CN101590243A - Microrna treats and/or prevents application in the lymphoid tumor medicament in preparation - Google Patents
Microrna treats and/or prevents application in the lymphoid tumor medicament in preparation Download PDFInfo
- Publication number
- CN101590243A CN101590243A CNA2009100404748A CN200910040474A CN101590243A CN 101590243 A CN101590243 A CN 101590243A CN A2009100404748 A CNA2009100404748 A CN A2009100404748A CN 200910040474 A CN200910040474 A CN 200910040474A CN 101590243 A CN101590243 A CN 101590243A
- Authority
- CN
- China
- Prior art keywords
- mir
- microrna
- group
- cell
- ara
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The present invention relates to Microrna treats and/or prevents the tumour medicine field in preparation application.Specifically be with the precursor of the precursor of Microrna-15a, Microrna-16-1, Microrna-15a, Microrna-16-1 or in them two or more mixture be used to prepare this type of medicine.The present invention expresses by above-mentioned oligonucleotide sequence is crossed in lymphoma cell, prove that above-mentioned sequence has the growth of the lymphoma cell of inhibition and promotes its effect of apoptosis, and the coupling that further discloses they and chemotherapeutics such as cytosine arabinoside etc. can strengthen the effectiveness of original medicine, thereby proved conclusively above-mentioned oligonucleotide sequence treats and/or prevents the tumour medicine field in preparation application potential.This type of medicine can be the independent compositions that comprises above-mentioned any oligonucleotide sequence or its mixture and pharmaceutical carrier, or also comprises the coupling compositions of chemotherapeutics.
Description
Technical field
The present invention relates to Microrna and application thereof, be specifically related to Microrna-15a (miR-15a) and Microrna-16-1 (miR-16-1) and treat and/or prevent application in the lymphoid tumor medicament in preparation.
Background technology
MiRNA is the adjusting molecule in gene expression and the protein translation process, plays the pivotal role of regulation and control at the generating process of tumor.Some miRNA may be potential oncogene or antioncogene, and by the miRNA that searching has oncogene and antioncogene character, the diagnosis that not only can be tumor also can provide new target for the Biotherapeutics of tumor.
The therapy of tumor that miRNA is relevant comprises knocking out or striking and subtracts oncogene property miRNA, introduces antioncogene miRNA two aspects.One side is introduced and is had the complementary synthesising antisense scant nucleotide of oncogene characteristic miRNA (Anti-miRNAAntisense Oligonucleotides, AMOs), miRNA in can effectively deactivation tumor, delay its growth (Weiler J, Hunziker J, Hall J.Anti2miRNA oligonucleotides (AMOs): ammunition to target miRNAsimplicated in human disease[J] .Gene Ther, 2006,13 (6): 496-502.).Can effectively suppress miR-16 in Different Organs after using the AMOs injection mice that joins with the cholesterol coupling, miR-122, the activity of miR-192 and miR-194 (Krutzfeldt J, Rajewsky N, Braich R, et al.Silencing of microRNAs in vivo with " antagomirs " [J] .Nature, 2005,438 (7068): 685-689.), thereby may become a kind of medicine likely.Clinically, can methylate or locked nucleic acid modified antisense oligonucleotide administrations such as (LNA) makes the miRNA inactivation by 2 '-O-frequent or that continue.These modifications make oligonucleotide more stable, and are lower than other treatment means toxicity.On the other hand, cross and express the miRNA that those have the tumor suppressor gene effect, also can be used for the treatment of some specific tumor as let-7 family.Utilize the expression system of virus or liposome can a large amount of miRNA of instantaneous introducing.These technology can guarantee to express pre-miRNA and both sides sequence thereof under some tissue-specific promoter control, and the miRNA of stimulation of endogenous processing, produce correct miRNA, suppress specific gene and express.
MiR-15a and miR-16-1 are positioned at 13q14.3, the disappearance zone of a 30kb, these two kinds of gene expression dose downward modulation (Amelia C of 65% B-CLL, George AC, Muller F, et al.MiR-15 and miR-16 induce apoptosis bytargeting Bcl-2[J] .Proc Natl Acad Sci USA, 2005,102 (39): 13944-13949.).One of reason of downward modulation is about 40% tumor specimen generation 13q14 zone disappearance (Calin GA, Dumitru CD, Shimizu M, et al.Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 inchronic lymphocytic leukemia[J] .Proc Natl cad Sci USA, 2002,99 (24): 15524-15529.).CLL case 13q14 homozygosity or loss of heterozygosity are the modal chromosomal abnormality of CLL, 50% lymphoma mantle cell, and 16～40% multiple myeloma and 60% carcinoma of prostate 13q14 lose.Show that there are one or more tumor suppressor genes in 13q14, take place relevant with the nosetiology of human tumor.Another kind of possible explanation is, C → T sudden change takes place in part leukaemic's 7bp place, miR-15a/miR-16-1 precursor downstream, this sudden change influences processing maturation (the Calin GA of miRNA, Ferracin M, Cimino A, et al.A microRNA signature associated with prognosis and progression in chroniclymphocytic leukemia[J] .New Engl J Med, 2005,353 (17): 1793-1801.).(AmeliaC such as Amelia, George AC, Muller F, et al.MiR-15 and miR-16 induce apoptosis by targeting Bcl-2[J] .ProcNatl Acad Sci USA, 2005,102 (39): 13944-13949.) find, in CLL, the expression of miR-15a and miR-16-1 and Bcl-2 are expressed as negative correlation, and two kinds of miRNA all can regulate Bcl-2 in the post-transcriptional level negativity.MiR-15 is identical by 9 base sequences of 5 ' end with miR-16, and the 3287-3279 base complementrity of these 9 bases and Bcl-2.MiR-15/miR-16 is transfected into the MEG-01 cell, can finds the apoptosis of cell, the removing of pro-caspase9 and PARP.
The existing miR-15a/16-1 that studies show that may be relevant with the generation of neoplastic hematologic disorder, but also do not have these two kinds of Micrornas to can be used for tumor at present, especially the evidence of lymphoma treating and/or prevention.
Summary of the invention
The objective of the invention is miR-15a and miR-16-1 are used for the preparation prevention or treat lymphadenomatous medicine.
For this reason, the invention provides following technical scheme: a kind of Microrna treats and/or prevents application in the lymphoid tumor medicament in preparation, and the active component of described medicine comprises precursor or the two or more mixture in them of precursor, the Microrna-16-1 of Microrna-15a, Microrna-16-1, Microrna-15a.
Preferably, described Microrna or its precursor are through known improvement sex modification.
Specialize as a kind of of above-mentioned application, the invention provides a kind of lymphadenomatous pharmaceutical composition that treats and/or prevents, said composition comprises Microrna and pharmaceutically acceptable diluent, carrier or the adjuvant of effective dose, and described Microrna is precursor or the two or more mixture in them of precursor, the Microrna-16-1 of Microrna-15a, Microrna-16-1, Microrna-15a.
A kind of preferred as above-mentioned composition: also comprise can the induced tumor apoptosis chemotherapeutics.Described chemotherapeutics more preferably can be induced the medicine of lymphoma cell apoptosis such as cytosine arabinoside, vincristine, amycin, daunorubicin, methotrexate, arsenic trioxide or two or more mixture etc. in them.
Described Microrna or its precursor can obtain by chemosynthesis, for strengthening pharmacy features such as its stability, bioavailability, tissue target tropism, can carry out known improvement sex modification to it, as thio-modification or methoxy modification etc.; Perhaps obtaining by making up carrier for expression of eukaryon, also is to comprise the expression vector that contains above-mentioned Microrna sequence in the active component of medicine, plays corresponding drug action after this carrier is expressed in vivo.Described carrier for expression of eukaryon can be plasmid vector or viral vector, and other can be by the carrier format of means acquisition known in this field.
Preferably, described carrier for expression of eukaryon is plasmid vector or viral vector.
