CN111647597A

CN111647597A - siRNA for inhibiting expression of hsa _ circ _0027479 and application thereof

Info

Publication number: CN111647597A
Application number: CN202010086545.4A
Authority: CN
Inventors: 何越峰; 王萌婕; 谭婧文; 孙明军; 平妮娜; 蒋成兰; 李舒婷
Original assignee: Kunming Medical University
Current assignee: Qilu Zhongke Anlan Technology Shandong Co ltd
Priority date: 2020-02-11
Filing date: 2020-02-11
Publication date: 2020-09-11
Anticipated expiration: 2040-02-11
Also published as: CN111647597B

Abstract

The invention discloses a nucleotide for inhibiting the expression of human hsa _ circ _0027479 circular RNA and application thereof, which is characterized in that: the nucleotide specifically binds to human hsa _ circ _0027479 circular RNA, the sequence of the nucleotide consisting of 18-22 consecutive nucleotides of the AAAUUCUUGGGACCCUGAUGCUC sequence or the complementary sequence, in particular it comprises the sequence: AAAUUCUUGGGACCCUGAU, and UCUUGGGACCCUGAUGCUC. The invention can inhibit the human hsa _ circ _0027479 circular RNA, can effectively inhibit the expression of hsa _ circ _0027479 circular RNA in A549 cells and XWLC-05 cells, can increase the inhibition of the growth and the proliferation of the human hsa _ circ _0027479 circular RNA by combining with the antitumor drug, and thus can effectively treat various tumors.

Description

siRNA for inhibiting expression of hsa _ circ _0027479 and application thereof

Technical Field

The invention belongs to the field of medical material technology and medicine, in particular to cyclic RNAs nucleotide, and especially relates to human cyclic RNAs nucleotide. The nucleotide can be complementary with hsa _ circ _0027479, thereby inhibiting the expression of human hsa _ circ _0027479 and playing the role of anti-tumor with other anti-tumor drugs.

Background

The CircRNA is a closed-loop, non-coding RNA formed by reverse splicing of exons or introns. The CircRNA is mainly present in cytoplasm and can be classified into exon-derived circular RNA, intron-derived circular RNA, and circular RNA formed of both an intron and an exon, depending on the origin and the sequence constituting the genome. The CircRNA can not only regulate gene expression, but also play a special role in the process of generating and developing tumors as a protooncogene and an anti-cancer gene.

The expression difference of the CircRNA in tumor tissues and paracancer normal tissues is obvious, and the CircRNA can be used as a micro RNAs sponge, can regulate the expression of parent genes, can interact with RNA binding protein and the like to play a role in the aspects of tumor cell cycle, apoptosis, angiogenesis, invasion and the like. The most classical action of the CircRNA is a sponge-like action, and the negative regulation effect of the miRNA on a target gene is inhibited by competitively combining a plurality of miRNAs, so that a CircRNA-miRNA-mRNA regulation network is formed to regulate the generation and development of tumors. In addition, the CircRNA can promote tumor development by combining and regulating oncogenic protein, and the generation process of the CicRNA competes with linear splicing to influence the linear gene expression of the CicRNA, thereby creating favorable conditions for tumorigenesis.

circRNAs are an important component of the tumor defense system, and aberrant expression thereof may be an early critical event for tumor initiation. The polypeptide can be used as a molecular marker or a potential treatment target of tumors, and provides a new target for early diagnosis, curative effect evaluation, prognosis prediction and tumor gene treatment of tumors. .

The RNA interference (RNAi) technology utilizes small double-stranded RNA to efficiently and specifically degrade intracellular homologous RNA to silence a target gene, thereby achieving the function of interfering the target gene.

Disclosure of Invention

The invention aims to provide siRNA capable of specifically and efficiently inhibiting expression of hsa _ circ _0027479 and application thereof.

