Bright difference terminator GFP and mcherry expression quantity has differences, and shows that different terminators has different characteristics.Wherein eventually The termination efficiency of only sub- TB4, TB5, TB6, TB7, TB9, ST1 are higher, and correspondingly, the expression quantity of these terminator upstreams GFP mentions Height, and mcherry expression in downstream is suppressed.Wherein, when addition TB5 terminator is not than adding terminator, upstream GFP expression quantity 1.68 times are improved, downstream mcherry expression quantity reduces 27.4 times.

1 primer table of table

The single terminator sequence of table 2

The single terminator of table 3 terminates efficiency

The single terminator of table 4 upstream GFP fluorescence intensity

Terminator title	Upstream GFP fluorescence intensity (Fl_GFP/OD₆₀₀)
		It compares (GM)	4930
ST1	13369
		ST1.5a	11112
ST1.5b	6752
		ST2	6687
ST3	11647
		TB1	5088
TB2	8906
		TB3	4670
TB4	10897
		TB5	13203
TB6	11933
		TB7	13689
TB8	10645
		TB9	12658
TB10	6914
		TB6S2	5659

The single terminator of table 5 downstream mcherry fluorescence intensity

Embodiment 2: two-in-series and the sub- plasmid construction of three series terminations and fluorescin recombinant expression

(1) it is synthesized by company with BamH I, Sac II, the primer sequence (being shown in Table 1) of XhoI and SacI restriction enzyme site.

(2) building of two-in-series terminator plasmid: four terminator sequences for being used for two-in-series are annealed through temperature gradient Connect into double-strand, later by after annealing DNA double chain with referring to plasmid PBP43-GFP-mcherry through II enzyme of BamH I and Sac The segment cut is connected with T4 ligase, obtains the test plasmid PBP43-GFP- for carrying two-in-series series terminations (table 6) Terms-mcherry, and DNA sequencing is carried out, DNA sequencing is successfully connected to test plasmid PBP43- the result shows that terminating sub-piece Restriction enzyme site between the GFP and mcherry of GFP-mcherry, new E.coli-B.subtilis shuttle vector building Success.

(3) constructed on the basis of two-in-series terminator plasmid three series terminations: by company synthesize with XhoI with The primer sequence (table 1) of sequence after SacI digestion.The terminator sequence of synthesis is connected into double-strand through temperature gradient annealing, later The piece that DNA double chain after annealing is obtained with two-in-series plasmid PBP43-GFP-Terms-mcherry through XhoI and SacI digestion Section is connected with T4 ligase, and building carries the test plasmid PBP43-GFP-Terms-mcherry of terminator, and carries out DNA survey Sequence, DNA sequencing the result shows that three series terminations (table 6) be successfully connected to test plasmid PBP43-GFP-mcherry GFP and Restriction enzyme site between mcherry, new E.coli-B.subtilis shuttle vector construct successfully.

(3) the correct recombinant plasmid of obtained sequence verification is transferred in bacillus subtilis 168, at 37 DEG C, stands training After supporting 12-14h, picking single bacterium is fallen in 5mL LB seed culture medium, and 37 DEG C are cultivated；By whole OD₆₀₀It is forwarded to and contains for 0.02 In the 250mL triangular flask of 50mL LB culture medium, 200rpm, is cultivated 24 hours by 37 DEG C of temperature.

Measure termination efficiency (Fig. 5 of the two-in-series and three series terminations that screen；Table 7) and fluorescence intensity (Fig. 6, Fig. 7 With table 7, table 8), illustrate that the termination efficiency of terminator can be substantially change by different series systems.For example, by will be weak The termination efficiency of terminator can be improved with connecting for strong terminator (TB5) in terminator (TB10, TB6S2, TB2), is had Difference terminates the novel terminator of efficiency, enriches and terminates library.

Novel promoter to the inhibitory effect of downstream gene expression can more preferably, such as add TB2-TB5-TB5 terminator when, than The downstream mcherry expression quantity of control has dropped 337.58 times.By this three series system, complete inhibition transcription can achieve It reads over, so that downstream mcherry is hardly expressed, it can be to avoid some meaningless transcriptions, thus maximum in gene expression The utilization of the raising resource intracellular of limit.

