CN109706152B - siRNA for inhibiting circ _0001017 expression and application thereof - Google Patents

Abstract

The invention discloses a nucleotide for inhibiting the expression of circular RNA of human circ _0001017 and application thereof, which is characterized in that: the nucleotide specifically binds to circular RNA of human circ _0001017, and the sequence of the nucleotide consists of 18-23 continuous nucleotide sequences in AUAGAUUACUUCGCACUGUCC sequence or complementary sequence, and particularly comprises the sequence: AUAGAUUACUUCGCACUGG and AGAUUACUUCGCACUGGUUCC. The invention can inhibit the circular RNA of human circ _0001017, can effectively inhibit the circular RNA expression of circ _0001017 in A549 cells and MBA-MD-231 cells, can increase the inhibition of the growth and the proliferation of the circular RNA in combination with the antitumor drugs, and thus can effectively treat various tumors.

Description

siRNA for inhibiting circ _0001017 expression and application thereof

Technical Field

The invention belongs to the field of medical material technology and medicine, and specifically relates to cyclic RNAs nucleotide, especially to human cyclic RNAs nucleotide. The nucleotide can be complemented with circ _0001017, thereby inhibiting the expression of the circ _0001017 of human beings, and playing the role of resisting tumors with other antitumor drugs.

Background

The CircRNAs are generally RNAs of which molecules have a closed loop structure, and can be formed by circularization of exons or introns, non-coding RNAs, and the like. And ADAR1, QKI, FUS, HNRNPL, DHX9 and the like participate in the regulation and control of the formation process of the circRNAs. The circRNAs play a role in various modes, and research shows that the circRNAs contain miRNA response elements which can be competitively combined with miRNA, and gene expression is regulated by influencing the miRNA mode; some circRNAs can interact with small ribonucleoproteins to regulate the transcription of genes; some of the circRNAs can modulate pre-mRNA splicing, altering mRNA levels, and thereby affecting protein production. The circRNAs play an important role in the processes of cell growth, proliferation, differentiation, cycle regulation, stress and the like, and the expression change of the circRNAs is closely related to the occurrence, development and prognosis of nervous system diseases, diabetes, coronary heart diseases and various cancers.

The RNA interference (RNAi) technology utilizes small double-stranded RNA to efficiently and specifically degrade intracellular homologous RNA to silence a target gene, thereby achieving the function of interfering the target gene.

In recent years, although clinical tumor combination therapy has become widespread, 5-year survival rate of tumor patients is not improved much by the combination therapy, and survival rate of patients in middle and late stages is lower, about 20%. The side effects of some chemotherapy drugs greatly limit the application of the drugs. Therefore, finding safer and more effective targeted combination therapies is a way to improve survival of tumor patients.

Disclosure of Invention

The invention aims to provide siRNA capable of specifically and efficiently inhibiting circ _0001017 expression and application thereof.

The object of the invention is achieved in that the sequence comprising the synthetic nucleotides consists of 18 to 23 consecutive nucleotide sequences in the sequence AUAGAUUACUUCGCACUGGUUCC (SEQ ID NO. 1) or 18 to 23 consecutive nucleotide sequences in the complementary sequence. In particular it comprises the sequence: AUAGAUUACUUCGCACUGG (SEQ ID NO. 2) and AGAUUACUUCGCACUGGUUCC (SEQ ID NO. 3). The nucleotide is ribonucleotide, deoxyribonucleotide or chimera of ribonucleotide and deoxyribonucleotide. The nucleotide is further modified by one or more of ribose modification, base modification and phosphate backbone modification. The modification is one or more of fluoro modification, sulfo modification, 2-methoxyl modification, cholesterol modification and LNA modification. Nucleotides and other antineoplastic therapeutic agents, particularly trivalent inorganic arsenic. Application in preparing medicine for treating cancer. Cancers include: liver cancer, lung cancer, pancreatic cancer, breast cancer, cervical cancer, colorectal cancer, stomach cancer, nasopharyngeal cancer, ovarian cancer, prostate cancer, chronic or acute leukemia, brain tumor, esophageal cancer, oral cancer, cardiac cancer, colon cancer, gallbladder cancer, laryngeal cancer, gum cancer, urethral cancer, skin cancer, rectal cancer, middle ear cancer, bone cancer, testicular cancer, cancer of the endocrine system, lymphocytic lymphomas. This study was supported by the national science foundation (81860572).

