CN111575305A

CN111575305A - Allene oxide synthetase, coding gene CsAOS and application thereof

Info

Publication number: CN111575305A
Application number: CN202010407410.3A
Authority: CN
Inventors: 赵剑; 张高阳; 崔单单; 赵丹丹
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2020-05-14
Filing date: 2020-05-14
Publication date: 2020-08-25
Anticipated expiration: 2040-05-14
Also published as: CN111575305B

Abstract

The invention belongs to the technical field of tea processing, and particularly relates to allene oxide synthetase, an encoding gene CsAOS and application thereof. Wherein the nucleotide sequence of the allene oxide synthetase gene CsAOS is shown in SEQ ID NO. 1; the amino acid sequence of the protein coded by the allene oxide synthase gene CsAOS is shown in SEQ ID NO. 2. The invention provides an allene oxide synthetase gene CsAOS which is derived from tea and related to tea aroma, and the allene oxide synthetase gene CsAOS has obvious expression difference in different adaptive black tea and green tea varieties. The invention discovers and proves that the content of volatile substances and jasmonic acid substances in tea can be obviously influenced by the expression of CsAOS through in vitro transient expression and in vitro oligonucleotide antisense inhibition experiments, and provides a new technical means for processing tea and cultivating excellent tea varieties.

Description

Allene oxide synthetase, coding gene CsAOS and application thereof

Technical Field

The invention belongs to the technical field of tea processing, and particularly relates to allene oxide synthetase, an encoding gene CsAOS and application thereof.

Background

The black tea is a fully fermented tea, is prepared by using proper tea tree new bud leaves as raw materials through a series of processes of withering, rolling (cutting), fermentation, drying and the like, is a main tea selling class in the international tea market, and is popular with consumers. The polyphenol substances of the tea leaves are subjected to a series of reactions such as oxidation reduction and the like in the fermentation process of the black tea, so that the color of the tea leaves is changed from green to red, and the basic characteristics and the fragrance of the 'red leaf and red soup' are formed, and the black tea has unique taste.

The tea aroma refers to the peculiar smell of tea which is sensed by people because different concentrations and proportions of odor substances influence olfactory nerves. Tea aroma is one of factors playing an important role in tea quality, a plurality of factors influencing tea aroma are provided, such as tea varieties, cultivation conditions, natural environment, processing technology, storage method and the like, and the volatile components in the tea are detected to be hundreds of types and mainly comprise aroma compounds such as aldehydes, ketones, alcohols, esters and the like. The components are combined in different proportions to form tea leaves with different flavors and types. The aroma component substances in the tea leaves are various, but the content of the aroma component substances is very little, the fresh tea leaves account for 0.001-0.05% (dry substances), and the black tea leaves account for 0.01-0.03% (dry substances).

The current research shows that the aroma substances in black tea mainly come from 3 aspects, including terpene compounds such as geraniol, compounds generated by the degradation of carotenoid such as ionone and the like, and oxidized lipid (Oxylipins) compounds generated by the lipid peroxidation of tea cell membranes. In the green leaves of most plants, Monogalactosyldiacylglycerol (MGDG) and digalactosyldiacylglycerol (DGDG) account for more than 80% of the membrane lipid of the green leaves. During tea processing, the two chloroplast membrane lipids are decomposed under the action of activated phosphatase A1(PLA1) to produce alpha-Linolenic acid (18: 3), which is catalyzed by Lipoxygenase (LOX) to produce 13S-hydroperoxyl Linolenic acid (13-HPOT). 13-HPOT can produce different breakdown products under different physiological conditions or environmental stresses. On one hand, the 13-HPOT is catalyzed and decomposed into C6-C9 volatile substances by lipid hydroperoxide lyase (HPL), wherein the volatile substances comprise 3-hexenal, hexanal and the like with grass fragrance; on the other hand, 13-HPOT is converted into Oxidized Plant Dienoic Acid (OPDA) under the catalysis of Allene Oxide Synthase (AOS) and Allene Oxido Cyclase (AOC) in sequence, the OPDA produced in chloroplasts is transported by transporters into peroxisomes, and Jasmonic Acid (JA) is finally produced via the oxidation of plant dienoic acid reductase (opdaredoctane) and 3 times of β -oxidation. JA is then methylated by JAMT to produce methyl jasmonate. (FIG. 1: synthetic route of jasmonates).