6 two-in-series of table, three series terminations subsequence tables

7 two-in-series of table and three series terminations terminate efficiency

Terminator	Terminate efficiency
		TB6S2-TB10	0.65
TB6S2-ST1.5b-TB10	0.67
		TB6S2-TB5-TB10	0.90
TB5-TB10	0.95
		TB5-ST1.5b-TB10	0.95
TB5-TB5-TB10	0.99
		TB6S2-TB5	0.82
TB6S2-ST1.5b-TB5	0.82
		TB6S2-TB5-TB5	0.97
TB2-TB5	0.98
		TB2-ST1.5b-TB5	0.99
TB2-TB5-TB5	0.9

8 two-in-series of table and the sub- upstream GFP fluorescence intensity of three series terminations

Terminator	Upstream GFP fluorescence intensity (Fl_GFP/OD₆₀₀)
		TB6S2-TB10	6732
TB6S2-ST1.5b-TB10	6658
		TB6S2-TB5-TB10	8275
TB5-TB10	11604
		TB5-ST1.5b-TB10	11201
TB5-TB5-TB10	11482
		TB6S2-TB5	8125
TB6S2-ST1.5b-TB5	7745
		TB6S2-TB5-TB5	8844
TB2-TB5	10720
		TB2-ST1.5b-TB5	9259
TB2-TB5-TB5	10049

9 two-in-series of table and the sub- downstream mcherry fluorescence intensity of three series terminations

Terminator	Downstream mcherry fluorescence intensity (Fl_mcherry/OD₆₀₀)
		TB6S2-TB10	5696
TB6S2-ST1.5b-TB10	5534
		TB6S2-TB5-TB10	1971
TB5-TB10	1578
		TB5-ST1.5b-TB10	1416
TB5-TB5-TB10	196
		TB6S2-TB5	3599
TB6S2-ST1.5b-TB5	3455
		TB6S2-TB5-TB5	562
TB2-TB5	438
		TB2-ST1.5b-TB5	112
TB2-TB5-TB5	45

Embodiment 3: the terminator TB5 screened is compared with the feature of common terminator rrnBT1

(1) building of plasmid PBP43-GFP-rrnBT1-mcherry: using plasmid PBP43-GFP-mcherry as template, The single-stranded rrnBT1 terminator sequence of company's synthesis is connected into double-strand through temperature gradient annealing, it is later that the double-strand after annealing is whole Only subsequence connect digestion connection with T4 with the segment that plasmid PBP43-GFP-mcherry is obtained through II digestion of BamH I and Sac It connects, constructs plasmid PBP43-GFP-rrnBT1-mcherry；

(2) building of plasmid PBP43-GFP-mcherry-TB5: using reference plasmid PBP43-GFP-mcherry as template, The design of TB5 terminator sequence on primer, the terminator rrnBT1 in the downstream mcherry is replaced with by end by full plasmid PCR Only sub- TB5 constructs plasmid PBP43-GFP-mcherry-TB5；

(3) building of plasmid PBP43-GFP-rrnBT1-mcherry-TB5: with plasmid PBP43-GFP-mcherry-TB5 For template, the single-stranded rrnBT1 terminator sequence of company's synthesis is connected into double-strand through temperature gradient annealing, after annealing later Double-strand terminator sequence and the segment T4 that is obtained through II digestion of BamH I and Sac of plasmid PBP43-GFP-mcherry-TB5 Ligase connection, constructs plasmid PBP43-GFP-rrnBT1-mcherry-TB5；

(4) building of plasmid PBP43-GFP-TB5-mcherry-TB5: it is with plasmid PBP43-GFP-mcherry-TB5 The single-stranded TB5 terminator sequence of company's synthesis is connected into double-strand through temperature gradient annealing, later by the double-strand after annealing by template The segment T4 ligase that terminator sequence and plasmid PBP43-GFP-mcherry-TB5 are obtained through II digestion of BamH I and Sac Connection constructs plasmid PBP43-GFP-TB5-mcherry-TB5；

(5) the correct recombinant plasmid of obtained sequence verification is transferred in bacillus subtilis 168, at 37 DEG C, stands training After supporting 12-14h, picking single bacterium is fallen in 5mL LB seed culture medium, and 37 DEG C are cultivated；By whole OD₆₀₀It is forwarded to and contains for 0.02 In the 250mL triangular flask of 50mL LB culture medium, 200rpm, is cultivated 24 hours by 37 DEG C of temperature.Measure the termination efficiency of terminator (Fig. 8；Table 10) and fluorescence intensity (Fig. 9, Figure 10 and table 11 and table 12), wherein G-M-TB5 is G-rrnB1-M-TB5 and G-TB5- The reference of M-TB5, wherein G-M-rrnB1 is the reference of G-rrnB1-M-rrnB1 and G-TB5-M-rrnB1, fluorescence detection result Show that the termination efficiency of the terminator TB5 of screening is higher than common terminator rrnBT1, while the inhibition to downstream mcherry expression Effect is more preferable.