The invention (advantage): the nucleotide has good circ _0001017 inhibition effect, acts on specific target sites, has strong specificity, low toxicity, small side effect and long modification half-life period, and can be used together with various antitumor drugs.

Detailed Description

The present invention is further described but not limited in any way, and any variations or alterations based on the teachings of the present invention are intended to fall within the scope of the present invention.

The specific implementation mode is as follows:

example 1

The silencing RNA sequence in this example is AUAGAUUACUUCGCACUGdTdT (SEQ ID NO. 2), and the complementary sequence CCAGUGCGAAGUAAUCUAUdT (SEQ ID NO. 4). All sequences were from 5-to 3-terminal, where dTdT was less than 19 nucleotides plus the TT tail was removed, and the RNA sequence information for circ-0001017 was present in the UCSC database. This study was supported by the national science foundation (81860572).

Control synthesis:

first, nucleotides were synthesized by Jima pharmaceutical technology, inc. of Shanghai, and a double-stranded RNA sequence including a complementary sequence thereof was synthesized, and as a negative control group, UUCCCGAACGUCACGUdTdT (SEQ ID NO. 5), which is the A06001 sequence of Jima pharmaceutical technology, inc. of Shanghai, and complementary ACGUGACACGUCGGAGAAdT (SEQ ID NO. 6), were used.

Cell culture: a549 or MBA-MD-231 cells were cultured in 1640 medium containing 10% fetal bovine serum purchased from cellmax, the 1640 medium was from Hyclone, at 37 ℃ and 5% CO2. Collecting cells with good growth state, centrifuging, spreading into 96-well plate with 5000 wells and 200000 wells, inoculating into six-well plate, culturing at 37 deg.C, 5% CO2.

RNA transfection:

the transfection reagent Lipo8000 of Biyunshi company is adopted, the operation is carried out according to the operation instruction, when A549 is transfected by a six-hole plate, the amount of SIRNA in the six-hole plate is 20ul per hole, the transfection reagent is 15ul, the culture medium is 2ml, when MBA-MD-231 is transfected by the six-hole plate, the amount of SIRNA in the six-hole plate is 10ul per hole, the transfection reagent is 7.5ul, the culture medium is 2ml, the silencing effect is detected within 96 hours, and the result is shown in Table 1.

TABLE 1 silencing Effect of circ _0001017

Silencing Effect	Control group	Silencing group 1	Silencing group 1
				A549	1.02±0.07	0.21±0.02	0.24±0.08
MBA-MD-231	1.04±0.09	0.18±0.04	0.16±0.03

Table 1 shows the SIRNA silencing effect of the invention in Table 1, the control group uses negative control fragments, and the silencing group 1 shows the result of silencing nucleotide fragments in example 1; silencing group 2 As a result of silencing nucleotide fragments in example 2, data use 2^ C ^-ΔΔCt And (4) showing.

When the A549 is transfected by using a 96-well plate, the SIRNA amount of the 96-well plate is 0.5ul per well, the transfection reagent is 0.5ul culture medium is 0.1ml, when the MBA-MD-231 is transfected by using the 96-well plate, the SIRNA amount of the 96-well plate is 0.25ul per well, the transfection reagent is 0.25ul culture medium is 0.1ml, 30uM (micromole per liter) of sodium arsenite A549 is added after the transfection of the 96-well plate and the MBA-MD-231 uM is added after the transfection of the MBA-MD-231 uM, wherein the sodium arsenite is not added in one row, and the cell activity is detected by MTS after the culture is carried out for 48 hours, and the result is shown in a table 2.