Pharmaceutical composition of the present invention is suitable for prevention and/or lymphoma, the especially lymphadenomatous treatment of Burkitt.
Ultimate principle of the present invention: the present invention is chemosynthesis miR-15a and miR-16-1 oligonucleotide at first, detects it Raji cell is had or not apoptosis-induced effect.The oligonucleotide fragment of chemosynthesis is little, is transfected into cell easily.For studying sophisticated miR-15a/16-1 and its precursor the influence of Raji cell is had or not diversity on the function.The present invention has also made up miR-15a precursor carrier for expression of eukaryon.By the synthetic miR-15a precursor sequence of amplification in vitro is implemented in the pGCSIL-GFP carrier for expression of eukaryon, behind the transfectional cell, at U
6Be transcribed into the pre-miR-15a of " stem ring " structure under the effect of promoter, be processed into sophisticated miR-15a, thereby performance is to the regulating and controlling effect of target gene by montage under the effect of the rna plymerase iii Dicer of self in the cell.
The present invention adopts fluorescence quantitative PCR method to detect the expression of respectively organizing ripe miR-15a in the cell after the transfection, experimental results show that the expression of miR-15a in the cell, behind transfection expression pre-miR-15a recombiant plasmid, significantly increase, the proteic expression of Bcl-2 significantly descends in the cell, and respectively organize the expression unknown significance difference of Bcl-2mRNA, as seen miR-15a regulates and control Bcl-2 at post-transcriptional level, promptly suppress the Bcl-2mRNA translation, thereby the proteic expression of downward modulation Bcl-2, rather than the Bcl-2mRNA that directly degrades; And then adopting trypan blue exclusion method and CCK8 method all to detect miR-15a group, miR-16-1 group and pre-miR-15a group cell 48h and the 72h proliferation activity significantly descends, Hoechst dyeing visible miR-15a, miR-16-1 and pre-miR-15a processed group from the morphology have the obvious apoptosis corpusculum; FCM result shows that also the apoptosis rate of this group will be higher than other groups, and promptly miR-15a and miR-16-1 have promoted the apoptosis of Raji cell.The result shows that miR-15a and miR-16-1 can promote the Raji apoptosis by suppressing the expression of anti-apoptotic genes expression Bcl-2, reduce the proliferation activity of cell, suppress the growth of cell, can be used for preparing the medicine of relevant prevention or treatment tumor.
Many chemotherapeutics all produce anticarcinogenic effect by inducing tumor cell generation apoptosis.Bcl-2 family is apoptotic important controlling gene, in apoptotic process, be in the terminal portion branch of regulatory mechanism, this gene family has important function in the dynamic equilibrium of keeping cell physiological differentiation, growth and cell quantity, its expression status affects the generation of generation, development and the multidrug resistance of tumor to a certain extent.The Bcl-2 gene family is the gene family of the most valued present regulating cell apoptosis, Bcl-2 is one of research member the most extensively and profoundly in the Bcl-2 family, can suppress p53 gene damage is reacted and inductive apoptosis, it crosses expression can cause the different medicine of cell tolerance.The cell Chinese medicine of crossing expression at Bcl-2 still can enter inducing cell damage in the cell, but this damage can not convert apoptotic signal effectively to, so that the physiological apoptosis of tumor cell is subjected to press down, increased the life span of tumor cell, the tumor cell that the result expresses Bcl-2 at chemotherapeutic period still can regrow with speed faster.The mistake of Bcl-2 is expressed in leukaemia's the apoptosis and plays an important role, and the activity of the anti-apoptosis of chemotherapeutics itself mainly depends on the expression of Bcl-2 family protein.The Bcl-2 protein overexpression also can obviously reduce the sensitivity of tumor cell to multiple chemotherapeutics such as cytosine arabinoside (Ara-C), methotrexate and cyclophosphamide.Ara-C is a DNA polymerase inhibitor, by the inhibition to the DNA polymerase, and influences duplicating of DNA.Ara-C is the first-selected and very effective chemotherapeutics of treatment acute leukemia, is the model of ucleosides antimetabolite, and its ability of killing the leukaemia is relevant with the apoptosis of its inducing tumor cell.
In the present invention, we with the cell of transfection random sequence (or negative control plasmid) as object of reference, compare under the Ara-C of variable concentrations effect the difference of cell viability between the Raji cell of transfection miR-15a/16-1 oligonucleotide (or expressing pre-miR-15a recombiant plasmid) and the control cells.Found that, the Raji cell of transfection miR-15a/16-1 (or expressing the pre-miR-15a recombiant plasmid), under variable concentrations Ara-C (0～80 μ g/ml) effect, the inhibition of cell viability obviously is better than control cells, and the IC50 value of miR-15a/16-1+Ara-C group obviously reduces.The CCK8 method detects the group (P＜0.05) that the cell proliferation vigor that shows miR-15a/16-1 (or expressing the pre-miR-15a recombiant plasmid) and Ara-C coupling group will be distinguished single usefulness well below both.Hoechst dyeing can be seen after the Raji cell of transfection miR-15a/16-1 (or expressing the pre-miR-15a recombiant plasmid) is using Ara-C and a large amount of apoptotic bodies occur.FCM detection apoptosis rate result shows that the apoptosis rate of miR-15a/16-1+Ara-C group (or pre-miR-15a+Ara-C group) obviously increases, and single apoptosis rate with Ara-C or random sequence+Ara-C group (or negative control plasmid+Ara-C organizes) has significant difference (P＜0.05).Prompting miR-15a/16-1 can pass through the expression of regulation and control Bcl-2, and changes the sensitivity of Raji cell to Ara-C.Thus, we have adequate reasons and believe that miR-15a/16-1 or its precursor can form a kind of pharmaceutical composition with chemotherapeutics (for example Ara-C) that can the induced tumor apoptosis, are used for better prevention or the relevant tumor disease of treatment.
The present invention has following beneficial effect: at first be to provide new optional approach for preventing or treating lymphoma, the part Microrna is applied to the preparation prevention or treats lymphadenomatous medicine by a large amount of having experimental results show that is practicable; Next is to have proved that the part Microrna can be used as the complementary composition of known chemotherapeutics, or with known chemotherapeutics coupling, can suppress growth of tumour cell and promote to bring into play better therapeutic aspect the apoptosis of tumor cells.
Description of drawings
Fluorescence microscope figure below (* 100) A behind Fig. 1 transfection 24h, B is negative control plasmid group.
Fig. 2 transfection miR-15a and miR-16-oligonucleotide RT-PCR record the Bcl-2mRNA expression of Raji cell;
M:marker, 1: blank group, 2: random sequence group, 3:miR-15a group, 4:miR-16-1 group.
Fig. 3 transfection expression pre-miR-15a recombiant plasmid RT-PCR records the Bcl-2mRNA expression of Raji cell;
M:marker, 1: blank group, 2: negative control plasmid group, 3:pre-miR-15a group.
Fig. 4 transfection miR-15a/16-148h flow cytometer detects the proteic expression of Bcl-2 in the Raji cell;
A: blank group, B: random sequence group, C:miR-15a group, D:miR-16-1 group.
Fig. 5 transfection expression pre-miR-15a recombiant plasmid 48h flow cytometer detects the proteic expression of Bcl-2 in the Raji cell;
A: blank group, B: negative control plasmid group, C:pre-miR-15a group.
Fig. 6 trypan blue exclusion method detection miR-15a and miR-16-1 are to the growth inhibited effect of Raji cell;
A: transfection miR-15a and miR-16-1 oligonucleotide b: transfection expression pre-miR-15a recombiant plasmid
*Compare P＜0.05 with the blank group with random sequence group (or blank group and negative control plasmid group).
Fig. 7 transfection miR-15a and miR-16-1 act on the morphological change (Hoechst fluorescence staining * 400) of Raji cell 48h;
A blank group; B random sequence group; C miR-15a group; D miR-16-1 group.
Fig. 8 transfection expression pre-miR-15a recombiant plasmid acts on the morphological change (Hoechst fluorescence staining * 400) of Raji cell 48h;
A blank group; B negative control plasmid group; C pre-miR-15a group.