10 terminator TB5 of table is compared with the termination efficiency of rrnBT1

11 terminator TB5 of table is compared with the upstream GFP fluorescence intensity of rrnBT1

Plasmid	Upstream GFP fluorescence intensity (Fl_GFP/OD₆₀₀)
		PBP43-GFP-mcherry-TB5(G-M-TB5)	9485
PBP43-GFP-rrnBT1-mcherry-TB5(G-rrnBT1-M-TB5)	18433
		PBP43-GFP-TB5-mcherry-TB5(G-TB5-M-TB5)	21708
PBP43-GFP-mcherry-rrnBT1(G-M-rrnBT1)	9841
		PBP43-GFP-rrnBT1-mcherry-rrnBT1(G-rrnBT1-M-rrnBT1)	18975
PBP43-GFP-TB5-mcherry-rrnBT1(G-TB5-M-rrnBT1)	23465

12 terminator TB5 of table is compared with the downstream mcherry fluorescence intensity of rrnBT1

Plasmid	Downstream mcherry fluorescence intensity (Fl_mcherry/OD₆₀₀)
		PBP43-GFP-mcherry-TB5(G-M-TB5)	11091
PBP43-GFP-rrnBT1-mcherry-TB5(G-rrnBT1-M-TB5)	3592
		PBP43-GFP-TB5-mcherry-TB5(G-TB5-M-TB5)	639
PBP43-GFP-mcherry-rrnBT1(G-M-rrnBT1)	11275
		PBP43-GFP-rrnBT1-mcherry-rrnBT1(G-rrnBT1-M-rrnBT1)	3629
PBP43-GFP-TB5-mcherry-rrnBT1(G-TB5-M-rrnBT1)	655

Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention Enclosing subject to the definition of the claims.