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides allene oxide synthetase, a coding gene CsAOS and application thereof, and aims to solve part of problems in the prior art or at least alleviate part of problems in the prior art.

The allene oxide synthetase gene CsAOS has the nucleotide sequence shown in SEQ ID No.1 or the DNA sequence which is hybridized with the DNA sequence limited by SEQ ID No.1 and codes the protein with the same function; or DNA molecule which has more than 90% of homology with the DNA sequence limited by SEQ ID NO.1 and codes the same functional protein.

The invention also discloses an allene oxide synthetase, the amino acid sequence is shown in SEQ ID NO.2, or the sequence shown in SEQ ID NO.2 is subjected to substitution and/or deletion and/or addition of a plurality of amino acid residues, and the allene oxide synthetase has the amino acid sequence with the same protein function; or derived from the amino acid sequence shown in SEQ ID NO.2, has more than 98 percent of homology and has the same protein function.

The invention also discloses application of the allene oxide synthetase gene CsAOS in preparation and/or serving as lipoxygenase.

The invention also discloses application of the allene oxide synthetase gene CsAOS in adjusting the content of volatile substances in tea.

Further, the volatile substances in the tea leaves are at least one of heptanal, hexanal, 2-hexenal, 2, 4-hexadienal, 2, 4-heptadienal, 2-hexen-1-ol acetate, 2-ethylhexanol, benzyl alcohol, linalool, phenethyl alcohol, nonenal, nonanol, geraniol, 3-hexenyl ester hexanoic acid, 3-hexenyl ester or hexyl ester hexanoate.

The invention also discloses application of the allene oxide synthetase gene CsAOS in adjusting the content of jasmonic acid substances and/or salicylic acid in tea.

Further, the jasmonate substance is at least one of jasmonic acid, jasmonic amino acid and methyl jasmonate.

The invention also discloses application of the allene oxide synthetase gene CsAOS in adjusting the content of jasmonic acid precursor OPDA in tea.

The invention also discloses application of the allene oxide synthase gene CsAOS in screening tea varieties suitable for making green tea and/or tea varieties suitable for making black tea or black tea as a marker.

The invention also discloses application of the allene oxide synthase gene CsAOS in tea tree breeding.

The invention also discloses a method for promoting the expression of the allene oxide synthetase gene CsAOS in the tea, which comprises at least one treatment mode of withering, rolling and fermentation treatment steps of the tea.

In summary, the advantages and positive effects of the invention are:

the invention provides an allene oxide synthetase gene CsAOS derived from tea leaves and related to tea leaf aroma, and a protein coded by the allene oxide synthetase gene CsAOS has the function of an allene oxide synthetase.

According to the invention, the expression difference of the allene oxide synthase gene CsAOS in the black tea processing process is detected, so that the expression of the gene is promoted by the withering, rolling and fermentation in the black tea processing process, and the gene is shown to participate in the black tea making process.

The invention discovers and proves that the content of volatile substances and jasmonic acid substances in tea can be obviously influenced by the expression of CsAOS through in vitro transient expression and in vitro oligonucleotide antisense inhibition experiments, and provides a new technical means for processing tea and cultivating excellent tea varieties.

Drawings

FIG. 1 is a synthetic pathway for jasmonates;

FIG. 2 shows the expression difference of allene oxide synthase gene CsAOS in different tissues of Shuchazao according to an embodiment of the present invention; wherein, L1 is a leaf; l2 two blades; l3, trefoil; FL is flower; FR is fruit; s, stem; r is root; b, bud;

FIG. 3 shows the difference in expression of allene oxide synthase gene CsAOS during black tea processing according to an example of the present invention;

FIG. 4 is the expression of CsAOS in different adapted tea varieties according to an embodiment of the present invention;

FIG. 5 shows the expression level of allene oxide synthase gene CsAOS in an in vitro oligonucleotide antisense suppression experiment according to an embodiment of the present invention;

FIG. 6 shows the results of jasmonates assay 3d after oligonucleotide antisense suppression experiment in vitro according to an embodiment of the invention;

FIG. 7 shows the determination of volatile substances after 3d of antisense inhibition experiment of oligonucleotides in vitro according to an embodiment of the present invention;

FIG. 8 shows the expression level of the allene oxide synthase gene CsAOS transiently expressed in vitro according to the embodiment of the present invention;

FIG. 9 shows the results of jasmonates assay after 3d in vitro transient expression according to an embodiment of the invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

The invention discloses an allene oxide synthase gene CsAOS, and a coding protein and application thereof, which are shown in the following embodiments. The nucleotide sequence of the allene oxide synthetase gene CsAOS is shown as SEQ ID NO.1 in a sequence table, and the amino acid sequence is shown as SEQ ID NO.2 in the sequence table.