TABLE 2 Activity after addition of arsenic after circ_0001017 silencing (%)

Activity%	Group without arsenic addition	Control group	Experimental group 1	Experimental group 2
					A549	100±4.53	83±3.52	67±2.31	65±5.38
MBA-MD-231	101±5.62	84±3.77	57±4.01	53±3.40

Table 2 shows the results of MTT of the present invention table 2; no arsenic group added: no sodium arsenite added, control: as a result of adding sodium arsenite after using the negative control fragment, the result was defined as 100%, in example 1 of experiment group 1, the result of adding sodium arsenite after silencing the silent nucleotide fragment, and in example 2, the result of adding sodium arsenite after silencing the silent nucleotide fragment.

MTS detection is carried out by adopting a method of Promega CellTiter 96 waterborne One Solution Cell promotion Assay, an instruction book for operation and calculation.

The silent effect is detected by adopting fluorescent quantitative PCR, the PCR conditions are 1, 95 ℃ for 2-10 min, 2, 95 ℃ for 10 seconds, 3, 60 ℃ for 10 seconds, 4, 72 ℃ for 15 seconds, PCR reagents adopt Roche or Kangji, and the primer sequences are as follows: CAAGGAACCAGTGCGAAGTAACT (SEQ ID NO. 7) and TTCCAAAATTGTCGACTCTTGT (SEQ ID NO. 8) 2^ is used ^ΔΔCt The expression level is shown.

Example 2

The RNA sequence in this example is: AGAUUACUUCGCACUGUCC (SEQ ID NO. 3), complementary sequence: GGAACCAGUGCGAAGUAAUCU (SEQ ID NO. 9), cell culture and transfection methods were the same as in example 1, except that the silencing RNA sequence was used. The results of the silencing are shown in Table 1, and the results of the MTT are shown in Table 2.

SEQUENCE LISTING

<110> university of Kunming medical science

<120> siRNA for inhibiting circ _0001017 expression and application thereof

<130>

<140>

<141>

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 23

<212> RNA

<213> Artificial sequence

<400> 1

auagauuacu ucgcacuggu ucc 23

<210> 2

<211> 19

<212> RNA

<213> Artificial sequence

<400> 2

auagauuacu ucgcacugg 19

<210> 3

<211> 21

<212> RNA

<213> Artificial sequence

<400> 3

agauuacuuc gcacugguuc c 21

<210> 4

<211> 19

<212> RNA

<213> Artificial sequence

<400> 4

ccagugcgaa guaaucuau 19

<210> 5

<211> 19

<212> RNA

<213> Artificial sequence

<400> 5

uucuccgaac gugucacgu 19

<210> 6

<211> 19

<212> RNA

<213> Artificial sequence

<400> 6

acgugacacg uucggagaa 19

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence

<400> 7

caaggaacca gtgcgaagta atc 23

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence

<400> 8

ttccaaaatt gtgtcgactc ttgt 24

<210> 9

<211> 21

<212> RNA

<213> Artificial sequence

<400> 9

ggaaccagug cgaaguaauc u 21

Claims (2)

1. The application of a pharmaceutical composition in preparing a medicament for treating lung cancer and breast cancer is characterized by comprising a nucleotide sequence for inhibiting the expression of circ _0001017 circular RNA of a human and sodium arsenite, wherein the nucleotide sequence is AUAGAUUACUUCGCACUGG and a complementary sequence CCAGUGCGAAGUAAUCUAU or AGAUUACUUCGCACUGGUUCC and a complementary sequence GGAACCAGUGCGAAGUAAUCU.

2. The use of the pharmaceutical composition of claim 1 for the manufacture of a medicament for the treatment of lung cancer and breast cancer, wherein the concentration of sodium arsenite in the composition is 30uM for the treatment of lung cancer and 5uM for the treatment of breast cancer.