SEQUENCE LISTING

<110>Southern Yangtze University

<120>a kind of new terminator and its application

<160> 81

<170> PatentIn version 3.3

<210> 1

<211> 44

<212> DNA

<213>artificial synthesized

<400> 1

caaacagcgg gaggatacag ccaattcttt tttttatgct ataa 44

<210> 2

<211> 36

<212> DNA

<213>artificial synthesized

<400> 2

gaaaggactg catagccagt cttttctttt atttta 36

<210> 3

<211> 49

<212> DNA

<213>artificial synthesized

<400> 3

taatagaatg gtatttaaat gagaatgcta tcaatttttt gtagtcagc 49

<210> 4

<211> 40

<212> DNA

<213>artificial synthesized

<400> 4

agaaaccggt ctggctgcca gccggtttct ttttttattc 40

<210> 5

<211> 41

<212> DNA

<213>artificial synthesized

<400> 5

caggacaccg ttcaaattga acggtgtttt tctttgaaaa g 41

<210> 6

<211> 45

<212> DNA

<213>artificial synthesized

<400> 6

acaaagctgc attcaatagt tgaatgcagc tttttcatta ttgga 45

<210> 7

<211> 82

<212> DNA

<213>artificial synthesized

<400> 7

gtgaacattt gaaatccggc cctctctata gtatccttta cttcagatga aggatactag 60

agggggcttt ttttatgtca at 82

<210> 8

<211> 62

<212> DNA

<213>artificial synthesized

<400> 8

agcaaggact gctgaaaggg ctgacataag ccttttgccg gcggtccttt tttaattctg 60

at 62

<210> 9

<211> 47

<212> DNA

<213>artificial synthesized

<400> 9

ctcaatccct tggcactaaa agtgtcaggg gattttttat gttaata 47

<210> 10

<211> 55

<212> DNA

<213>artificial synthesized

<400> 10

caaaagagga gttagtgcct ctgctcaggc actactcctc tttttgggat tttct 55

<210> 11

<211> 28

<212> DNA

<213>artificial synthesized

<400> 11

ccctcctgta ctaggagggt attttttt 28

<210> 12

<211> 26

<212> DNA

<213>artificial synthesized

<400> 12

gggagcctca aggctccctt tagttt 26

<210> 13

<211> 30

<212> DNA

<213>artificial synthesized

<400> 13

gatcacaaag agtaggtgta gcctactcgc 30

<210> 14

<211> 26

<212> DNA

<213>artificial synthesized

<400> 14

gggcgggtct tcccgcccta cttttt 26

<210> 15

<211> 37

<212> DNA

<213>artificial synthesized

<400> 15

tgccctgaat ggcttagttg ctgttcaggg cattttt 37

<210> 16

<211> 45

<212> DNA

<213>artificial synthesized

<400> 16

acaaactgcc cggtcctacg gtacgggttc tttttcatta ttgga 45

<210> 17

<211> 87

<212> DNA

<213>artificial synthesized

<400> 17

caaataaaac gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg 60

gtgaacgctc tcctgagtag gacaaat 87

<210> 18

<211> 130

<212> DNA

<213>artificial synthesized

<400> 18

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgaggag 60

tccgagctcc aaaagaggag ttagtgcctc tgctcaggca ctactcctct ttttgggatt 120

ttctggatcc 130

<210> 19

<211> 126

<212> DNA

<213>artificial synthesized

<400> 19

ccgcggcagg acaccgttca aattgaacgg tgtttttctt tgaaaagctc gaggagtccg 60

agctccaaaa gaggagttag tgcctctgct caggcactac tcctcttttt gggattttct 120

ggatcc 126

<210> 20

<211> 116

<212> DNA

<213>artificial synthesized

<400> 20

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgaggag 60

tccgagctcc aggacaccgt tcaaattgaa cggtgttttt ctttgaaaag ggatcc 116

<210> 21

<211> 107

<212> DNA

<213>artificial synthesized

<400> 21

ccgcgggaaa ggactgcata gccagtcttt tcttttattt tactcgagga gtccgagctc 60

caggacaccg ttcaaattga acggtgtttt tctttgaaaa gggatcc 107

<210> 22

<211> 125

<212> DNA

<213>artificial synthesized

<400> 22

ccgcgggaaa ggactgcata gccagtcttt tcttttattt tactcgagga gtaggctaca 60

cctactcttt gtgagctcca ggacaccgtt caaattgaac ggtgtttttc tttgaaaagg 120

gatcc 125

<210> 23

<211> 142

<212> DNA

<213>artificial synthesized

<400> 23

ccgcgggaaa ggactgcata gccagtcttt tcttttattt tactcgagca ggacaccgtt 60

caaattgaac ggtgtttttc tttgaaaagg agctccagga caccgttcaa attgaacggt 120

gtttttcttt gaaaagggat cc 142

<210> 24

