CN110724696B - Lipid hydroperoxide lyase and gene and application thereof - Google Patents

Abstract

The invention discloses a lipid hydroperoxide lyase, a gene and an application thereof, wherein the gene has a nucleotide sequence shown as SEQ ID NO. 1; or has the nucleotide sequence shown as SEQ ID NO. 3. The lyase gene can regulate the content of volatile matters and jasmonic acid substances in plants, participates in the processing process of tea, is expressed to improve the generation of C6-C9 volatility with grass fragrance in the plants, and is inhibited to improve the content of jasmonic acid precursor substances and jasmonic acid substances.

Description

Lipid hydroperoxide lyase and gene and application thereof

Technical Field

The invention relates to a lyase gene, in particular to a lipid hydroperoxide lyase, a gene thereof and application thereof.

Background

The sensory evaluation of the black tea is mainly in aspects of color, fragrance, taste and the like, while the fragrance is one of important indexes of the sensory evaluation of the tea, has an important judgment guiding function for tea drinkers and consumers, and is often used as an index for dividing the quality of the black tea.

The black tea belongs to completely fermented tea, and in the fermentation process, under the enzymatic action, the tea polyphenol is oxidized to generate Theaflavin (TFs), Thearubigins (Thearubigins) and the like, so the black tea has the characteristics of black tea, red soup, red leaves and mellow sweet taste. The specific aroma substances of the black tea are obviously increased compared with fresh leaves, but the generation mechanism of the aroma components of the black tea is not completely clear.

At present, research shows that the aroma substances in black tea mainly come from 3 aspects, including terpene compounds, such as geraniol and compounds generated by the degradation of carotenoid (such as ionone), and oxidized lipid (Oxylipins) compounds generated by the lipid peroxidation of tea cell membranes. In the green leaves of most plants, Monogalactosyldiacylglycerol (MGDG) and digalactosyldiacylglycerol (DGDG) account for more than 80% of the membrane lipid of the green leaves, and the two chloroplast membrane lipids are decomposed under the action of activated phosphatase A1(PLA1) in the tea leaf processing process to generate alpha-Linolenic acid (alpha-Linolenic acid, 18: 3), which is catalyzed by Lipoxygenase (LOX) to generate 13S-hydroperoxy Linolenic acid (13-HPOT).

13-HPOT can produce different breakdown products under different physiological conditions or environmental stresses:

(1) the 13-HPOT is catalytically decomposed into volatile substances C6-C9 by lipid hydroperoxide lyase (HPL), wherein the volatile substances comprise 3-hexenal, hexanal and the like with grass fragrance, and are shown in figure 1 as common volatile substance structural formulas C6-C9 with grass fragrance;

(2)13-HPOT is converted into Oxidized Plant Dienoic Acid (OPDA) under the catalysis of Allene Oxidase (AOS) and Allene Oxidation Cyclase (AOC) in sequence, the OPDA generated in chloroplasts is transported to peroxisomes by transporters, Jasmonic Acid (JA) is finally generated through oxidized plant dienoic acid reductase (OPDARedditase) and 3 times of beta-oxidation, and then methylation reaction catalyzed by JAMT (jasmonic acid carboxyl methyltransferase) is carried out to generate methyl jasmonate, as shown in figure 2, the synthetic pathway of jasmonic acid and 3-hexenal.

Disclosure of Invention

The invention aims to provide a lipid hydroperoxide lyase, a gene and an application thereof, wherein the lyase gene can regulate and control the content of volatile matters and jasmonic acid substances in plants and participate in the processing process of tea.

In order to achieve the aim, the invention provides a lipid hydroperoxide lyase gene for regulating and controlling volatile matters and jasmonic acid substances, wherein the gene has a nucleotide sequence shown as SEQ ID NO. 1; or has the nucleotide sequence shown as SEQ ID NO. 3.

The invention also provides a lipid hydroperoxide lyase for regulating and controlling volatile matters and jasmonic acid substances, and the lyase is obtained by the gene coding.

Preferably, the lyase has an amino acid sequence shown as SEQ ID NO. 2; or has an amino acid sequence shown as SEQ ID NO. 4.