Fig. 9 flow cytometer detection miR-15a and miR-16-1 act on the apoptosis figure (the two methods of dying of Annexin V/PI) of Raji cell 48h;
A blank group; B random sequence group; C miR-15a group; D miR-16-1 group.
Figure 10 flow cytometer detection miR-15a and miR-16-1 act on the apoptosis figure (PI staining) of Raji cell 48h;
A blank group; B negative control plasmid group; C pre-miR-15a group.
The inhibition of Raji cell viability behind Figure 11 CCK8 method detection miRNA associating Ara-C;
A:miR-15a or miR-16-1 oligonucleotide associating Ara-C; B: express pre-miR-15a recombiant plasmid associating Ara-C.
Figure 12 miR-15a and miR-16-1 associating Ara-C are to the growth inhibited effect of Raji cell;
*Compare P＜0.05 with other group.
Figure 13 expresses the growth inhibited effect of pre-miR-15a recombiant plasmid associating Ara-C to the Raji cell;
*P＜0.05 (comparing) with other group.
Figure 14 transfection miR-15a/16-1 also unites the morphological change (Hoechst fluorescence staining * 400) that Ara-C acts on Raji cell 48h;
A: blank group, B: random sequence group, C:miR-15a group, D:miR-16-1 group, E:Ara-C group, F: random sequence+Ara-C group, G:miR-15a+Ara-C group, H:miR-16-1+Ara-C group.
Figure 15 transfection expression pre-miR-15a recombiant plasmid is also united the morphological change (Hoechst fluorescence staining * 400) that Ara-C acts on Raji cell 48h;
A: blank group, B: negative control plasmid group, C:pre-miR-15a group, D:Ara-C group, E: negative control plasmid+Ara-C group, F:pre-miR-15a+Ara-C group.
Figure 16 transfection miR-15a/16-1 and unite Ara-C 48h after Raji apoptosis figure.(the two methods of dying of flow cytometer-AnnexinV/PI detect);
A: blank group, B: random sequence group, C:miR-15a group, D:miR-16-1 group, E:Ara-C group, F: random sequence+Ara-C group, G:miR-15a+Ara-C group, H:miR-16-1+Ara-C group.
Figure 17 transfection expression pre-miR-15a recombiant plasmid and unite Ara-C 48h after Raji apoptosis figure.(flow cytometer-PI dyes method and detects);
A: blank group, B: negative control plasmid group, C:pre-miR-15a group, D:Ara-C group, E: negative control plasmid+Ara-C group; F:pre-miR-15a group+Ara-C group.
The specific embodiment
Below in conjunction with embodiment, the present invention is done detailed description further, but implementation of the present invention is not limited thereto.
One, experimental technique
1.miR-15a, the design of miR-16-1 and pre-miR-15a (miR-15a precursor) oligonucleotide is with synthetic
According to MiRBase (
Http:// www.sanger.ac.uk/Software/Rfam/mirna) the miRNA gene order that provides, obtain the sequence of people miR-15a, miR-16-1 and pre-miR-15a.Adopt BLAST software to analyze, determine control sequence at random, miR-15a, miR-16-1 oligonucleotide are by the full thio-modification of the synthetic strand of Shanghai biotechnology Services Co., Ltd.Sequence is as follows:
Three RNA of chemosynthesis:
miR-15a： 5’-uagcagcacauaaugguuugug-3’ (22bp)
miR-16-1： 5’-uagcagcacguaaauauuggcg-3’ (22bp)
scrambled?sequence： 5’-cauuaaugucggacaacucaau-3’ (22bp)
Pre-miR-15a (corresponding gene order): (83bp)
5’-ccttggagtaaagtagcagcacataatggtttgtggattttgaaaaggtgcaggccatattgtgctgcctcaaaaatacaagg-3’
negative?control?sequence： (83bp)
5’-agcttttccaaaaattctccgaacgtgtcacgttctcttgaaacgtgacacgttcggagaagggttctccgaacgtgtcacgt-3’
2. plasmid construction
2.1 obtain the purpose fragment
(1) from " The miRNA Registry " data base (
Http:// microrna.sanger.ac.uk/) the middle pre-miR-15a sequence that obtains, adopt BLAST software to analyze, determine the negative control sequence.Design and synthesize the pre-miR-15a sequence the acquisition fragment (pre-miR-15a-1:5 ' cgggt
AccggtCcttggagtaaagtagcagcacataatggtttg tggattttgaaaaggtgc-3 '; Pre-miR-15a-2:5 ' ccg
GaattcAnd introduce AgeI, EcoR I restriction enzyme site cttgtatttttgaggcagcacaatatg gcctgcaccttttcaaaatccac-3 ').(2) pcr amplification obtains the purpose fragment: reaction system is: pre-miR-15a-1,2 each 5 μ L, ddH
2O6.5 μ L, 10 * buffer, 2 μ L, MgCl
20.5 μ L, DNTPs (2.5mM) 0.8 μ L, pfu polymerase 0.2 μ L.Reaction condition: 94 ℃ of 30s; 94 ℃ of 30s; 55 ℃ of 30s; 72 ℃ of 30s; 72 ℃ of 2min, 20 circulations.(3) enzyme action PCR fragment: use Age I/EcoR I to carry out enzyme action digestion, endonuclease reaction system: PCR product (100ng/ μ L) 5 μ L, 10 * buffer5 μ L, 100 * BSA, 0.5 μ L, Age I (10U/ μ l) 1 μ L, EcoR I (10U/ μ L) 1 μ L, ddH
2O is settled to 50 μ L.Place 37 ℃, 1h.
2.2 construction of recombinant plasmid
(1) Age I and EcoR I enzyme action pGCSIL-GFP carrier are so that its linearisation.Endonuclease reaction system: the DNA plasmid of purification (1 μ g/ μ l) 2 μ L, 10 * buffer, 5 μ L, 100 * BSA, 0.5 μ L, Age I (10U/ μ L) 1 μ L, EcoR I (10U/ μ L) 1 μ L, ddH
2O is settled to 50 μ L.Place 37 ℃, 1h.(2) calcium chloride prepares fresh competent escherichia coli cell.From single bacterium colony of picking in 16 hours fresh flat board of 37 ℃ of cultivations, forward in the flask that contains 100ml LB.After 3h is cultivated in 37 ℃ of violent joltings, forward in the 50ml polypropylene tube of ice pre-cooling, place 10min on ice.4 ℃, 4000rpm, 10min reclaims cell.Pour out culture fluid, the CaCl of 10ml ice pre-cooling
2(0.1mol/L) resuspended every part of precipitation, 4 ℃, 4000rpm, 10min reclaims cell.Pour out culture fluid, CaCl
2(0.1mol/L) resuspended every part of precipitation.-70 ℃ frozen.(3) connect.Reaction system: carrier DNA (100ng/ μ l) the 1 μ L that enzyme action reclaims, annealed double-stranded DNA (100ng/ μ l) 1 μ L, 10 * T4 phage DNA ligase buffer, 1 μ L, T4 phage DNA ligase 1 μ L, dd H
2O is settled to 10 μ L.Place 4 ℃ of 12h.(4) transform.Aseptic suction nozzle is got competent cell suspension 200 μ L to aseptic microcentrifugal tube, adds 2 μ L and connects liquid, and mixing is put 30min on ice.42 ℃ of temperature are bathed 90s, cool off 2min rapidly.Add 800 μ L SOC culture medium, 37 ℃ of shaking table temperature are bathed 45min.Getting 150 μ L is transferred to and contains MgSO
4(20mmol/L) and on the LB agar culture medium of Amp resistance (100 μ g/ml).Cultivate 16h for 37 ℃.