The materials involved in the invention:

1. tea tree samples: the Shucha early tea tree is planted in the agricultural industrial park of Yihui agricultural university of Yihui, Luyang area of Anhui province, and the leaf picking condition is 25-28 ℃.

The preparation process of the black tea mainly comprises the steps of picking, withering, rolling, fermenting and drying. The method specifically comprises the following steps: picking one bud and one leaf of Shucha early plant (in this case, a fresh leaf sample); spreading at room temperature for about 16h (withering sample after completion); firstly, lightly kneading tea leaves into a spherical shape, then heavily kneading and lightly kneading (a kneading sample is obtained after the completion); wrapping the tea leaves with gauze, fermenting at 30 deg.C for 12h (fermentation sample after completion), dispersing every 2h during fermentation period, and continuing fermentation; drying at 110 ℃ for about 15min (drying samples after completion).

Tobacco sample: the Nicotiana benthamiana (Nicotiana benthamiana) is grown in a light culture chamber at a temperature of 22-25 ℃.

2. Coli: DH5 α.

3. Carrier: pGEM-T Easy.

4. LB culture medium: weighing 10g of NaCl, 5g of yeast extract and 10g of tryptone, adding 950mL of ultrapure water, stirring and dissolving, adding water to a constant volume of 1000mL, and sterilizing for 15min by high-pressure steam to obtain an LB liquid culture medium, wherein the LB solid culture medium is obtained by adding 15g of agar powder into the LB liquid culture medium.

5. Ampicillin mother liquor (Amp +, 50 mg/ml): 0.5g ampicillin Amp was weighed, dissolved in 10mL sterile water, filtered, sterilized, and dispensed into vials for storage at-20 ℃.

6. In vitro oligonucleotide antisense inhibition buffer: centrifuging nucleotide powder (8000rpm,5min), adding 2ml of 50mMol/L sucrose solution into each tube, shaking on a vortex apparatus for several minutes, observing whether the powder is completely dissolved, stopping shaking if no particulate matter is found, obtaining in-vitro oligonucleotide antisense inhibition buffer solution (hereinafter referred to as buffer solution), transferring 250ul of buffer solution by using a liquid transfer gun, and subpackaging in a 96-well plate for later use.

Example 1 expression differences of allene oxide synthase Gene CsAOS in different tissues of Shuchazao, different tea plant varieties and during Black tea processing

1. Expression difference of allene oxide synthetase gene CsAOS in different tissues of Shuchazao

Respectively picking the roots, stems, flowers, fruits, buds, one leaf, two leaves and three leaves of Shucha early plants, and detecting the expression quantity of an allene oxide synthase gene CsAOS in each sample by adopting a high-throughput sequencing method.

2. Expression difference of allene oxide synthetase gene CsAOS in black tea processing process

Samples of black tea during picking, withering, rolling, fermentation and drying periods are respectively taken, cDNA is obtained according to the method in example 3, and fluorescent quantitative PCR detection is carried out, wherein the method comprises the following steps, and high-throughput sequencing is adopted for verification.

A forward primer: ACCTCCTTCTAAACCCACCAATC

Reverse primer: ACCAGGTGGCATGTTGGCTCTG

3. Expression differences of CsAOS of different adaptive tea tree varieties

Collecting three leaves of different tea tree varieties with adaptability, and detecting the expression quantity of allene oxide synthetase gene CsAOS in each sample by a high-throughput sequencing method.

Test results and analysis:

in FIG. 2, the expression difference of the allene oxide synthase gene CsAOS in different tissues of Shuchazao, which is higher in leaves and flowers, is shown, indicating that it has corresponding functions in these tissues.

In fig. 3, it can be seen that the expression difference of allene oxide synthase gene CsAOS during black tea processing, transcriptome data and quantitative PCR data indicate that the expression level of the gene is gradually increased from withering to fermentation, which indicates that the withering, rolling and fermentation of black tea processing promote the expression of the gene, and that the gene is involved in the black tea manufacturing process.