The invention also provides a PCR primer of the lipid hydroperoxide lyase gene, wherein in the primer, an upstream primer has a nucleotide sequence shown as SEQ ID NO.5, a downstream primer has a nucleotide sequence shown as SEQ ID NO.6, and the lipid hydroperoxide lyase gene amplified by the PCR has a nucleotide sequence shown as SEQ ID NO. 1; or the upstream primer has a nucleotide sequence shown as SEQ ID NO.7, the downstream primer has a nucleotide sequence shown as SEQ ID NO.8, and the lipid hydroperoxide lyase gene amplified by PCR has a nucleotide sequence shown as SEQ ID NO. 3.

The present invention also provides a primer of an antisense oligonucleotide, which comprises: has a nucleotide sequence shown as SEQ ID NO.11, has a nucleotide sequence shown as SEQ ID NO.12, has a nucleotide sequence shown as SEQ ID NO.13, and has a nucleotide sequence shown as SEQ ID NO. 14.

The invention also provides an application of the lipid hydroperoxide lyase gene for regulating and controlling the volatile matters and the jasmonic acid substances, and the lyase gene is used for regulating and controlling the content of the volatile matters and the jasmonic acid substances in plants.

Preferably, the plant comprises: and (5) tea tree breeding.

Preferably, the lyase gene is used for regulating the content of volatile matters in the tea processing process.

Preferably, the lyase gene expression is used for improving the volatile generation of grass fragrance C6-C9 in plants, and the suppression is used for improving the content of jasmonic acid precursor and jasmonic acid substances.

Preferably, the jasmonic acid precursor comprises: oxidized vegetable dienoic acid (OPDA), dioxo-oxidized vegetable dienoic acid (dnOPDA); the jasmonates include: jasmonic Acid (JA), jasmonic acid-isoleucine complex (JA-Ile), methyl jasmonate (MeJA); the volatile matter with grass fragrance C6-C9 comprises: 2-hexenal, hexanal, nonanal.

The lipid hydroperoxide lyase and the gene and the application thereof have the following advantages:

the lipid hydroperoxide lyase gene can regulate the content of volatile matters and jasmonic acid substances in plants, participates in the processing process of tea, has the function of lipid hydroperoxide lyase, is expressed to improve the generation of volatility of green grass fragrance C6-C9 in the plants, and is inhibited to improve the content of jasmonic acid precursor substances and jasmonic acid substances.

Drawings

FIG. 1 shows the structural formula of common volatile substances with grass fragrance C6-C9.

FIG. 2 is a synthesis pathway for jasmonic acid and 3-hexenal.

FIG. 3 is a bar graph of the expression levels of CsHPL1 and CsHPL3 in different tissues of the invention.

FIG. 4 is a bar graph showing the expression levels of CsHPL1 and CsHPL3 during processing of black tea of the present invention.

FIG. 5 is a graph showing the results of expression levels of the gene CsHPL1 in Experimental example 4 and CsHPL3 in Experimental example 3.

FIG. 6 shows the results of the experiment for the exoenzyme activity in Experimental example 3 of the present invention.

FIG. 7 shows the measurement results of volatiles after transient expression of CsHPL3 in tobacco in vitro in accordance with Experimental example 3 of the present invention.

FIG. 8 shows the results of volatile determination after antisense inhibition experiment of oligonucleotides in vitro in Experimental example 4 of the present invention.

FIG. 9 shows the results of jasmonates assay after antisense inhibition of CsHPL1 by oligonucleotides in vitro in Experimental example 4 of the present invention.

FIG. 10 shows the jasmonic acid assay results after tobacco transiently expresses CsHPL3 in vitro in Experimental example 3 of the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Experimental materials:

1. tea tree samples: the Shucha early tea tree is planted in the agricultural industrial park of Yihui agricultural university of Yihui, Luyang area of Anhui province, and the leaf picking condition is 25-28 ℃.

The preparation process of the black tea mainly comprises the following steps: picking, withering, rolling, fermenting and drying. The method specifically comprises the following steps: picking one bud and one leaf of Shucha early plant (in this case, a fresh leaf sample); spreading at room temperature for about 16h (withering sample after completion); firstly, lightly kneading tea leaves into a spherical shape, then heavily kneading and lightly kneading (a kneading sample is obtained after the completion); wrapping the tea leaves with gauze, fermenting at 30 deg.C for 12h (fermentation sample after completion), dispersing every 2h during fermentation period, and continuing fermentation; drying at 110 ℃ for about 15min (drying samples after completion).

Tobacco sample: nicotiana benthamiana (Nicotiana benthamiana) was grown in a light culture chamber at a temperature of 22 ℃ to 25 ℃.