2.3 the PCR of positive colony identifies
Utilize the sequence on the carrier to carry out PCR evaluation positive colony as primer.Primer sequence is: forward primer 5 '-CCTATTTCCCATGATTCCTTCATA-3 ', downstream primer 5 ' GTAATACGGTTATCCACGCG-3 '.The PCR reaction system: each 0.4 μ L of upstream and downstream primer, 10 * buffer, 2 μ L, MgCL2 0.5 μ L, DNTPs (2.5mM) 0.8 μ L, Taq polymerase 0.2 μ L, Template 1 μ L, ddH2O is settled to 20 μ L.
2.4 order-checking
Select positive colony PGCSIL-GFP-pre-miR-15a bacterium liquid and send order-checking (Mei Ji company carries out ABI 3733 type sequenators and carries out sequencing analysis).
3. from escherichia coli, extract plasmid
Use commercial test kit or known plasmid extraction method commonly used to extract plasmid.
4. cell culture
Raji cell line is purchased in the Shanghai cell bank.The Raji cell inoculation in the RPMI1640 culture medium that contains volume fraction 10% new-born calf serum, 100U/mL penicillin and 100U/mL streptomycin, is being contained volume fraction 5%CO
237 ℃ of continuous culture of incubator.
5. experiment is divided into groups and cell transfecting
5.1 experiment grouping
Experiment induces the Raji apoptosis partly to divide 4 groups at research miR-15a/16-1 oligonucleotide: blank group, random sequence group, miR-15a group and miR-16-1 group;
Expressing the pre-miR-15a recombiant plasmid in research induces the Raji apoptosis partly to divide 3 groups: blank group, negative control plasmid group, pre-miR-15a group;
Strengthening Ara-C at research miR-15a/16-1 oligonucleotide induces the Raji apoptosis partly to divide 8 groups: blank group, random sequence group, miR-15a group, miR-16-1 group, Ara-C group, random sequence+Ara-C group, miR-15a+Ara-C group and miR-16-1+Ara-C group;
Expressing pre-miR-15a recombiant plasmid enhancing Ara-C in research induces the Raji apoptosis partly to divide 6 groups: blank group, negative control plasmid group, pre-miR-15a group, Ara-C group, negative control plasmid+Ara-C group and pre-miR-15a+Ara-C group
5.2 cell transfecting:
(1) according to grouping, in transfection the previous day, with 4-8 * 10
5The cell density of/mL is inoculated on 96 well culture plates;
(2) every hole is pressed in the preparation of solution a: 12.5 μ L serum-free mediums+0.5 μ L Lipofectamine
TM2000 carry out;
(3) preparation of solution b is by every hole: 12.5 μ L serum-free mediums+0.2 μ g plasmid (or oligonucleotide) carries out, and prepares under the room temperature of back and places 5min;
(4) solution a is mixed room temperature underlying 20min with solution b;
(5) meanwhile, use the cell in 96 orifice plates instead serum-free medium, final volume is 125 μ L;
(6) mixed liquor with solution a and solution b dropwise adds in the hand-hole wave and culture plate, mixing gently.At 37 ℃, 5% CO
2Middle insulation 5-6h;
(7) behind the 6h, change the full culture medium that contains serum, at 37 ℃, 5% CO
2Cultivate in the incubator.
The detection of transfection efficiency: behind the transfection 24h, under fluorescence microscope, select 10 200 times of visuals field, the cell number of band green fluorescence in 200 cells of statistics in each visual field, the percentage ratio of calculating fluorecyte.
6. sxemiquantitative RT-PCR detects transfectional cell Bcl-2 mRNA expression
The cell of respectively organizing of transfection 48h is carried out centrifugal collection under aseptic condition.The level of application cell total RNA extracting and purifying test kit and RT-PCR kit measurement Bcl-2 mRNA.
6.1 the extraction of cell total rna and purification
1) collect centrifuge cell, remove its supernatant, wash twice with PBS after, cell transfer is gone in the 1.5mL centrifuge tube, every pipe adds Trizol reagent 1mL, shakes up, and behind the room temperature underlying 15min, blows and beats schistocyte repeatedly;
2) the good cell of digestion in each pipe is split liquid and be drawn onto in the 1.5mLEP pipe that a DEPC handled, add chloroform 0.2mL (Trizol: chloroform is about 5: 1), jog 15s, and hatch 15min on ice;
3) 12,000rpm, 15min is 4 ℃, centrifugal.Get the colourless water of supernatant then to the EP pipe that DEPC handled, add the 0.5mL isopropyl alcohol, room temperature underlying 10min;
4) 12,000rpm, 10min is 4 ℃, centrifugal.Observe total RNA in the pipe white precipitate at the end, supernatant discarded;
5) add with the new 75% ethanol 1.0mL for preparing of DEPC water through pre-cooling, washing precipitation gently, 12,000rpm, 5min, 4 ℃ are centrifugal;
6) remove supernatant, the time centrifugal, blot liquid with little Tip; Make the precipitation natural drying, DEPC treating water 20-30 μ L adds, mixing, the 55-60 ℃ of molten total RNA of water-bath 10min;
7) survey total RNA purity and concentration with the uv-spectrophotometric instrument, identify whether water of RNA, identify that the back is standby in-70 ℃ of preservations with agarose gel electrophoresis.
6.2 the evaluation of cell total rna
Concentration analysis and purity are identified: draw 1 μ L from the RNA that extracts, be diluted to 100 μ L with DEPC water, survey the concentration of total RNA, the ratio of absorbance A260 and A280 (A260/A280) respectively with the uv-spectrophotometric instrument.
6.3 reverse transcription reaction
Get above-mentioned RNA sample, it be diluted to 1 μ g/ μ L, in the PCR pipe, add the mixture of following reagent:
RNA 3μL(3μg)
Random?Primer(10μM) 2μL
dNTP?Mixture(2.5μM) 2μL
5×First-Strand?Buffer 4μL
DTT(0.1M) 1μL
RNase?inhibitor(10U/μL) 0.5μL
M-MLV(200U) 1μL
RNase-free ddH
2O is settled to 50 μ L
On the PCR instrument according to following conditioned response: 42 ℃ of temperature are bathed 50min, 95 ℃ of heating 5min, the time centrifugal ,-20 ℃ of preservations are standby.
6.4PCR amplification
The Bcl-2 primer sequence is as follows: forward primer: 5 '-GTGGCCTTCTTTGAGTTCG-3 ', downstream primer: 5 '-CTTCAGAGACAGCCAGGAG-3 ', product length 212bp. internal reference β-actin primer sequence: forward primer 5 '-TGTATGCCTCTGGTCGTACCAC-3 ', downstream 5 '-ACAGAGTACTTGCGCTCAGGAG-3 ', product length 592bp.
Get above-mentioned product cDNA amplification confidential reference items β-actin earlier,, determine whether cDNA is synthetic successful, and synthetic successful specimen is carried out the PCR reaction, adds following reagent in the amplification pipe successively then according to the result of β-actin:
CDNA (template) 2 μ L
Forward primer (10 μ M) 1 μ L
Downstream primer (10 μ M) 2 μ L
dNTP?Mixture(2.5mM) 4μL
10 * Taq buffer (contains MgCl
2) 5 μ L
Taq enzyme (2.5U/ μ L) 1 μ L
ddH
2O 36μL
The mentioned reagent mixing, by following amplification condition PCR:94 ℃ degeneration 1min, 55 ℃ of renaturation 45s, 72 ℃ are extended 1min, circulate 72 ℃ of insulation 5min 30 times.The PCR product is electrophoresis observation and photograph on 3% agarose gel, observes on Gel-Doc1000 type ultraviolet gel images analyser, analyzes.
7. fluorescence quantitative PCR detection method (Hairpin-it
TMMiRNAs Real-Time PCR Quantitation Kit) expression of detection miR-15a
7.1RNA extract (method is the same)
7.2RT the synthetic cDNA of reaction
According to Hairpin-it
TMThe description that miRNAs Real-Time PCR Quantitation Kit provides is operated, and reaction is 20 μ L systems.