FIG. 4 is the expression of CsAOS in different adapted tea varieties according to an embodiment of the invention. As a result, it was found that CsAOS is expressed in a significantly higher amount in most of the varieties of tea suitable for making black tea and black tea than in the varieties of tea suitable for making green tea. Therefore, the expression level of the CsAOS gene can be used as a parameter for judging the tea plant variety to be suitable for preparing green tea and black tea.

Example 2 in vitro oligonucleotide antisense inhibition experiments

1. Designing and synthesizing oligonucleotide antisense primer according to AOS predicted sequence, and designing on websitehttp:// sfold.wadsworth.org/cgi-bin/soligo.plThe above was accomplished by the following primer sequences:

asODN001041-1 CTGTTGAGTGGTATTTTTCG

asODN001041-2 GTTGGGAGTGGAGTTTGGCT

asODN001041-3 GGGGTCCAGATAGGAGAGGA

asODN001041-4 GTATTGTGATGGCACGGGCG

2. dissolving with 80mM sucrose solution to obtain inhibition buffer solution, wherein the blank is sucrose solution;

3. a pair of bud and two leaves with basically consistent size, bright color, healthy color and no insect and disease are cut by scissors and inserted into a 96-well plate filled with buffer solution, and the tail of the bud and two leaves is ensured to be immersed into the buffer solution.

4. And putting the 96-well plate into a light incubator, and performing light culture according to the light intensity of 16 h/dark 8h, wherein the temperature of the incubator is 28 ℃.

5. And taking a treated 3d primer treatment sample and a blank sample.

Test results and analysis:

in fig. 5, it can be seen that the expression level of allene oxide synthase gene CsAOS in the antisense inhibition experiment of oligonucleotide in vitro is significantly inhibited compared with the control, and the inhibition rate is close to 2/3.

In FIG. 6, it can be seen that the jasmonic acid substances are measured after 3 days of antisense inhibition by the oligonucleotide in vitro, and it can be seen that the inhibition of CsAOS expression can significantly reduce the contents of jasmonic acid precursor OPDA and jasmonic acid substances JA, JA-Ile, etc. JA was reduced by more than 50% compared to control; and simultaneously, the content of the salicylic acid SA can be reduced.

In FIG. 7, the results of the volatiles measurements after 3 days of the in vitro oligonucleotide antisense inhibition experiments can be seen, which indicated that the in vitro inhibition of CsAOS was increased by about 18-fold and about 8-fold for heptanal, hexanal, 2-hexenal, 2, 4-hexadienal, 2-hexen-1-ol acetate, 2-ethylhexanol, benzyl alcohol, linalool, phenethyl alcohol, nonenal, nonanol, geraniol, 3-hexenyl ester hexanoic acid, 3-hexenyl ester, hexanoic acid-hexyl ester, especially hexanal, 2-hexenal, compared to the control.

Example 3 cloning and in vitro transient expression of the allene oxide synthase CsAOS Gene

1. Designing a specific primer, wherein a drawn part is a restriction enzyme cutting site, and the primer sequence is shown as SEQ ID NO.3 and SEQ ID NO. 4:

SEQ ID NO.3:TGGATCCATGGCTTTTACTTCTCTAGC BamH1

SEQ ID NO.4:CAAGCTTTCAAAAACTAGCTCTCTTGACG Hind3

2. extracting total RNA of the tea tree sample according to the instructions of the plant total RNA extraction kit and the first-strand cDNA synthesis kit, and performing reverse transcription to obtain cDNA.

3. And (3) taking the reverse transcription cDNA as a template, and amplifying by using the specific primer, wherein a PCR system comprises: 2. mu.l of forward primer, 2. mu.l of reverse primer, 2. mu.l of template, MIX 25. mu.l, ddH₂O19 microliters; PCR procedure: the first step is as follows: the temperature is maintained at 94 ℃ for 5 min. The amplification procedure is pre-denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 30s, extension at 68 ℃ for 1min, 35 cycles, and extension at 68 ℃ for 5min, and the obtained PCR product is stored at 4 ℃.