The object of the invention is achieved in that the sequence comprising synthetic nucleotides consists of a sequence of 18 to 22 consecutive nucleotides of the sequence AAAUUCUUGGGACCCUGAUGCUC (SEQ ID NO.1) or a sequence of 18 to 22 consecutive nucleotides of the complementary sequence. In particular it comprises the sequence: AAAUUCUUGGGACCCUGAU (SEQ ID NO.2) and UCUUGGGACCCUGAUGCUC (SEQ ID NO.3) or the complementary sequences. The nucleotide is ribonucleotide, deoxyribonucleotide or chimera of ribonucleotide and deoxyribonucleotide. The nucleotide is further modified by one or more of ribose modification, base modification, phosphate backbone modification, fluoro modification, sulfo modification, methoxy modification and cholesterol modification. Nucleotides and other antineoplastic therapeutic agents, particularly trivalent inorganic arsenic. Application in preparing medicine for treating cancer. Cancers include: liver cancer, cardiac cancer, colon cancer, nasopharyngeal cancer, ovarian cancer, prostate cancer, chronic or acute leukemia, brain tumor, esophageal cancer, oral cancer, urethral cancer, skin cancer, rectal cancer, middle ear cancer, bone cancer, intestinal cancer, gallbladder cancer, laryngeal cancer, gingival cancer, lung cancer, pancreatic cancer, breast cancer, cervical cancer, colorectal cancer, testicular cancer, cancer of the endocrine system, and lymphocytic lymphoma. The study was supported by the national science foundation (81860572).

The invention (advantage): the nucleotide has good hsa _ circ _0027479 inhibition effect, acts on a specific target site, has strong specificity, low toxicity, small side effect and long modification half-life period, and can be used together with various antitumor drugs.

Detailed Description

The present invention is further illustrated but not limited in any way by the following description, and any alterations or substitutions based on the teachings of the present invention are intended to fall within the scope of the present invention.

Detailed description of the preferred embodiments.

Examples

The silencing RNA sequences in this example are: AAAUUCUUGGGACCCUGAU (SEQ ID NO.2) and UCUUGGGACCCUGAUGCUC (SEQ ID NO.3) and the complementary sequences, all from 5 to 3, with dTdT added to the ends. RNA sequence information for hsa _ circ _0027479 is present in the UCSC database. The subject is supported by the national science foundation under this study (81860572).

Control Synthesis

First, nucleotides were synthesized by jima pharmaceutical technology ltd, shanghai, and a double-stranded RNA sequence including a complementary sequence thereof was synthesized, and negative control group using a sequence having a cargo number a06001 of negative control siRNA of jima pharmaceutical technology ltd as a negative control of the control group was used.

Cell culture: a549 or XWLC-05 cells were cultured in 1640 medium containing 10% fetal bovine serum at 37 ℃ under 5% CO 2. The plates were plated in 96-well plates at 2500 per well. RNA transfection was performed using the Afect transfection reagent from the hundred generations, and the efficiency of RNA interference was determined by fluorescent quantitative PCR. The silencing efficiencies of the control group, the silencing group 1 and the silencing group are respectively as follows, and the A549 cells are respectively as follows: 1.001 plus or minus 0.041, 0.199 plus or minus 0.021 and 0.243 plus or minus 0.038; XWLC-05 cells were 0.998. + -. 0.071, 0.181. + -. 0.014, 0.254. + -. 0.020, respectively, and data used were 2^ 2^-ΔΔCtAnd (4) showing.

Primers used for fluorescence quantification: upstream of hsa _ circ _ 0027479: ATGAGAAAATTCTTGGGACCCTG (SEQ ID NO. 4): GCTCTCCATGCTTGACCACA (SEQ ID NO.5), the internal reference adopts ACTB gene in the article "Chengjiang, Zhangluo, Zhang Twai, Juan, Zhoume, He Yufeng. arsenic and its metabolite influence on P21 gene expression [ J ]. occupation and health, 2018,34(23):3213-3216 ].

