CN109825502B

CN109825502B - siRNA for inhibiting circ _0054853 expression and application thereof

Info

Publication number: CN109825502B
Application number: CN201910149615.3A
Authority: CN
Inventors: 何越峰; 尚莉; 王立萍; 平妮娜; 钱舒然
Original assignee: Nanjing Adicon Clinical Laboratories Co ltd
Current assignee: Nanjing Adicon Clinical Laboratories Co ltd
Priority date: 2019-02-28
Filing date: 2019-02-28
Publication date: 2022-10-25
Anticipated expiration: 2039-02-28
Also published as: CN109825502A

Abstract

The invention discloses a nucleotide for inhibiting the expression of circular RNA of human circ _0054853 and application thereof, which is characterized in that: the nucleotide specifically binds to human circ _0054853 circular RNA, the sequence of the nucleotide consists of 18-25 continuous nucleotide sequences in the sequence of UAAAACGUAUGAACUCUUGUGAGGUGAGGA or the complementary sequence, in particular the sequence comprises: UAAAACGUAUGAACUCUUG and UGAACUCUUGUAGGUGAGGGA. The invention can inhibit the circular RNA of human circ _0054853, can effectively inhibit the circular RNA expression of circ _0054853 in A549 and MBA-MD-231 cells, and can increase the growth and proliferation of the circular RNA in combination with antitumor drugs, thereby effectively treating various tumors.

Description

siRNA for inhibiting circ _0054853 expression and application thereof

Technical Field

The invention belongs to the field of medical material technology and medicine, in particular to cyclic RNAs nucleotide, and especially relates to human cyclic RNAs nucleotide. The nucleotide can be complemented with circ _0054853, thereby inhibiting the expression of circ _0054853 of human, and playing a role in resisting tumors with other antitumor drugs.

Background

The CircRNAs are common RNAs whose molecules have a closed loop structure, and can be formed by circularization of exons or introns, non-coding RNAs, and the like. And the ADAR1, the QKI, the DHX9 and the like are involved in the regulation and control of the formation process of the circRNAs. The circRNAs play a role in various modes, and research shows that the circRNAs contain miRNA response elements which can be competitively combined with miRNA, and gene expression is regulated by influencing the miRNA mode; some circRNAs can interact with small ribonucleoproteins to regulate the transcription of genes; some of the circRNAs can modulate pre-mRNA splicing, altering mRNA levels, and thereby affecting protein production. The circRNAs play an important role in the processes of cell growth, proliferation, differentiation, cycle regulation, stress and the like, and the expression change of the circRNAs is closely related to the occurrence, development and prognosis of nervous system diseases, diabetes, coronary heart diseases and various cancers.

RNA interference (RNAi) technology utilizes double-stranded small RNA to efficiently and specifically degrade homologous RNA in cells so as to silence target genes, thereby realizing the function of interfering the target genes.

In recent years, although clinical combination therapy of tumor has been popularized, the 5-year survival rate of tumor patients is not improved much by the combination therapy, and the survival rate of patients in middle and late stages is lower, about 20%. The side effects of some chemotherapy drugs greatly limit the application of the drugs. Therefore, finding safer and more effective targeted combination therapies is a way to improve survival of tumor patients.

Disclosure of Invention

The invention aims to provide siRNA capable of specifically and efficiently inhibiting circ _0054853 expression and application thereof.