4. The PCR product was purified using a PCR purification kit and ligated into pGEM-T Easy followed by transformation of DH 5. alpha. for colony PCR, running gel and sequencing verification as follows. Obtaining positive colonies, obtaining a T vector (CsAOS-pGEM) containing the CsAOS gene, and obtaining the DH5 alpha escherichia coli containing the allene oxide synthetase gene CsAOS sequence.

Connection conditions are as follows: ligation was performed overnight at 4 ℃.

Transformation system:

adding the obtained ligation product into 50 mu L DH5 alpha, gently mixing uniformly, placing in ice, and carrying out ice bath for 30 min; thermally shocking at 42 deg.C in water bath for 45sec, immediately placing in ice, and ice-cooling for 3 min; adding 1mL of fresh LB culture medium, and carrying out shaking culture at 37 ℃ and 200rpm for 1 h; the cultured bacteria liquid is centrifuged, 300 mu L of supernatant is reserved, and the supernatant is re-suspended and mixed evenly, plated and cultured overnight at 37 ℃.

5. Designing a specific primer, wherein the primer sequence is shown as follows:

F:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCTTTTACTTCTCTAGC

R:GGGGACCACTTTGTACAAGAAAGCTGGGTTCAAAAACTAGCTCTCTTGACG

6. and (3) using the CsAOS-pGEM obtained in the step (4) as a template, using the primer obtained in the step (5) for amplification, and sequentially carrying out PCR verification, gel running verification and sequencing verification by using a homologous recombination method (Gateway technology) to construct the CsAOS-PB2GW 7. The fusion vector has a strong 35S promoter, and CsAOS-PB2GW7 is transferred into agrobacterium GV3101 by a freezing transformation method.

Transient expression of target genes

1. The recombinant strain CsAOS-PB2GW7 GV3101 and the control GV3101 obtained in the examples were selected and inoculated into 5ml of LB liquid medium (100ug/ml gentamicin, 50ug/ml spectinomycin), and shake-cultured at 28 ℃.

2.1 ml of overnight cultured Agrobacterium was transferred to 25ml of LB liquid medium (with the same antibiotic as1 added, additionally autoclaved acetosyringone added).

3. The OD600 value of the overnight culture broth was measured.

4.5000g, 15min for collection, and the cells were resuspended in a resuspension solution (10mM MgCl2,10mM 2- (N-morpholino) ethanesulfonic acid (pH5.6), 100uM acetosyringone) to give a final OD600 of 0.4.

5. Standing at room temperature for 2-3 hr, and injecting tobacco.

6. The infesting solution was filled into a 5ml syringe and the liquid was injected into tobacco leaves from the lower skin of the leaf (no cotyledons were used) by pressing the syringe back plate with the thumb. After injection, tobacco leaves are wet.

7. 3 days after injection, the injection leaves were removed for volatile and jasmonic analysis.

Test results and analysis:

in FIG. 8, the expression level of the allene oxide synthase gene CsAOS transiently expressed in vitro can be seen, and the results show that the expression level of CsAOS in transiently expressed tobacco is increased by 9 times.

FIG. 9 shows the results of jasmonates assay after 3d in vitro transient expression according to an embodiment of the invention. The results show that the content of jasmonates is obviously increased after transient expression, such as the content of JA and MeJA is increased by about 20 percent and 29 percent respectively.

Detection method related to the present invention

Volatile determination of in vitro oligonucleotide antisense inhibition samples:

1. determination of volatile matter is performed by using a headspace solid-phase microextraction (HS-SPME) method combined with gas-phase mass spectrometry (GC-MS) (Agilent 7890A), extracting volatile matters of in-vitro oligonucleotide antisense inhibition samples and blank samples by using an extraction head containing 50/30um DVB/CAR/PDMS (Supelco), extracting at 60 ℃ for 1h, then taking out the extraction head, inserting the extraction head into a GC-MS sample inlet, desorbing for 5min, and starting an instrument to collect data.

2. GC-MS detection conditions

Chromatographic conditions are as follows: the temperature of a sample inlet is 240 ℃, the carrier gas is high-purity nitrogen, the purity is more than 99.99 percent, the flow rate is 0.8ml/min, and split-flow sample injection is not carried out; the chromatographic column model is HP-5MS quartz capillary column (60m × 0.32mm × 0.25 um); the column temperature is initially 40 deg.C, held for 3min, ramped to 90 deg.C at 2 deg.C/min, held for 5min, ramped to 160 deg.C at 3 deg.C/min, ramped to 250 deg.C at 10 deg.C/min, and held for 5 min.

