CN109706152A - It is a kind of inhibit circ_0001017 expression siRNA and its application - Google Patents

Abstract

The invention discloses a kind of nucleotide of inhibition people circ_0001017 circular rna expression and its applications, it is characterized in that: the polynucleotide is incorporated into people's circ_0001017 circular rna, the sequence of the nucleotide is made of 18-23 continuous nucleotide sequence in AUAGAUUACUUCGCACUGGUUCC sequence or complementary series, and especially it includes sequences: AUAGAUUACUUCGCACUGG and AGAUUACUUCGCACUGGUUCC.The present invention inhibits people circ_0001017 circular rna, and circ_0001017 circular rna in A549 and MBA-MD-231 cell can effectively be inhibited to express, it can be increased by, which combining with anti-tumor drug, inhibits it to grow and be proliferated, to effectively treat kinds of tumors.

Description

It is a kind of inhibit circ_0001017 expression siRNA and its application

Technical field

The invention belongs to medical material technology and drug fields, specifically the present invention relates to a kind of circular rna s nucleotide, More particularly, to people's circular rna s nucleotide.The nucleotide can be complementary with circ_0001017, to inhibit people circ_ 0001017 expression, it plays antineoplastic action with other anti-tumor drugs.

Background technique

CircRNAs is the RNA that its universal molecule of one kind is in closed circular structure, can be by exon or introne, non-volume The cyclisation such as code RNA are formed.ADAR1, QKI, FUS, HNRNPL and DHX9 etc. take part in the regulation of circRNAs forming process. CircRNAs plays a role in several ways, research shows that circRNAs contain miRNA response element can be with competitive binding MiRNA adjusts gene expression by influencing miRNA mode；Some circRNAs can interact with small nuclear ribonucleoprotein, adjust Control the transcription of gene；The montage of the adjustable pre-mRNA of part circRNAs changes mRNA content, to influence protein Yield.In the growth of cell, increment, differentiation, cycle regulating and multiple circRNAs in the process stress be waited to play an important role, It is closely related with the generation, development and prognosis of the nervous system disease, diabetes, coronary heart disease and kinds cancer that it expresses variation.

RNA interferes (RNA interference, RNAi) technology to utilize, and double-strand tiny RNA is efficient, selective degradation is intracellular Cognate rna is to silencing of target genes, to realize the function of interference target gene.

In recent years, although clinically the conjoint therapy of tumour is popularized, conjoint therapy survives to 5 years of tumor patient Rate improves less, and middle and advanced stage survival is lower, and about 20%.Part chemotherapeutics side effect limits greatly the fortune of drug With.Therefore, finding safer and more effective targeting conjoint therapy is the approach for improving tumor patient existence.

Summary of the invention

The purpose of the present invention is to provide one kind can inhibit specifical and efficiently circ_0001017 express siRNA and its Using.

The object of the present invention is achieved like this, the sequence including synthesizing ribonucleotide by 18-23 continuous nucleotide sequence composition or complementary in AUAGAUUACUUCGCACUGGUUCC (SEQ ID NO.1) sequence 18-23 continuous nucleotide sequence composition in sequence.Especially it includes sequences: AUAGAUUACUUCGCACUGG (SEQ ID NO.2) and AGAUUACUUCGCACUGGUUCC (SEQ ID NO.3).Nucleotide is ribonucleotide, dezyribonucleoside The chimera of acid or ribonucleotide and deoxyribonucleotide.Nucleotide is further by ribose modification, base modification and phosphorus The modification of one or more of sour backbone modification.Modification is repaired selected from fluoro modification, thio-modification, the modification of 2- methoxyl group, cholesterol One or more of decorations, LNA modification.Nucleotide and other antineoplaston drugs especially trivalent inorganic arsenic.Preparation treatment Application in cancer drug.Cancer include: liver cancer, lung cancer, cancer of pancreas, breast cancer, cervical carcinoma, colorectal cancer, gastric cancer, nasopharynx Cancer, oophoroma, carcinoma of prostate, chronic or acute leukemia, brain tumor, cancer of the esophagus, carcinoma of mouth, cardia cancer, colon cancer, gall-bladder Cancer, laryngocarcinoma, gingival carcinoma, carcinoma of urethra, cutaneum carcinoma, the carcinoma of the rectum, cancer of middle ear, osteocarcinoma, carcinoma of testis, the cancer of endocrine system, lymph Cell lymphoma.Support (81860572) of this research by state natural sciences fund.