The object of the invention is achieved in that the sequence comprising synthetic nucleotides consists of 18 to 25 consecutive nucleotides of the sequence UAAACGUAUGAACCUUGUAGGUGAGGGGA (SEQ ID NO. 1) or 18 to 25 consecutive nucleotides of the complementary sequence. In particular it comprises the sequence: UAAAACGUAUGAACUCUUG (SEQ ID NO. 2) and UGAACUCUUGUAGGUGAGGGA (SEQ ID NO. 3). The nucleotide is ribonucleotide, deoxyribonucleotide or chimera of ribonucleotide and deoxyribonucleotide. The nucleotide is further modified by one or more of ribose modification, base modification and phosphate backbone modification. The modification is one or more of fluoro modification, sulfo modification, 2-methoxyl modification, cholesterol modification and LNA modification. Nucleotides and other antineoplastic therapeutic agents, particularly trivalent inorganic arsenic. Application in preparing medicine for treating cancer. Cancers include: liver cancer, lung cancer, pancreatic cancer, breast cancer, cervical cancer, colorectal cancer, stomach cancer, nasopharyngeal cancer, ovarian cancer, prostate cancer, chronic or acute leukemia, brain tumor, esophageal cancer, oral cancer, cardiac cancer, colon cancer, gallbladder cancer, laryngeal cancer, gum cancer, urethral cancer, skin cancer, rectal cancer, middle ear cancer, bone cancer, testicular cancer, cancer of the endocrine system, lymphocytic lymphomas. The study was supported by the national science foundation (81860572).

The invention (advantage): the nucleotide has good circ _0054853 inhibition effect, acts on a specific target site, has strong specificity, low toxicity, small side effect and long modification half-life period, and can be used together with various antitumor drugs.

Detailed Description

The present invention is further described without limiting in any way, and any variations or alterations based on the teachings of the present invention are intended to fall within the scope of the present invention.

The specific implementation mode is as follows:

example 1

The silencing RNA sequences in this example are: UAAACGUAUGAACCUUGdT (SEQ ID NO. 2), and the complementary sequence CAAGAGUUCACGUUUGdT (SEQ ID NO. 4). All sequences were from 5-to 3-terminal, where dTdT was less than 19 nucleotides plus TT tail, synthesized by Shanghai Jima pharmaceutical technology, inc., and the RNA sequence information of CIRC _0054853 was present in the UCSC database. The study was supported by the national science foundation (81860572).

Control Synthesis

First, nucleotides were synthesized by jima pharmaceutical technology ltd, shanghai, and a double-stranded RNA sequence including a complementary sequence thereof was synthesized, and the control group used the a06001 sequence of jima pharmaceutical technology ltd, uucuccgaacgucacgugdtdt (SEQ ID No. 5) and the complementary acgucacguggagadtt (SEQ ID No. 6) as negative controls.

Cell culture: a549 or MBA-MD-231 cells were cultured in 1640 medium containing 10% fetal bovine serum purchased from cellmax, the 1640 medium was from Hyclone, at 37 ℃ and 5% CO2. The cells with good growth status were collected, centrifuged, plated in 96-well plates at 5000 wells and 200000 cells were inoculated in six-well plates, cultured at 37 ℃ in 5% CO2.

RNA transfection:

when A549 is transfected by using a six-well plate, the amount of SIRNA in the six-well plate is 20ul per well, the transfection reagent is 15ul, the culture medium is 2ml, when MBA-MD-231 is transfected by using the six-well plate, the amount of SIRNA in the six-well plate is 10ul per well, the transfection reagent is 7.5ul, the culture medium is 2ml, and the silencing effect is detected for 96 hours, and the result is shown in table 1.

TABLE 1 silencing Effect of circ _0054853

Silencing Effect	Control group	Silencing group 1	Silencing group 1
				A549	1.02±0.07	0.21±0.02	0.19±0.02
MBA-MD-231	1.04±0.09	0.13±0.05	0.12±0.01

Table 1 shows the SIRNA silencing effect of the invention in Table 1, the control group uses negative control fragments, and the silencing group 1 shows the result of silencing nucleotide fragments in example 1; silencing group 2 results of silencing nucleotide fragments of example 2, data using 2^ 2 ^-ΔΔ Ct represents.

When the A549 is transfected by a 96-well plate, the SIRNA amount of the 96-well plate is 0.5ul per well, the transfection reagent is 0.5ul of a culture medium, when the MBA-MD-231 is transfected by the 96-well plate, the SIRNA amount of the 96-well plate is 0.25ul per well, the transfection reagent is 0.25ul of a culture medium, the transfection reagent is 0.1ml, 30uM (micromole per liter) is added after the two are transfected by adding sodium arsenite A549 and adding MBA-MD-231 5uM after 24 hours, wherein sodium arsenite is not added in one row, and the cell activity is detected by MTS after 48 hours of culture, and the result is shown in Table 2.