Mass spectrum conditions: the ion source is an EI source, the temperature of the ion source is 230 ℃, the electron energy is 70eV, the temperature of a quadrupole rod is 150 ℃, the interface temperature is 280 ℃, the voltage of an electron multiplier is 1680V, and the scanning range m/z is 35-350 amu.

Determination of jasmonates:

the samples were ground to a powder in liquid nitrogen and extracted in the dark as follows.

Preparing an extraction buffer solution formula, wherein methanol: ddH₂Acetic acid 80:19:1(V: V). Weighing about 0.1g of sample into a 2ml centrifuge tube, adding 750 μ l of the extract, mixing by inversion, and placing on ice, wherein the process is carried out under the condition of keeping out the light. Then carrying out rotary extraction for more than 16h at 4 ℃ under the condition of keeping out of the light. Centrifuging at 13000rpm for 10min at 4 deg.C, sucking supernatant, adding 750 μ l of extractive solution again, extracting at 4 deg.C in dark for more than 16h, centrifuging, and mixing the two supernatants. Filtering with 0.22um filter membrane (organic filter membrane), blowing with nitrogen gas, adding 200 μ l methanol, reversing for several times, and dissolving at 4 deg.C for 3-6 h. (this process was carried out under exclusion of light). After the lysate was centrifuged at 13000rpm for 15min at 4 ℃, 180. mu.l of the supernatant was gently aspirated into the inner cannula, and placed in a sample bottle dedicated to mass spectrometry for waiting for detection by the machine.

The hormone samples were analyzed by LC-MS, the liquid chromatograph is Shimadzu LC-20AD type, and the quantitative analysis was performed by external standard method.

The detection method comprises the following steps:

the liquid chromatography adopts a binary solvent system, and the mobile phase: the solution A was methanol, the solution B was 0.05% aqueous formic acid, and an Eclipse plus C18(5 μm,2.1 × 150mm) column was selected, the flow rate was controlled at 300uL/min, the column temperature was 30 ℃ and 10 μ L was injected per sample. Gradient elution was used with a gradient of 10% methanol starting and held for 2min, increasing gradually to 90% for 5min at 10 min. At 15.1min, methanol dropped to the initial gradient and was held for 7 min.

TABLE 1 liquid phase elution conditions for phytohormones

The mass spectrum conditions are as follows: the ion source is an electrospray ion source (ESI), the voltage of the ion source is-4.5 KV, the temperature of the ion source is 500 ℃, N2 is used as auxiliary heating gas2(50psi), atomizing gas1(60psi) and air curtain gas (30psi), and the object to be detected is in a negative ion mode. The standard mixture was separated in reverse phase liquid chromatography and quantitatively analyzed in tandem triple quadrupole mass spectrometry multiple reaction detection (MRM) mode with a scan time of 50 ms.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> agriculture university of Anhui

<120> allene oxide synthetase, coding gene CsAOS and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>1572

<212>DNA

<213> nucleotide sequence (CsAOS)