(advantage) of the invention: the nucleotide of invention has good circ_0001017 inhibitory effect, acts on specificity Target site, high specificity, toxicity is low, Small side effects and modification long half time, can share with a variety of anti-tumor drugs.

Specific embodiment

The present invention is further illustrated below, but the present invention is limited in any way, based on the present invention It is any made by introduction to transform or replace, it all belongs to the scope of protection of the present invention.

Specific embodiment:

Embodiment 1

Silencing RNA sequence in the present embodiment is AUAGAUUACUUCGCACUGGdTdT (SEQ ID NO.2), and complementary sequence It arranges CCAGUGCGAAGUAAUCUAUdTdT (SEQ ID NO.4).All sequences are all from 5 ends to 3 ends that wherein dTdT is not 19 nucleotide of foot have been added up TT tail, and the RNA sequence information of circ_0001017 is present in UCSC database.This research by The support (81860572) of state natural sciences fund.

Control synthesis:

Firstly, synthesis includes the double-stranded RNA sequence of its complementary series by Shanghai JiMa pharmacy Technology Co., Ltd's synthesizing ribonucleotide Column, control group are UUCUCCGAACGUGUCACGUdTdT (SEQ ID using the A06001 sequence of Ji Ma Pharmaceutical Technology Inc. NO.5) and complementary ACGUGACACGUUCGGAGAAdTdT (SEQ ID NO.6) is used as negative control.

Cell culture: A549 MBA-MD-231 cell is trained in 1640 culture mediums containing 10% fetal calf serum It supports, fetal calf serum is purchased from cellmax company, and 1640 culture mediums are cultivated under the conditions of 5%CO2 from Hyclone in 37 DEG C.It receives Collecting the good cell of growth conditions, centrifugation counts, and 200000, which are laid in 96 orifice plates, with 5000 every holes is inoculated in six orifice plates, 37 DEG C, 5%CO2 culture.

RNA transfection:

It using green skies company Lipo8000 transfection reagent, is operated according to operating instruction, A549 is transfected using six orifice plates When, SIRNA amount is every hole 20ul, transfection reagent 15ul in six orifice plates, and culture medium 2ml, MBA-MD-231 use six holes When plate transfects, SIRNA amount is every hole 10ul, transfection reagent 7.5ul, culture medium 2ml in six orifice plates, and detection in 96 hours is heavy Silent effect, the result is shown in tables 1.

Table 1.circ_0001017 silencing efficiency

Silencing efficiency	Control group	Silencing group 1	Silencing group 1
				A549	1.02±0.07	0.21±0.02	0.24±0.08
MBA-MD-231	1.04±0.09	0.18±0.04	0.16±0.03

Table 1 is the effect table 1 of SIRNA silencing of the present invention, and control group uses negative control segment, and silencing group 1 is embodiment 1 The result of silent nucleotide segment；Silencing group 2 is 2 silent nucleotide segment of embodiment as a result, data use 2^^-ΔΔCtTable Show.

96 orifice plate SIRNA amounts are every hole 0.5ul when A549 is transfected using 96 orifice plates, and transfection reagent is 0.5ul culture medium For 0.1ml, 96 orifice plate SIRNA amounts are every hole 0.25ul when MBA-MD-231 is transfected using 96 orifice plates, and transfection reagent is 0.25ul culture medium is 0.1ml, and 30uM (every liter of micromole) is added in 24 hours addition sodium arsenite A549 after the two transfection, MBA-MD-231 5uM, wherein a row is added without sodium arsenite, MTS detects cell viability after being further cultured for 48 hours, the result is shown in Table 2.

Vigor (%) after addition arsenic after table 2.circ_0001017 silencing

Vigor %	Not plus arsenic group	Control group	Experimental group 1	Experimental group 2
					A549	100±4.53	83±3.52	67±2.31	65±5.38
MBA-MD-231	101±5.62	84±3.77	57±4.01	53±3.40

Table 2 is the result table 2 of MTT of the present invention；Arsenic group is not added: being added without sodium arsenite, control group: to use negative control piece The result of sodium arsenite is added after section, it is determined as 100%, arsenious acid is added after 1 embodiment of experimental group, 1 silent nucleotide segment silencing Sodium as a result, after 2 embodiment of experimental group, 2 silent nucleotide segment silencing be added sodium arsenite result.