5×RT?Buffer 5μL
DTT(0.1M) 2.5μL
dNTP(10mM) 0.75μL
Mg2+(25mM) 3μL
miR-RT?primers(1μM) 1.25μL
RNasin(40U/μL) 0.25μL
MMLV?Reverse?Transcriptase(200U/μL) 0.5μL
RNA?Sample(0.2ng?to?200ng?total?RNA) XμL
Rnase?Free?H
2O?to?20μL
All ingredients and reverse transcription mix mixing that must will be except reverse transcription before reverse transcription reaction be with pointing the pipe that flicks installed reagents.Reaction condition is: 16 ℃ of 30min, 42 ℃ of 30min, 85 ℃ of 10min.Product is in-20 ℃ of preservations.
7.3Real-Time PCR detects the expression of miR-15a
According to Hairpin-it
TMThe description that miRNAs Real-Time PCR Quantitation Kit provides is operated, and reaction is 20 μ L systems.
2×Real-time?PCR?Buffer 10μL
miR?specific?Primer?set(5μM) 0.8μL
miRNA?RT?product 2μL
Taq?DNA?polymerase(5U/μL) 0.2μL
dd?H2O?To?20μL
Reaction condition is: 95 ℃ of preheating 3min, and 40 circulations are carried out in following reaction: 95 ℃ of degeneration 12s, 55 ℃ of renaturation 25s, 72 ℃ are extended 25s.
8. indirect immunofluorescence and flow cytometer detect Bcl-2 protein expression situation
After the centrifugal collection transfection 48h respectively organize cell, with the fixing 30min of 4% paraformaldehyde room temperature, add volume fraction 3%H after PBS washes
2O
2, room temperature 10min, PBS wash 3 times, each 5min adds 10g/L TritonX-100, room temperature 10min, PBS washes back increase serum room temperature sealing 40min, gets rid of and does not wash, and drips mouse-anti people Bcl-2 antibody, 4 ℃ are spent the night, next day rewarming 30min, PBS washes, the sheep anti mouse two anti-incubated cells that add 20 μ LCy3 labellings, room temperature lucifuge reaction 30min, PBS washes 3 times, each 5min goes up machine behind the PBS mixing, flow cytometer (FCM) is measured the positive rate of Bcl-2 protein expression.
9. trypan blue cell counting
The cell inoculation of exponential phase in 96 well culture plates, is carried out transfection according to above-mentioned steps, respectively at 24,48 and the 72h harvesting, conventional trypan blue (0.5%) dyeing, with blood counting chamber living cell counting number, the experiment triplicate.
10.CCK8 method is surveyed inhibitory rate of cell growth and IC50 value
The cell inoculation of exponential phase in 96 well culture plates, is carried out transfection according to above-mentioned steps, place 37 ℃, saturated humidity, 5%CO
2Behind conventional cultivation 24,48 and the 72h, in every hole, add 30 μ L CCK8 under the condition, place 37 ℃ to hatch 4h again.Directly joining survey A in 450nm wavelength place on the detector then
450Value is with A
450Reflect cell survival quantity indirectly.Experiment repeats 3 times, can calculate miR-15a and miR-16-1 transfection in view of the above after each time point to Raji cell inhibiting rate.
Grouping and transfection Raji cell are hatched with the Ara-C (0,5,10,20,40,80 μ g/ml) of variable concentrations respectively as stated above, and the CCK8 method is surveyed and respectively organized A behind the 24h
450Value, and calculate following parameter:
2. half-inhibition concentration (IC50): adopt probit method PROBIT (Probability unit).
11.Hoechst staining kit observing apoptosis cellular morphology
Collection is through 48 hours cell of liposome transfection, and the centrifugal collecting cell sample adds the 0.5ml fixative in the 1.5ml centrifuge tube, and mixing is fixed 10 minutes.The centrifugal fixative that goes, PBS washes twice.Last centrifugal back is inhaled and is gone most of liquid to keep about 50 μ l liquid, has slowly hanged cell again, drops on the microscope slide, dries. and evenly drip and go up 0.5ml Hoechst 33258 dyeing liquors, dyeed 5 minutes, dry.PBS washes twice.Drip anti-fluorescent quenching mounting liquid on microscope slide, cover a clean coverslip, avoid bubble.Fluorescence microscope can detect the nucleus that is blue.
12. flow cytometer detects apoptosis rate
12.1AnnexinV/PI two methods of dying
48h's respectively organizes cell after the centrifugal collection transfection, PBS washing 2 times, the centrifugal supernatant that goes, 195 μ L Annexin V-FITC are in conjunction with the liquid re-suspended cell, add Annexin V-FITC 5 μ L, lucifuge is hatched 10min, the centrifugal supernatant that goes, and 190 μ L AnnexinV-FITC are in conjunction with the liquid re-suspended cell, add 10 μ L propidium iodide dyeing liquors, the ice bath lucifuge is placed, and carries out flow cytometer immediately and detects, with MULTCYCLE software analysis result.
12.2PI staining
48h's respectively organizes cell, PBS washing 2 times, the centrifugal supernatant that goes after the centrifugal collection transfection, at 4 ℃ of fixing 30min, discard ethanol with volume fraction 70% ethanol of-20 ℃ of pre-coolings then, add 500 μ L PBS mixing cells, add propidium iodide (PI) then, lucifuge dyeing 15min.Put cells were tested by flow cytometry and respectively organize apoptosis rate, with MULTICYCLE software analysis result.
13. statistical procedures
Adopt SPSS 13.0 softwares to carry out the statistical analysis of data.Experimental data is represented with means standard deviation, data relatively between many groups, adopt the one factor analysis of variance of completely random block design, relatively selecting for use between group can be carried out per two means q check or Bonferroni check relatively between a plurality of sample averages, and the IC50 value is calculated and adopted Probit unit's probabilistic method.
Two, miR-15a and miR-16-1 suppress the growth of Raji cell
1, the successful structure of pre-miR-15a recombiant plasmid
The plasmid sequencing result is as follows:
AATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATG TTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGG CTTTATATATCTTGTGGAAAGGACGAAACACCGGT
CCTTGG AGTAAAGTAGCAGCACATAATGGTTTGTGGATTTTGAAAAGGTGCAGGCCATATTG TGCTGCCTCAAAAATACAAGGAATTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATTAGT TATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCG CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCC, sequencing result show that the gained recombiant plasmid successfully inserts the pre-miR-15a sequence.
2, cell transfecting efficient
Cell behind the transfection negative control plasmid 24h is placed observation under the inverted fluorescence microscope, can see the parts of fine born of the same parents and present green fluorescence (gene that contains encoding green fluorescent protein in the transfection plasmid), under fluorescence microscope, select the cell number of being with green fluorescence in each visual field, 10 the 200 times visuals field in 200 cells of statistics, the percentage ratio that calculates fluorecyte is transfection efficiency, and its value is (39 ± 2.4%).The experiment of back is all carried out transfection in liposome under this transfection efficiency and plasmid ratio.The picture of Fig. 1 under inverted fluorescence microscope, seeing behind the transfection 24h.
3, fluorescence quantitative PCR method detects the expression of miR-15a
Behind the transfection expression pre-miR-15a recombiant plasmid 24h, each organizes C
TValue and molal quantity see Table 1.Credit is analysed by statistics, the miR-15a C of pre-miR-15a group
TValue and molal quantity obviously increase than blank group and negative control plasmid group, and difference has statistical significance (P＜0.05).