<211> 144

<212> DNA

<213>artificial synthesized

<400> 24

ccgcggcagg acaccgttca aattgaacgg tgtttttctt tgaaaagctc gaggagtagg 60

ctacacctac tctttgtgag ctccaaaaga ggagttagtg cctctgctca ggcactactc 120

ctctttttgg gattttctgg atcc 144

<210> 25

<211> 161

<212> DNA

<213>artificial synthesized

<400> 25

ccgcggcagg acaccgttca aattgaacgg tgtttttctt tgaaaagctc gagcaggaca 60

ccgttcaaat tgaacggtgt ttttctttga aaaggagctc caaaagagga gttagtgcct 120

ctgctcaggc actactcctc tttttgggat tttctggatc c 161

<210> 26

<211> 148

<212> DNA

<213>artificial synthesized

<400> 26

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgaggag 60

taggctacac ctactctttg tgagctccaa aagaggagtt agtgcctctg ctcaggcact 120

actcctcttt ttgggatttt ctggatcc 148

<210> 27

<211> 165

<212> DNA

<213>artificial synthesized

<400> 27

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgagcag 60

gacaccgttc aaattgaacg gtgtttttct ttgaaaagga gctccaaaag aggagttagt 120

gcctctgctc aggcactact cctctttttg ggattttctg gatcc 165

<210> 28

<211> 134

<212> DNA

<213>artificial synthesized

<400> 28

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgaggag 60

taggctacac ctactctttg tgagctccag gacaccgttc aaattgaacg gtgtttttct 120

ttgaaaaggg atcc 134

<210> 29

<211> 151

<212> DNA

<213>artificial synthesized

<400> 29

ccgcggacaa actgcccggt cctacggtac gggttctttt tcattattgg actcgagcag 60

gacaccgttc aaattgaacg gtgtttttct ttgaaaagga gctccaggac accgttcaaa 120

ttgaacggtg tttttctttg aaaagggatc c 151

<210> 30

<211> 880

<212> DNA

<213>artificial synthesized

<400> 30

tccgcgggat tacggatcct aaacacaata gatagcagta gaaggaggta gagtatggtt 60

tctaaaggcg aagaagataa catggctatc atcaaagaat tcatgcgttt caaagttcat 120

atggaaggct ctgttaacgg ccatgaattc gaaatcgaag gcgaaggcga aggccgtcct 180

tacgaaggca cacaaacagc taaacttaaa gttacaaaag gcggccctct tcctttcgct 240

tgggatatcc tttctcctca attcatgtac ggctctaaag cttacgttaa acatcctgct 300

gatatccctg attaccttaa actttctttc cctgaaggct tcaaatggga acgtgttatg 360

aacttcgaag atggcggcgt tgttacagtt acacaagatt cttctcttca agatggcgaa 420

ttcatctaca aagttaaact tcgtggcaca aacttccctt ctgatggccc tgttatgcaa 480

aaaaaaacaa tgggctggga agcttcttct gaacgtatgt accctgaaga tggcgctctt 540

aaaggcgaaa tcaaacaacg tcttaaactt aaagatggcg gccattacga tgctgaagtt 600

aaaacaacat acaaagctaa aaaacctgtt caacttcctg gcgcttacaa cgttaacatc 660

aaacttgata tcacatctca taacgaagat tacacaatcg ttgaacaata cgaacgtgct 720

gaaggccgtc attctacagg cggcatggat gaactttaca aataagggcc catggtacgc 780

gtgctagagg catcaaataa aacgaaaggc tcagtcgaaa gactgggcct ttcgttttat 840

ctgttgtttg tcggtgaacg ctctcctgag taggacaaat 880

<210> 31

<211> 44

<212> DNA

<213>artificial synthesized

<400> 31

caaacagcgg gaggatacag ccaattcttt tttttatgct ataa 44

<210> 32

<211> 50

<212> DNA

<213>artificial synthesized

<400> 32

gatcttatag cataaaaaaa agaattggct gtatcctccc gctgtttggc 50

<210> 33

<211> 36

<212> DNA

<213>artificial synthesized

<400> 33

gaaaggactg catagccagt cttttctttt atttta 36

<210> 34

<211> 42

<212> DNA

<213>artificial synthesized

<400> 34

gatctaaaat aaaagaaaag actggctatg cagtcctttc gc 42

<210> 35

<211> 49

<212> DNA

<213>artificial synthesized

<400> 35

taatagaatg gtatttaaat gagaatgcta tcaatttttt gtagtcagc 49

<210> 36

<211> 55

<212> DNA

<213>artificial synthesized

<400> 36

gatcgctgac tacaaaaaat tgatagcatt ctcatttaaa taccattcta ttagc 55

<210> 37

<211> 40

<212> DNA

<213>artificial synthesized

<400> 37

agaaaccggt ctggctgcca gccggtttct ttttttattc 40

<210> 38

<211> 46

<212> DNA

<213>artificial synthesized

<400> 38

gatcgaataa aaaaagaaac cggctggcag ccagaccggt ttctgc 46