<400>1

atggctttta cttctctagc tttgccttcc ctgcaactac aattcttgac acaacggcct 60

ccaaaagtat catcaaaacc atactcaatt caccacccaa tctatgcttc cgtatccgaa 120

agaccatctg cgccacctcc tccggcgacg ccgaaaatga aacctccttc taaacccacc 180

aatcttccca ttcagaaaat cccaggaaac tatggccctc ccttaattgg tcccatcaaa 240

gacagactcg actacttcta caaccaaggc acagtcgaat tcttcaagtc tcgaagcgaa 300

aaataccact caacagtttt cagagccaac atgccacctg gtcccttcat ttcctccaac 360

cccaacgtgg tcgttcttct ggacggcaag agcttcccag tcctcttcga cgtcacaaaa 420

gtcgaaaaga aagacctctt cacagggact ttcatgccct ccaccgaact caccggtggt 480

taccgagtcc tctcctatct ggacccctcg gagcctaagc atgccaagct caagcaactc 540

atgttctttc tactcaaatc agggcgagac aaagtgatac cagagttcca ctcgagcttc 600

acagacctct tcgagaccct tgaagccgaa ctggcaagca aaggcaaagc agcatttagc 660

gatgccaatg accaggcttc tttcaatttc ttagctcggt cactcttcgg gaccaaccca 720

gccgatacca aactcggact cgacggaccc aatttgatag ccatatggat atttttccaa 780

ctggctcctt tgataaccct tggcctccca aagttggtgg aagagctact catccacact 840

tttcctctcc ctccagtact catcaaaaaa gactaccaaa gattgtacga ttttttctac 900

aactcgtcaa catccatcct cgacgaagcc gagaaaattg gcctctcccg cgaagaggct 960

tgccacaatc tcttattcgc cacgtgcttc aattccttcg gcggaatgaa aatctttttc 1020

cccagcatga tcaaatggat cggccatgct ggagccaaac tccactccca actcgccgag 1080

gagatccgat cagccgtcag atccagcggc gggaaagtga cgatggccgg gatggaacag 1140

atgccgttga tgaagtccgt agtgtacgaa tcgctgagga tcgacccgcc cgtgccatca 1200

caatacggtc gagcgaaacg ggacatggtg atagagtctc atgacgcagc gtttgaggtg 1260

aaagaagggg aaatgttatt tgggtaccaa ccatttgcga ctaaagatcc gaagatattc 1320

gagaggccgg aggagtttgt ggcggaccgg ttcgtcggag aggagggaga gaagatgttg 1380

aggcacgttc tgtggtcgaa tggaccggag accgagagca cgacggtggg aaacaagcaa 1440

tgcgcgggga aggacttcgt ggtgatggtg tcgaggttgt tgctggtgga gttgtttcta 1500

cgttatgatt cgtttgagac ggaggttggt tcttcagtta ctataacgtc cgtcaagaga 1560

gctagttttt ga 1572

<210>2

<211>523

<212>PRT

<213> amino acid sequence (CsAOS)