Expression x ± s of miR-15a in the Raji cell behind the table 1 transfection pre-miR-15a 24h, n=3)
*Compare P＜0.05 with other groups
4, Bcl-2mRNA expression after the RT-PCR detection transfection
By the gel electrophoresis (Fig. 2,3) of Bcl-2 amplified production as seen, internal reference β-actin reason group throughout all has expression, and Bcl-2 amplified production Zone electophoresis band is about the 210bp position, and is consistent with the theoretical value of design primer.To the electrophoresis product analysis, calculate the optical density OD ratio of Bcl-2mRNA/ β-actin, relative abundance is respectively organized in reflection.Behind transfection miR-15a and the miR-16-1 oligonucleotide 48h, the relative abundance that each processed group Bcl-2 expresses is followed successively by: blank group 0.985 ± 0.006, random sequence group 0.978 ± 0.009, miR-15a group 0.974 ± 0.010, miR-16-1 group 0.989 ± 0.003, each group difference does not have significance (P＞0.05).Behind the transfection pre-miR-15a expression plasmid 48h, the relative abundance that each processed group Bcl-2 expresses is followed successively by: blank group 0.976 ± 0.005, negative control plasmid group 0.985 ± 0.007, pre-miR-15a group 0.969 ± 0.009, also there was no significant difference (P＞0.05) between each group.Show miR-15a and the miR-16-1 Bcl-2 mRNA that do not degrade.
5. indirect immunofluorescence and flow cytometer detect Bcl-2 protein expression situation (Fig. 4,5)
Fig. 4,5 result shows, the Raji cell is behind transfection miR-15a and miR-16-1 (or pre-miR-15a expression plasmid) 48h, the proteic expression of Bcl-2 all reduces, compare with blank group and random sequence group (or blank group and negative control plasmid group), difference has significance (P＜0.05); And blank group and random sequence group (or blank group and negative control plasmid group) differences does not have significance (P＞0.05), and each is organized the Bcl-2 expressing quantity and sees Table 2,3.
Table 2 transfection miR-15a/16-1 oligonucleotide 48h Bcl-2 table 3 transfection expression pre-miR-15a recombiant plasmid 48h expressing quantity (x ± s, n=3) the Bcl-2 expressing quantity (x ± s, n=3)
*Compare P＜0.05 with other group
*Compare P＜0.05 with other group
6, trypan blue exclusion method detection miR-15a and miR-16-1 are to the growth inhibited effect of lymphoma cell Raji
The result shows, after final concentration is the miR-15a and miR-16-1 oligonucleotide (or pre-miR-15a expression plasmid) transfection Raji cell of 0.6 μ mol/L, the 24h action effect is not obvious, difference does not have significance (P＞0.05), 48h and 72h can bring into play the growth inhibited effect of pair cell, and along with the increase of action time, effect strengthens gradually, the 48h action effect is obvious, and tangible time-effect relationship (Fig. 6) is arranged.
7, CCK8 method detection miR-15a and miR-16-1 are to the influence of Raji cell growth
Table 4 shows: the Raji ability of cell proliferation of transfection miR-15a and miR-16-1 oligonucleotide is the poorest, its 24h, 48h and 72hOD value all are starkly lower than blank group and random sequence group (P＜0.05), wherein behind the transfection 24h, show promptly that through the Bonferroni check difference has significance between miR-15a group and the random sequence group, P=0.005, difference also has significance, P=0.014 between miR-16-1 group and the random sequence group; The multiplication capacity that table 5 shows pre-miR-15a group cell than blank group and negative control plasmid group a little less than, difference has significance (P＜0.05), wherein behind the transfection 24h, show that through the Bonferroni check difference has significance, P=0.004 between pre-miR-15a and the negative control plasmid group; Illustrate that miR-15a and miR-16-1 can suppress the growth and the propagation of Raji cell, and 24h, 48h and 72h all can play a role, and with the increase of action time, effect strengthens gradually, and the 72h action effect is the most obvious, and tangible time-effect relationship is arranged.
CCK8 method detection Raji cell absorbance A value behind table 4 transfection miR-15a and the miR-16-1 (x ± s, n=5)
*Compare P＜0.05 with other groups
CCK8 method detection Raji cell absorbance A value behind the table 5 transfection expression pre-miR-15a recombiant plasmid (x ± s, n=5)
*Compare P＜0.05 with other groups
8, Hoechst dyeing detects the apoptosis form
Fig. 7,8 are 48h Hoechst colored graph after the transfection.The all visible obvious apoptosis cell of miR-15a group and miR-16-1 group and pre-miR-15a group: intact nuclear membrane, smaller volume, caryoplasm pyknosis; And other groups are not seen obvious apoptotic cell.
9, flow cytometer detects apoptosis rate
48h behind transfection miR-15a and the miR-16-1 oligonucleotide, flow cytometer-AnnexinV/PI is two dye Faxian show the miR-15a group the early apoptosis rate and late period apoptosis rate be respectively 9.74% and 9.65%, the early apoptosis rate of miR-16-1 group and late period apoptosis rate be respectively 9.70% and 9.34%, with blank group and random sequence group comparing difference significance (P＜0.05) is arranged.And the apoptosis rate difference of blank group and random sequence group does not have significance (P＞0.05), sees Table 6.48h behind the transfection expression pre-miR-15a recombiant plasmid, the apoptosis rate of pre-miR-15a group is 12.43%, be significantly higher than blank group and negative control plasmid group (P＜0.05), and blank group and negative control plasmid group difference there is not significance (P＞0.05), see Table 7.As seen, miR-15a and miR-16-1 can induce the apoptosis (Fig. 9,10) of Raji cell.
The apoptosis that the two methods of dying of 48h flow cytometer-AnnexinV/PI detect the Raji cell behind table 6 transfection miR-15a and the miR-16-1 (x ± s, n=5)
*With other group ratio, P＜0.05
The apoptosis that 48h flow cytometer-PI method of dying detects the Raji cell behind the table 7 transfection expression pre-miR-15a recombiant plasmid (x ± s, n=5)
*Compare P＜0.05 with other group
Three, miR-15a and miR-16-1 can strengthen the Raji cell to cytosine arabinoside sensitivity
1.CCK8 detecting the IC50 value, method changes
1.1 transfection miR-15a/16-1 oligonucleotide is gone into the variation of Ara-C IC50 value behind the Raji cell
The Raji cell of transfection miR-15a is 0,5,10,20,40, behind the Ara-C effect 24h of 6 kinds of concentration of 80 μ g/ml, cell viability is respectively (97.15 ± 5.87%), (67.0 ± 3.96%), (37.23 ± 2.98%), (20.15 ± 2.24%), (0.85 ± 0.02%), (0.01 ± 0.01%), the Raji cell viability of transfection miR-16-1 is respectively (96.85 ± 6.14%), (66.38 ± 4.53%), (37.77 ± 3.61%), (20.85 ± 3.01%), (1.69 ± 0.75%), (0.31 ± 0.06%), be starkly lower than under the corresponding Ara-C mass action, the Raji cell viability of transfection random sequence is respectively (99.54 ± 6.23%), (73.00 ± 4.09%), (51.06 ± 3.52%), (26.46 ± 2.96%), (4.62 ± 1.38%), (1.92 ± 0.96%), the P value all＜0.05 is seen Figure 11 a.As seen, transfection miR-15a/16-1 oligonucleotide can make the IC50 value of Ara-C obviously reduce after going into the Raji cell, and each is organized the IC50 value and sees Table 8.
1.2 transfection expression pre-miR-15a recombiant plasmid is gone into the variation of Ara-C IC50 value behind the Raji cell
The Raji cell of transfection expression pre-miR-15a recombiant plasmid is 0,5,10,20,40, behind the Ara-C effect 24h of 6 kinds of concentration of 80 μ g/ml, cell viability is respectively (96.08 ± 6.3%), (67.85 ± 4.9%), (38.46 ± 2.1%), (14.62 ± 2.4%), (1.00 ± 0.4%), (0.08 ± 0.08%), be starkly lower than under the corresponding Ara-C mass action, the Raji cell viability of transfection negative control plasmid is respectively (96.00 ± 5.3%), (72.00 ± 4.8%), (51.38 ± 4.4%), (26.00 ± 3.8%), (8.00 ± 2.1%), (2.23 ± 1.6%), the P value all＜0.05 is seen Figure 11 b.As seen, transfection expression pre-miR-15a recombiant plasmid is gone into the Raji cell can make the IC50 value of Ara-C obviously reduce, and each is organized the IC50 value and sees Table 9.