TABLE 2 Activity after addition of arsenic after silencing of circ \u0054853 (%)

Activity%	Group without arsenic addition	Control group	Experimental group 1	Experimental group 2
					A549	100±4.53	83±3.52	59±2.91	58±3.58
MBA-MD-231	101±5.62	84±3.77	41±1.99	43±3.90

Table 2 shows the results of MTT of the present invention table 2; no arsenic group added: no sodium arsenite added, control: as a result of adding sodium arsenite after using the negative control fragment, it was determined to be 100%, in example 1 of experimental group 1, the result of adding sodium arsenite after silencing the silent nucleotide fragment, and in example 2 of experimental group 2, the result of adding sodium arsenite after silencing the silent nucleotide fragment.

MTS detection adopts CellTiter of Promega corporation

The operational calculations were performed by the method of the AQueous One Solution Cell Proliferation Assay, an instruction manual.

The silent effect is detected by fluorescent quantitative PCR (polymerase chain reaction) under the conditions of 1, 95 ℃ for 2-10 min, 2, 95 ℃ for 10 seconds, 3, 60 ℃ for 10 seconds, 4, 72 ℃ for 15 seconds and PCR reagentIn the century of Roche or kang, the primer sequences were as follows: CCCTCACCTACAAGGTTCA (SEQ ID NO. 7) and GCTGCTTGACTGTTTCAGGA (SEQ ID NO. 8) with 2^ ^ΔΔCt The expression level is shown.

Example 2

The RNA sequence in this example is: UGAACUUGUAGGUGAGGGA (SEQ ID NO. 3), and a complementary sequence UCCCUCACCUCUACAAGAGUUCA (SEQ ID NO. 9). The assay methods for cell culture and transfection were the same as in example 1, except that the silencing RNA sequence was used. The results of the silencing are shown in Table 1, and the results of the MTT are shown in Table 2.

SEQUENCE LISTING

<110> university of Kunming medical science

<120> siRNA for inhibiting circ _0054853 expression and application thereof

<130>

<140>

<141>

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 30

<212> RNA

<213> Artificial sequence

<400> 1

uaaaacguau gaacucuugu aggugaggga 30

<210> 2

<211> 19

<212> RNA

<213> Artificial sequence

<400> 2

uaaaacguau gaacucuug 19

<210> 3

<211> 21

<212> RNA

<213> Artificial sequence

<400> 3

ugaacucuug uaggugaggg a 21

<210> 4

<211> 19

<212> RNA

<213> Artificial sequence

<400> 4

caagaguuca uacguuuua 19

<210> 5

<211> 19

<212> RNA

<213> Artificial sequence

<400> 5

uucuccgaac gugucacgu 19

<210> 6

<211> 19

<212> RNA

<213> Artificial sequence

<400> 6

acgugacacg uucggagaa 19

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

ccctcaccta caagagttca 20

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence

<400> 8

tgctgcttga ctgtttcagg a 21

<210> 9

<211> 21

<212> RNA

<213> Artificial sequence

<400> 9

ucccucaccu acaagaguuc a 21

Claims

1. The application of a pharmaceutical composition in preparing a medicament for treating lung cancer and breast cancer is characterized by comprising a nucleotide sequence for inhibiting the expression of circular RNA of human circ _0054853 and trivalent inorganic arsenic, wherein the nucleotide sequence is UAAAACGUAUGAACUCUUG, a complementary sequence CAAGAGUUCCAUCCGUUUUA or UGAACUCUCUCUUGUAGGUGAGGGGA and a complementary sequence UCCCUCACCUCCUACAAGAGUUCA.

2. The use of the pharmaceutical composition according to claim 1 for the manufacture of a medicament for the treatment of lung cancer and breast cancer, wherein the trivalent inorganic arsenic compound is present in the composition at a concentration of 30uM for the treatment of lung cancer and 5uM for the treatment of breast cancer.