<400>2

Met Ala Phe Thr Ser Leu Ala Leu Pro Ser Leu Gln Leu Gln Phe Leu

1 5 10 15

Thr Gln Arg Pro Pro Lys Val Ser Ser Lys Pro Tyr Ser Ile His His

20 25 30

Pro Ile Tyr Ala Ser Val Ser Glu Arg Pro Ser Ala Pro Pro Pro Pro

35 40 45

Ala Thr Pro Lys Met Lys Pro Pro Ser Lys Pro Thr Asn Leu Pro Ile

50 55 60

Gln Lys Ile Pro Gly Asn Tyr Gly Pro Pro Leu Ile Gly Pro Ile Lys

65 70 75 80

Asp Arg Leu Asp Tyr Phe Tyr Asn Gln Gly Thr Val Glu Phe Phe Lys

85 90 95

Ser Arg Ser Glu Lys Tyr His Ser Thr Val Phe Arg Ala Asn Met Pro

100 105 110

Pro Gly Pro Phe Ile Ser Ser Asn Pro Asn Val Val Val Leu Leu Asp

115 120 125

Gly Lys Ser Phe Pro Val Leu Phe Asp Val Thr Lys Val Glu Lys Lys

130 135 140

Asp Leu Phe Thr Gly Thr Phe Met Pro Ser Thr Glu Leu Thr Gly Gly

145 150 155 160

Tyr Arg Val Leu Ser Tyr Leu Asp Pro Ser Glu Pro Lys His Ala Lys

165 170 175

Leu Lys Gln Leu Met Phe Phe Leu Leu Lys Ser Gly Arg Asp Lys Val

180 185 190

Ile Pro Glu Phe His Ser Ser Phe Thr Asp Leu Phe Glu Thr Leu Glu

195 200 205

Ala Glu Leu Ala Ser Lys Gly Lys Ala Ala Phe Ser Asp Ala Asn Asp

210 215 220

Gln Ala Ser Phe Asn Phe Leu Ala Arg Ser Leu Phe Gly Thr Asn Pro

225 230 235 240

Ala Asp Thr Lys Leu Gly Leu Asp Gly Pro Asn Leu Ile Ala Ile Trp

245 250 255

Ile Phe Phe Gln Leu Ala Pro Leu Ile Thr Leu Gly Leu Pro Lys Leu

260 265 270

Val Glu Glu Leu Leu Ile His Thr Phe Pro Leu Pro Pro Val Leu Ile

275 280 285

Lys Lys Asp Tyr Gln Arg Leu Tyr Asp Phe Phe Tyr Asn Ser Ser Thr

290 295 300

Ser Ile Leu Asp Glu Ala Glu Lys Ile Gly Leu Ser Arg Glu Glu Ala

305 310 315 320

Cys His Asn Leu Leu Phe Ala Thr Cys Phe Asn Ser Phe Gly Gly Met

325 330 335

Lys Ile Phe Phe Pro Ser Met Ile Lys Trp Ile Gly His Ala Gly Ala

340 345 350

Lys Leu His Ser Gln Leu Ala Glu Glu Ile Arg Ser Ala Val Arg Ser

355 360 365

Ser Gly Gly Lys Val Thr Met Ala Gly Met Glu Gln Met Pro Leu Met

370 375 380

Lys Ser Val Val Tyr Glu Ser Leu Arg Ile Asp Pro Pro Val Pro Ser

385 390 395 400

Gln Tyr Gly Arg Ala Lys Arg Asp Met Val Ile Glu Ser His Asp Ala

405 410 415

Ala Phe Glu Val Lys Glu Gly Glu Met Leu Phe Gly Tyr Gln Pro Phe

420 425 430

Ala Thr Lys Asp Pro Lys Ile Phe Glu Arg Pro Glu Glu Phe Val Ala

435 440 445

Asp Arg Phe Val Gly Glu Glu Gly Glu Lys Met Leu Arg His Val Leu

450 455 460

Trp Ser Asn Gly Pro Glu Thr Glu Ser Thr Thr Val Gly Asn Lys Gln

465 470 475 480

Cys Ala Gly Lys Asp Phe Val Val Met Val Ser Arg Leu Leu Leu Val

485 490 495

Glu Leu Phe Leu Arg Tyr Asp Ser Phe Glu Thr Glu Val Gly Ser Ser

500 505 510

Val Thr Ile Thr Ser Val Lys Arg Ala Ser Phe

515 520

<210>3

<211>27

<212>DNA

<213> Artificial sequence (BamH1)

<400>3

tggatccatg gcttttactt ctctagc 27

<210>4

<211>29

<212>DNA

<213> Artificial sequence (Hind3)

<400>4

caagctttca aaaactagct ctcttgacg 29

Claims

1. An allene oxide synthetase gene CsAOS, the nucleotide sequence of which is shown in SEQ ID NO.1, or a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.1 and encodes the protein with the same function; or DNA molecule which has more than 90% of homology with the DNA sequence limited by SEQ ID NO.1 and codes the same functional protein.

2. An allene oxide synthetase has an amino acid sequence shown in SEQ ID NO.2, or an amino acid sequence which is obtained by substituting and/or deleting and/or adding a plurality of amino acid residues in the sequence shown in SEQ ID NO.2 and has the same protein function; or

Derived from the amino acid sequence shown in SEQ ID NO.2, has more than 98 percent of homology and has the same protein function.

3. Use of the allene oxide synthase gene CsAOS according to claim 1 for the preparation and/or use as an allene oxide synthase.

4. Use of the allene oxide synthase gene CsAOS according to claim 1 for the regulation of volatile substance content in tea.

5. Use according to claim 4, characterized in that: the volatile substances in the tea leaves are at least one of heptanal, hexanal, 2-hexenal, 2, 4-hexadienal, 2, 4-heptadienal, 2-hexen-1-ol acetate, 2-ethylhexanol, benzyl alcohol, linalool, phenethyl alcohol, nonenal, nonanol, geraniol, 3-hexenyl ester hexanoic acid, 3-hexenyl ester or hexanoic acid-hexyl ester.

6. The use of the allene oxide synthase gene CsAOS according to claim 1 for the regulation of jasmonates content and/or salicylic acid content in tea.

7. Use according to claim 6, characterized in that: the jasmonic acid substance is at least one of jasmonic acid, jasmonic acid amino acid and methyl jasmonate.

8. The use of the allene oxide synthase gene CsAOS according to claim 1 for adjusting the content of jasmonic acid precursor OPDA in tea.

9. Use of the allene oxide synthase gene CsAOS according to claim 1 as a marker for screening tea varieties suitable for making green tea and/or tea varieties suitable for making black tea or black tea.

10. A method for promoting the expression level of allene oxide synthase gene CsAOS in tea leaves is characterized in that: comprises at least one treatment mode of withering, rolling and fermenting treatment steps of the tea leaves.