Table 8 transfection miR-15a/16-1 oligonucleotide is gone into table 9 and is expressed the variation that the pre-miR-15a recombiant plasmid is gone into the variation Raji cell Ara-C IC50 value of Raji cell Ara-C IC50 value
*Compare P＜0.05 with other group
*Compare P＜0.05 with other group
2. the trypan blue exclusion method detects cell growth inhibited situation
2.1miR-15a/16-1 the growth inhibited effect experimental result to the Raji cell behind the oligonucleotide associating Ara-C shows, after final concentration is the miR-15a/16-1 oligonucleotide transfection Raji cell of 0.6 μ mol/L, the cell number of miR-15a+Ara-C group and miR-16-1+Ara-C group is single with miR-15a group, single with miR-16-1 group, single with Ara-C group and random sequence+obviously reduction of Ara-C group, begin to play a role during miR-15a/16-1 oligonucleotide effect 24h, and increase along with action time, its effect strengthens gradually, and the 72h action effect is obvious. (Figure 12)
2.2 express behind the pre-miR-15a recombiant plasmid associating Ara-C growth inhibited effect to the Raji cell
Experimental result shows, after expression pre-miR-15a recombiant plasmid is united the Ara-C of 10 μ g/ml, the growth of Raji cell obviously is suppressed (P＜0.05) than other groups, begin to play a role in 24h, and increase along with action time, its effect strengthens gradually, and the 72h action effect is obvious. (Figure 13)
3.CCK8 method detects the cell proliferation situation
3.1CCK8 method detects the influence of miR-15a/16-1 oligonucleotide associating Ara-C to the growth of Raji cell
CCK8 result's (table 10) shows: the Raji cell is after miR-15a/16-1 oligonucleotide and 10 μ g/mL Ara-C Combined Treatment, and cell-proliferation activity reduces greatly, and is starkly lower than other group (P＜0.05); And the cell proliferation vigor that Ara-C and random sequence synergy cause is organized quite with Ara-C with single, no significant difference (P＞0.05).This explanation transfection miR-15a or miR-16-1 oligonucleotide can strengthen the inhibitory action of Ara-C to the growth of Raji cell.
Table 10miR-15a and miR-16-1 oligonucleotide associating Ara-C CCK8 method detection Raji cell absorbance A value (x ± s, n=5)
*Other groups are compared, P＜0.05.
3.2CCK8 detecting, method expresses the influence of pre-miR-15a recombiant plasmid associating Ara-C to the growth of Raji cell
CCK8 result's (table 11) shows: transfection expression pre-miR-15a recombiant plasmid also adds with the Raji ability of cell proliferation behind the 10 μ g/mL Ara-C the poorlyest, and the CCK8 value of pre-miR-15a+Ara-C group will be lower than significantly that blank group, negative control plasmid group, pre-miR-15a are organized, Ara-C organizes, negative control plasmid+Ara-C organizes (P＜0.05); And Ara-C coupling negative control plasmid is not with singly comparing cell-proliferation activity with Ara-C has significant difference (P＞0.05).This explanation can strengthen the inhibitory action of Ara-C to the growth of Raji cell after expressing pre-miR-15a recombiant plasmid and chemotherapeutics Ara-C coupling.
Table 11 expression pre-miR-15a recombiant plasmid associating Ara-C CCK8 method detection Raji cell absorbance A value (x ± s, n=5)
*Compare P＜0.05 with other groups.
4.Raji apoptotic morphological change
Through transfection miR-15a/16-1 oligonucleotide or express the pre-miR-15a recombiant plasmid and unite Ara-C group all visible a large amount of apoptotic cells after Hoechst dyeing: intact nuclear membrane, smaller volume, caryoplasm pyknosis; And other groups are not seen or rarely seen a small amount of apoptotic cell (Figure 14,15).
5. apoptosis rate analysis
5.1 transfection miR-15a/16-1 oligonucleotide and coupling Ara-C (the two methods of dying of flow cytometer-AnnexinV/PI)
Each is organized apoptosis rate and sees Table 12.Apoptosis rate during miR-15a or miR-16-1 oligonucleotide and Ara-C (10 μ g/mL) coupling is the highest, has compared significant difference (P＜0.05) with single with miR-15a or miR-16-1 oligonucleotide, the single group with Ara-C, random sequence coupling Ara-C; And random sequence+Ara-C group with single with comparison apoptosis rate unknown significance difference (P＞0.05) between the Ara-C group, between miR-15a and the miR-16-1.Show that miR-15a/16-1 oligonucleotide and Ara-C coupling can significantly increase the apoptosis rate of cell.(Figure 16)
Table 12 transfection miR-15a/16-1 and and associating Ara-C after the two methods of dying of 48h flow cytometer detect the Raji apoptosis rate (x ± s, n=5)
*Compare P＜0.05 with other groups
5.2 transfection expression pre-miR-15a recombiant plasmid and coupling Ara-C (flow cytometer-PI dyes method)
Each is organized apoptosis rate and sees Table 13.The apoptosis rate of expressing pre-miR-15a recombiant plasmid and Ara-C (10 μ g/mL) coupling is the highest, has compared significant difference (P＜0.05) with negative control plasmid, list with Ara-C, negative control plasmid coupling Ara-C with expression pre-miR-15a recombiant plasmid, list with single; And it is single with apoptosis rate unknown significance difference (P＞0.05) between Ara-C and the negative control plasmid coupling Ara-C.Show that expression pre-miR-15a recombiant plasmid and Ara-C coupling can significantly increase the apoptosis rate of cell.(Figure 17)
Behind table 13 transfection expression pre-miR-15a recombiant plasmid and the associating Ara-C 48h flow cytometer list method of dying detect the Raji apoptosis rate (x ± s, n=5)
*Compare P＜0.05 with other group
The foregoing description is a preferred implementation of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
Sequence table
＜110〉Ji'nan University
＜120〉Microrna treats and/or prevents application in the lymphoid tumor medicament in preparation
<130>090612
<160>13
<170>PatentIn?version?3.3
<210>1
<211>22
<212>RNA
＜213〉artificial sequence
<220>
<221>microRNA
<222>(1)..(22)
＜223〉miR-15a sequence
<400>1
uagcagcaca?uaaugguuug?ug 22
<210>2
<211>22
<212>RNA
＜213〉artificial sequence
<220>
<221>microRNA
<222>(1)..(22)
＜223〉microRNA16-1 sequence
<400>2
uagcagcacg?uaaauauugg?cg 22
<210>3
<211>22
<212>RNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(22)
＜223〉random sequence
<400>3
cauuaauguc?ggacaacuca?au 22
<210>4
<211>83
<212>DNA
<213>Homo?sapiens
<220>
<221>gene
<222>(1)..(83)
＜223〉pre-miR-15a precursor-gene sequence
<400>4
ccttggagta?aagtagcagc?acataatggt?ttgtggattt?tgaaaaggtg?caggccatat 60
tgtgctgcct?caaaaataca?agg 83
<210>5
<211>83
<212>DNA
＜213〉artificial sequence
<220>
<221>gene
<222>(1)..(83)
＜223〉according to the negative control sequence of pre-miR-15a precursor-gene sequential design
<400>5
agcttttcca?aaaattctcc?gaacgtgtca?cgttctcttg?aaacgtgaca?cgttcggaga 60
agggttctcc?gaacgtgtca?cgt 83
<210>6
<211>62
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(62)
＜223〉the acquisition fragment 1 of pre-miR-15a precursor-gene
<400>6
cgggtaccgg?tccttggagt?aaagtagcag?cacataatgg?tttgtggatt?ttgaaaaggt 60
gc 62
<210>7
<211>59
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(59)
＜223〉the acquisition fragment 2 of pre-miR-15a precursor-gene
<400>7
ccggaattcc?ttgtattttt?gaggcagcac?aatatggcct?gcaccttttc?aaaatccac 59
<210>8
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(24)
＜223〉the used positive colony of construction of recombinant plasmid process that comprises pre-miR-15a precursor-gene sequence is identified primer
1
<400>8
cctatttccc?atgattcctt?cata 24
<210>9
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(20)
＜223〉the used positive colony of construction of recombinant plasmid process that comprises pre-miR-15a precursor-gene sequence is identified primer
2
<400>9
gtaatacggt?tatccacgcg 20
<210>10
<211>19
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(19)
＜223〉Bcl gene test primer 1
<400>10
gtggccttct?ttgagttcg 19
<210>11
<211>19
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(19)
＜223〉Bcl gene test primer 2
<400>11
cttcagagac?agccaggag 19
<210>12
<211>22
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(22)
＜223〉β-actin primer 1
<400>12
tgtatgcctc?tggtcgtacc?ac 22
<210>13
<211>22
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(22)
＜223〉β-actin primer 2
<400>13
acagagtact?tgcgctcagg?ag 22
Claims (10)
1, Microrna treats and/or prevents application in the lymphoid tumor medicament in preparation, it is characterized in that: the active component of described medicine comprises precursor or the two or more mixture in them of precursor, the Microrna-16-1 of Microrna-15a, Microrna-16-1, Microrna-15a.