<210> 39

<211> 41

<212> DNA

<213>artificial synthesized

<400> 39

caggacaccg ttcaaattga acggtgtttt tctttgaaaa g 41

<210> 40

<211> 47

<212> DNA

<213>artificial synthesized

<400> 40

gatccttttc aaagaaaaac accgttcaat ttgaacggtg tcctggc 47

<210> 41

<211> 45

<212> DNA

<213>artificial synthesized

<400> 41

acaaagctgc attcaatagt tgaatgcagc tttttcatta ttgga 45

<210> 42

<211> 51

<212> DNA

<213>artificial synthesized

<400> 42

gatctccaat aatgaaaaag ctgcattcaa ctattgaatg cagctttgtg c 51

<210> 43

<211> 82

<212> DNA

<213>artificial synthesized

<400> 43

gtgaacattt gaaatccggc cctctctata gtatccttta cttcagatga aggatactag 60

agggggcttt ttttatgtca at 82

<210> 44

<211> 88

<212> DNA

<213>artificial synthesized

<400> 44

gatcattgac ataaaaaaag ccccctctag tatccttcat ctgaagtaaa ggatactata 60

gagagggccg gatttcaaat gttcacgc 88

<210> 45

<211> 62

<212> DNA

<213>artificial synthesized

<400> 45

agcaaggact gctgaaaggg ctgacataag ccttttgccg gcggtccttt tttaattctg 60

at 62

<210> 46

<211> 68

<212> DNA

<213>artificial synthesized

<400> 46

gatcatcaga attaaaaaag gaccgccggc aaaaggctta tgtcagccct ttcagcagtc 60

cttgctgc 68

<210> 47

<211> 47

<212> DNA

<213>artificial synthesized

<400> 47

ctcaatccct tggcactaaa agtgtcaggg gattttttat gttaata 47

<210> 48

<211> 53

<212> DNA

<213>artificial synthesized

<400> 48

gatctattaa cataaaaaat cccctgacac ttttagtgcc aagggattga ggc 53

<210> 49

<211> 55

<212> DNA

<213>artificial synthesized

<400> 49

caaaagagga gttagtgcct ctgctcaggc actactcctc tttttgggat tttct 55

<210> 50

<211> 61

<212> DNA

<213>artificial synthesized

<400> 50

gatcagaaaa tcccaaaaag aggagtagtg cctgagcaga ggcactaact cctcttttgg 60

c 61

<210> 51

<211> 28

<212> DNA

<213>artificial synthesized

<400> 51

ccctcctgta ctaggagggt attttttt 28

<210> 52

<211> 34

<212> DNA

<213>artificial synthesized

<400> 52

gatcaaaaaa ataccctcct agtacaggag gggc 34

<210> 53

<211> 26

<212> DNA

<213>artificial synthesized

<400> 53

gggagcctca aggctccctt tagttt 26

<210> 54

<211> 32

<212> DNA

<213>artificial synthesized

<400> 54

gatcaaacta aagggagcct tgaggctccc gc 32

<210> 55

<211> 24

<212> DNA

<213>artificial synthesized

<400> 55

gagtaggcta cacctactct ttgt 24

<210> 56

<211> 30

<212> DNA

<213>artificial synthesized

<400> 56

gatcacaaag agtaggtgta gcctactcgc 30

<210> 57

<211> 26

<212> DNA

<213>artificial synthesized

<400> 57

gggcgggtct tcccgcccta cttttt 26

<210> 58

<211> 32

<212> DNA

<213>artificial synthesized

<400> 58

gatcaaaaag tagggcggga agacccgccc gc 32

<210> 59

<211> 37

<212> DNA

<213>artificial synthesized

<400> 59

tgccctgaat ggcttagttg ctgttcaggg cattttt 37

<210> 60

<211> 43

<212> DNA

<213>artificial synthesized

<400> 60

gatcaaaaat gccctgaaca gcaactaagc cattcagggc agc 43

<210> 61

<211> 55

<212> DNA

<213>artificial synthesized

<400> 61

ggcaggacac cgttcaaatt gaacggtgtt tttctttgaa aagctcgagg agtcc 55

<210> 62

<211> 51

<212> DNA

<213>artificial synthesized

<400> 62

ctcgagcttt tcaaagaaaa acaccgttca atttgaacgg tgtcctgccg c 51

<210> 63

<211> 59

<212> DNA

<213>artificial synthesized

<400> 63

ggacaaactg cccggtccta cggtacgggt tctttttcat tattggactc gaggagtcc 59

<210> 64

<211> 55

<212> DNA

<213>artificial synthesized

<400> 64

ctcgagtcca ataatgaaaa agaacccgta ccgtaggacc gggcagtttg tccgc 55

<210> 65

<211> 50

<212> DNA

<213>artificial synthesized

<400> 65

gggaaaggac tgcatagcca gtcttttctt ttattttact cgaggagtcc 50

<210> 66

<211> 46

<212> DNA

<213>artificial synthesized

<400> 66

ctcgagtaaa ataaaagaaa agactggcta tgcagtcctt tcccgc 46

<210> 67