MTS detection uses 96 AQueous One Solution Cell of Promega company CellTiter The method of Proliferation Assay, an specification carries out operation calculating.

Detect silencing efficiency use quantitative fluorescent PCR, the condition of PCR be 1,95 degree 2-10 divide, 2,95 degree 10 seconds, 3,60 degree 10 seconds, 4,72 degree 15 seconds, PCR reagent uses Roche or health for century, and primer sequence is as follows: CAAGGAACCAGTGCGAAGTAATC (SEQ ID NO.7) and TTCCAAAATTGTGTCGACTCTTGT (SEQ ID NO.8) Using 2^^ΔΔCtIndicate expression quantity.

Embodiment 2

RNA sequence in the present embodiment are as follows: AGAUUACUUCGCACUGGUUCC (SEQ ID NO.3), complementary series: GGAACCAGUGCGAAGUAAUCU (SEQ ID NO.9), the test methods such as cell culture and transfection are used only with embodiment 1 Silencing RNA sequence is different.Silencing efficiency, the result is shown in table 1, the result is shown in tables 2 by MTT.

SEQUENCE LISTING

<110>Kunming Medical University

<120>a kind of siRNA for inhibiting circ_0001017 expression and its application

<130>

<140>

<141>

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 23

<212> RNA

<213>artificial sequence

<400> 1

auagauuacu ucgcacuggu ucc 23

<210> 2

<211> 19

<212> RNA

<213>artificial sequence

<400> 2

auagauuacu ucgcacugg 19

<210> 3

<211> 21

<212> RNA

<213>artificial sequence

<400> 3

agauuacuuc gcacugguuc c 21

<210> 4

<211> 19

<212> RNA

<213>artificial sequence

<400> 4

ccagugcgaa guaaucuau 19

<210> 5

<211> 19

<212> RNA

<213>artificial sequence

<400> 5

uucuccgaac gugucacgu 19

<210> 6

<211> 19

<212> RNA

<213>artificial sequence

<400> 6

acgugacacg uucggagaa 19

<210> 7

<211> 23

<212> DNA

<213>artificial sequence

<400> 7

caaggaacca gtgcgaagta atc 23

<210> 8

<211> 24

<212> DNA

<213>artificial sequence

<400> 8

ttccaaaatt gtgtcgactc ttgt 24

<210> 9

<211> 21

<212> RNA

<213>artificial sequence

<400> 9

ggaaccagug cgaaguaauc u 21

Claims (9)

1. it is a kind of inhibit circ_0001017 circular rna expression nucleotide, it is characterised in that: the sequence of the nucleotide by 18-23 continuous nucleotide sequence composition in AUAGAUUACUUCGCACUGGUUCC sequence or complementary series.

2. nucleotide according to claim 1, it is characterised in that its sequence be AUAGAUUACUUCGCACU or AGAUUACUUCGCACUGGUUCC and its complementary series.

3. nucleotide according to claim 2, it is characterised in that: the polynucleotide is ribonucleotide, deoxyribose The chimera of nucleotide or ribonucleotide and deoxyribonucleotide.

4. nucleotide according to claim 2, it is characterised in that the polynucleotide is further repaired by ribose modification, base The modification of one or more of decorations and phosphoric acid backbone modification.

5. nucleotide according to claim 4, it is characterised in that the modification is selected from fluoro modification, thio-modification, 2- first One or more of oxygroup modification, cholesterol modification, LNA modification.

6. a kind of pharmaceutical composition, it is characterised in that anti-swollen with other comprising the described in any item nucleotide of claim 1-5 Tumor therapeutic agent.

7. pharmaceutical composition according to claim 6, it is characterised in that other antineoplaston drugs are trivalent inorganic arsenic.

8. application of the pharmaceutical composition as claimed in claim 7 in preparation treating cancer drug.

9. application described in claim 8, wherein the cancer includes: liver cancer, lung cancer, cancer of pancreas, breast cancer, uterine neck Cancer, colorectal cancer, gastric cancer, nasopharyngeal carcinoma, oophoroma, carcinoma of prostate, chronic or acute leukemia, brain tumor, cancer of the esophagus, oral cavity Cancer, cardia cancer, colon cancer, gallbladder cancer, laryngocarcinoma, gingival carcinoma, carcinoma of urethra, cutaneum carcinoma, the carcinoma of the rectum, cancer of middle ear, osteocarcinoma, carcinoma of testis, Cancer, the lymphocytic lymphoma of endocrine system.