Arsenic is added into two cells 48 hours after transfection of a 96-well plate, sodium arsenite is dissolved in a culture medium, the same amount of the culture medium is not added, the final concentration of the sodium arsenite is 60 micromole per liter, the final concentration of the arsenic of the XWLC-05 cells is 40 micromole per liter, and the cell viability is detected by MTS after 48 hours of culture. The cell viability was calculated by using the absorbance at 490nm measured by MTS from Promega.

Control group without arsenic addition: in order to use the negative control fragment without adding sodium arsenite, the activity of this group was determined to be 100.0%. Non-arsenic test group 1: results of nucleotide fragment 1 silencing. Non-arsenic test group 2: silencing nucleotide fragment 2 silencing results. Arsenic addition control group: the result of adding sodium arsenite after using the negative control fragment was obtained. Arsenic addition experimental group 1: silencing nucleotide fragment 1 was followed by addition of sodium arsenite. Arsenic addition experimental group 2: silencing nucleotide fragment 2 was followed by addition of sodium arsenite. The cell viability of each group was in percent (%):

control group without arsenic addition: a549 is 101.4 +/-2.9, XWLC-05 is 99.9 +/-4.1,

non-arsenic test group 1: a549 is 93.9 +/-5.0, XWLC-05 is 94.7 +/-4.0,

in the experiment group 2 without arsenic, A549 is 94.1 +/-4.2, XWLC-05 is 93.9 +/-2.9,

arsenic addition control group: a549 is 87.1 +/-4.2, XWLC-05 is 86.4 +/-3.3,

arsenic addition experimental group 1: a549 is 64.3 +/-2.8, XWLC-05 is 57.4 +/-3.1,

arsenic addition experimental group 2: a549 is 65.1 +/-2.9, XWLC-05 is 58.1 +/-3.7.

Sequence listing

<110> university of Kunming medical science

<120> siRNA for inhibiting expression of hsa _ circ _0027479 and application thereof

<141>2019-12-24

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>RNA

<213> Artificial sequence (rengongxulie)

<400>1

aaauucuugg gacccugaug cuc 23

<210>2

<211>19

<212>RNA

<213> Artificial sequence (rengongxulie)

<400>2

aaauucuugg gacccugau 19

<210>3

<211>19

<212>RNA

<213> Artificial sequence (rengongxulie)

<400>3

ucuugggacc cugaugcuc 19

<210>4

<211>23

<212>DNA

<213> Artificial sequence (rengongxulie)

<400>4

atgagaaaat tcttgggacc ctg 23

<210>5

<211>20

<212>DNA

<213> Artificial sequence (rengongxulie)

<400>5

gctctccatg cttgaccaca 20

Claims

1. A nucleotide sequence that inhibits the expression of hsa _ circ _0027479 circular RNA, wherein the nucleotide sequence comprises: the sequence of nucleotides consists of 18-22 contiguous nucleotides of the AAAUUCUUGGGACCCUGAUGCUC sequence or the complement.

2. The nucleotide according to claim 1, characterized in that its sequence is AAAUUCUUGGGACCCUGAU or UCUUGGGACCCUGAUGCUC and its complement.

3. The nucleotide of claim 1, wherein: the nucleotide is ribonucleotide, deoxyribonucleotide or chimera of ribonucleotide and deoxyribonucleotide.

4. The nucleotide according to claim 1, wherein the nucleotide is further modified by one or more of ribose modification, base modification, phosphate backbone modification, fluoro modification, thio modification, methoxy modification and cholesterol modification.

5. Use of the nucleotide according to claims 1 to 4, characterized by the use in the preparation of an antitumor medicament.

6. Use according to claim 5, characterized in that said tumor is lung cancer.

7. A pharmaceutical composition comprising the nucleotide according to any one of claims 1 to 4 and another anti-tumor therapeutic agent.

8. The pharmaceutical composition of claim 7, wherein the additional anti-neoplastic therapeutic agent is sodium arsenite.

9. The pharmaceutical composition of claim 7, characterized by the use in the preparation of an antitumor drug.

10. Use according to claim 9, characterized in that said tumor is lung cancer.