2, treat and/or prevent application in the lymphoid tumor medicament according to the described Microrna of claim 1 in preparation, it is characterized in that: described Microrna or its precursor are through known improvement sex modification.
3, treat and/or prevent application in the lymphoid tumor medicament according to the described Microrna of claim 2 in preparation, it is characterized in that: described Microrna or its precursor are strand or the double chain form that is made of the complementary strand of this strand and this strand.
4, a kind ofly treat and/or prevent lymphadenomatous pharmaceutical composition, it is characterized in that: comprise Microrna and pharmaceutically acceptable diluent, carrier or the adjuvant of effective dose, described Microrna is precursor or the two or more mixture in them of precursor, the Microrna-16-1 of Microrna-15a, Microrna-16-1, Microrna-15a.
5, treat and/or prevent lymphadenomatous pharmaceutical composition according to claim 4 is described, it is characterized in that: the active component of described medicine also comprise can the induced tumor apoptosis chemotherapeutics.
6, treat and/or prevent lymphadenomatous pharmaceutical composition according to claim 5 is described, it is characterized in that: described chemotherapeutics is cytosine arabinoside, vincristine, amycin, daunorubicin, methotrexate, arsenic trioxide or two or more mixture in them.
7, according to each describedly treats and/or prevents lymphadenomatous pharmaceutical composition in the claim 6, it is characterized in that: described Microrna or its precursor are through known improvement sex modification.
8, according to each describedly treats and/or prevents lymphadenomatous pharmaceutical composition among the claim 4-7, it is characterized in that: described Microrna or its precursor obtain by chemosynthesis; Perhaps obtain by making up carrier for expression of eukaryon.
9, describedly according to Claim 8 treat and/or prevent lymphadenomatous pharmaceutical composition, it is characterized in that: described carrier for expression of eukaryon is plasmid vector or viral vector.
10, according to each describedly treats and/or prevents lymphadenomatous pharmaceutical composition among the claim 4-7, it is characterized in that: described lymphoma is the Burkitt lymphoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100404748A CN101590243A (en) | 2009-06-23 | 2009-06-23 | Microrna treats and/or prevents application in the lymphoid tumor medicament in preparation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100404748A CN101590243A (en) | 2009-06-23 | 2009-06-23 | Microrna treats and/or prevents application in the lymphoid tumor medicament in preparation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101590243A true CN101590243A (en) | 2009-12-02 |
Family
ID=41405243
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2009100404748A Pending CN101590243A (en) | 2009-06-23 | 2009-06-23 | Microrna treats and/or prevents application in the lymphoid tumor medicament in preparation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101590243A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107115352A (en) * | 2011-08-04 | 2017-09-01 | 耶达研究及发展有限公司 | MicroRNA and the composition comprising microRNA |
| CN111601890A (en) * | 2017-12-14 | 2020-08-28 | 联合细胞Ev股份公司 | Pharmaceutical vector comprising miRNA for treating renal cancer |
| US10975373B2 (en) | 2014-02-05 | 2021-04-13 | Yeda Research And Development Co. Ltd. | Micro-RNAS and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone-associated medical conditions |
| CN111601890B (en) * | 2017-12-14 | 2024-04-19 | 联合细胞Ev股份公司 | Pharmaceutical carrier comprising miRNA for treating renal cancer |
-
2009
- 2009-06-23 CN CNA2009100404748A patent/CN101590243A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107115352A (en) * | 2011-08-04 | 2017-09-01 | 耶达研究及发展有限公司 | MicroRNA and the composition comprising microRNA |
| CN107115352B (en) * | 2011-08-04 | 2020-10-30 | 耶达研究及发展有限公司 | micro-RNAs and compositions comprising micro-RNAs |
| US10975373B2 (en) | 2014-02-05 | 2021-04-13 | Yeda Research And Development Co. Ltd. | Micro-RNAS and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone-associated medical conditions |
| US11680263B2 (en) | 2014-02-05 | 2023-06-20 | Yeda Research And Development Co. Ltd. | Micro-RNAS and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions |
| CN111601890A (en) * | 2017-12-14 | 2020-08-28 | 联合细胞Ev股份公司 | Pharmaceutical vector comprising miRNA for treating renal cancer |
| CN111601890B (en) * | 2017-12-14 | 2024-04-19 | 联合细胞Ev股份公司 | Pharmaceutical carrier comprising miRNA for treating renal cancer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108179194A (en) | A kind of tumor cells marker circBIRC6 and its inhibitor and purposes | |
| WO2019093308A1 (en) | Therapeutic pharmaceutical composition for cancer including mirna | |
| CN109288855B (en) | Application of reagent in preparation of medicine, interference fragment, method for inhibiting self-renewal of liver cancer tumor stem cells and medicine for treating liver cancer | |
| CN101590243A (en) | Microrna treats and/or prevents application in the lymphoid tumor medicament in preparation | |
| WO2009143371A2 (en) | COMPOSITIONS COMPRISING mTOR SIRNA AND METHODS OF USE THEREOF | |
| CN104774966B (en) | Adenocarcinoma of lung miRNA labels | |
| CN101457224A (en) | MiR-21 antisense digonucleotides and use thereof | |
| US20110190375A1 (en) | Compositions comprising cmyc sirna and methods of use thereof | |
| CN109825504A (en) | It is a kind of inhibit circ_0001016 expression siRNA and its application | |
| CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
| CN102031256A (en) | Human miR-485-5p antisense nucleic acid and application thereof | |
| CN108642176B (en) | Application of PART1 as breast cancer diagnosis, treatment and prognosis marker | |
| CN109876144B (en) | Purposes of the EMC8 gene inhibitor in preparation treatment gastric cancer medicament | |
| CN109224076B (en) | Gene miR-140-3P related to lung cancer diagnosis and treatment, and mimics and application thereof | |
| WO2009143372A2 (en) | Compositions comprising a-raf, b-raf, and c-raf sirna and methods of use thereof | |
| CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
| CN103421884B (en) | The purposes and its related drugs of people's FZR1 genes | |
| WO2009143281A2 (en) | Compositions comprising c-met sirna and methods of use thereof | |
| CN102080083A (en) | Human miR-149 antisense nucleotide and application thereof | |
| CN109694868A (en) | It is a kind of inhibit sFRP1 gene expression siRNA and its application | |
| CN109097399A (en) | The expression vector of long-chain non-coding RNA H19, the cell strain for expressing H19 and its application | |
| CN110042101B (en) | siRNA for reducing ROGDI gene expression, recombinant vector and application thereof | |
| CN112375823B (en) | Application of miRNA inhibitor in preparation of medicine for treating and/or preventing lymphoma | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN110055249B (en) | siRNA for reducing expression of THEM6 gene, recombinant vector and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20091202 |