<211> 51

<212> DNA

<213>artificial synthesized

<400> 67

tcgagcagga caccgttcaa attgaacggt gtttttcttt gaaaaggagc t 51

<210> 68

<211> 43

<212> DNA

<213>artificial synthesized

<400> 68

ccttttcaaa gaaaaacacc gttcaatttg aacggtgtcc tgc 43

<210> 69

<211> 62

<212> DNA

<213>artificial synthesized

<400> 69

gagctccaaa agaggagtta gtgcctctgc tcaggcacta ctcctctttt tgggattttc 60

tg 62

<210> 70

<211> 72

<212> DNA

<213>artificial synthesized

<400> 70

gatccagaaa atcccaaaaa gaggagtagt gcctgagcag aggcactaac tcctcttttg 60

gagctcggac tc 72

<210> 71

<211> 34

<212> DNA

<213>artificial synthesized

<400> 71

aattcgagta ggctacacct actctttgtg agct 34

<210> 72

<211> 26

<212> DNA

<213>artificial synthesized

<400> 72

cacaaagagt aggtgtagcc tactcg 26

<210> 73

<211> 51

<212> DNA

<213>artificial synthesized

<400> 73

aattccagga caccgttcaa attgaacggt gtttttcttt gaaaaggagc t 51

<210> 74

<211> 43

<212> DNA

<213>artificial synthesized

<400> 74

ccttttcaaa gaaaaacacc gttcaatttg aacggtgtcc tgg 43

<210> 75

<211> 87

<212> DNA

<213>artificial synthesized

<400> 75

caaataaaac gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg 60

gtgaacgctc tcctgagtag gacaaat 87

<210> 76

<211> 93

<212> DNA

<213>artificial synthesized

<400> 76

gatcatttgt cctactcagg agagcgttca ccgacaaaca acagataaaa cgaaaggccc 60

agtctttcga ctgagccttt cgttttattt ggc 93

<210> 77

<211> 60

<212> DNA

<213>artificial synthesized

<400> 77

caggacaccg ttcaaattga acggtgtttt tctttgaaaa gtctgtgcgg tatttcacac 60

<210> 78

<211> 42

<212> DNA

<213>artificial synthesized

<400> 78

ccgttcaatt tgaacggtgt cctgatgcct ctagcacgcg ta 42

<210> 79

<211> 45

<212> DNA

<213>artificial synthesized

<400> 79

acaaactgcc cggtcctacg gtacgggttc tttttcatta ttgga 45

<210> 80

<211> 51

<212> DNA

<213>artificial synthesized

<400> 80

gatctccaat aatgaaaaag aacccgtacc gtaggaccgg gcagtttgtg c 51

<210> 81

<211> 20

<212> DNA

<213>artificial synthesized

<400> 81

tccgcgggat tacggatcct 20

Claims

1. a kind of element of controlling gene expression, which is characterized in that be by TB1, TB2, TB3, TB4, TB5, TB6, TB7, TB8, Two or three in TB9, TB10, ST1, ST2, ST3, ST1.5a, ST1.5b or TB6S2 are connected, the TB1, TB2, The nucleotide sequence of TB3, TB4, TB5, TB6, TB7, TB8, TB9, TB10, ST1, ST2, ST3, ST1.5a, ST1.5b, TB6S2 Respectively as shown in SEQ ID NO.1-SEQ ID NO.16.

2. element as described in claim 1, which is characterized in that be by two in TB5, TB2, TB6S2, ST1.5b or TB10 Or three connected.

3. element as claimed in claim 1 or 2, which is characterized in that sequence shown in the NO.18-SEQ ID of ID containing SEQ NO.29 Column.

4. the carrier containing any element of claim 1-3.

5. expressing the genetic engineering bacterium of carrier described in claim 4.

6. a kind of method of destination protein expression in regulation bacillus subtilis, which is characterized in that by any institute of claim 1-3 The element and destination protein gene co-expressing stated.

7. method as claimed in claim 6, which is characterized in that the bacillus subtilis includes Bacillus subtilis 168, Bacillus subtilis WB400, Bacillus subtilis WB600 or Bacillus subtilis WB800.

8. method as claimed in claim 6, which is characterized in that the destination protein includes enzyme.

9. genetic engineering bacterium described in claim the 1-3 any element or claim 5 is in preparing destination protein Using.

10. genetic engineering bacterium described in claim the 1-3 any element or claim 5 is in food, pharmacy or chemical industry The application in field.