2. Coli: DH5 α (from NEB, C2987-NEB).

3. Carrier: pGEM-T Easy (available from Promega, Cat. # A3600, A3610), pET28A (available from Promega, Cat #69864-3), pB2GW7 (available from Thermo Fisher Scientific, 67493-2).

4. LB culture medium: adding 10g of NaCl, 5g of yeast extract and 10g of tryptone into 950mL of ultrapure water, stirring and dissolving, adding water to a constant volume of 1000mL, and sterilizing for 15min by high-pressure steam to obtain an LB liquid culture medium, wherein the LB solid culture medium is obtained by adding 15g of agar powder into the LB liquid culture medium.

5. Ampicillin mother liquor (Amp +, 50 mg/mL): 0.5g ampicillin Amp was weighed, dissolved in 10mL sterile water, filtered, sterilized, and dispensed into vials for storage at-20 ℃.

6. Kanamycin (kanamycin) (10 mg/mL): dissolving 100mg kanamycin in sufficient sterilized water, finally metering to 10mL, filtering for sterilization, subpackaging into small parts and storing at-20 ℃.

7. In vitro oligonucleotide antisense inhibition buffer: centrifuging nucleotide powder (8000rpm,5min), adding 2mL of 50Mmol/L sucrose solution into each tube, shaking on a vortex apparatus for several minutes, observing whether the powder is completely dissolved, stopping shaking if no particles are found, obtaining in vitro oligonucleotide antisense inhibition buffer solution (hereinafter referred to as buffer solution), transferring 250 μ L of buffer solution by using a liquid transfer gun, and subpackaging in a 96-well plate for later use.

Experimental example 1 different tissues of Shuchazao and the expression difference of lipid hydroperoxide lyase genes CsHPL1 and CsHPL3 during black tea processing

1. Expression difference of lipid hydroperoxide lyase genes CsHPL1 and CsHPL3 in different tissues of Shuchazao

The root, stem, flower, fruit, bud, leaf and leaf of Shucha early plant are respectively picked, the expression level of CsHPL1 and CsHPL3 in each sample is detected by a high-throughput sequencing method, as shown in FIG. 3, the expression level of CsHPL1 and CsHPL3 in different tissues of the invention is a bar chart, A in FIG. 3 is the expression level of CsHPL1 in each sample, B in FIG. 3 is the expression level of CsHPL3 in each sample, L1 in the diagram shows one leaf, L2 shows two leaves, L3 shows three leaves, FL shows flower, FR shows fruit, S shows stem, R shows root, B shows bud, it can be seen that the expression level of CsHPL1 is higher in fruit, bud, one leaf and two leaves, which indicates that the tissues have corresponding functions, and CsHPL3 shows higher expression level in fruit, three leaves and root, which indicates that the three tissues have corresponding functions.

2. Expression difference of CsHPL1 and CsHPL3 genes in black tea processing process

Samples of the black tea during the picking, withering, rolling, fermentation and drying periods are respectively taken, expression quantities of different periods are detected by a high-throughput sequencing method and fluorescent quantitative PCR, as shown in figure 4, the expression quantities of CsHPL1 and CsHPL3 in the black tea processing process are bar charts (HX: picked fresh leaves, HW: withering, HR: rolling and HF: fermentation), A in figure 4 is the relative expression quantity of CsHPL1 in the black tea processing process, B in figure 4 is the relative expression quantity of CsHPL3 in the black tea processing process, and it can be seen that data of transcription set data and quantitative PCR indicate that the expression quantity of the gene is gradually increased from the fresh leaves to the rolling process and then is obviously reduced in the fermentation process, which indicates that the processing withering and rolling of the black tea promotes the expression of the gene, and the expression quantity of the gene is very low after the fermentation process, and indicates that the gene participates in the black tea manufacturing process. The transcriptome data and the quantitative PCR data indicate that the expression level of the CsHPL3 gene is gradually increased from withering to fermentation, which indicates that the processing of black tea promotes the expression of the gene and that the gene is also involved in the making process of black tea.

Experimental example 2 cloning of lipid hydroperoxide lyase genes CsHPL1 and CsHPL3

1. Preparation of DH5 alpha E.coli containing the sequence of the gene CsHPL1 or CsHPL3

(1) Specific primer

The specific primer sequences for CsHPL1 are as follows (the outlined parts are restriction sites):

F(SEQ ID NO.5)：

CGGATCCATGTCGGCAGTGATGGCGAAAATG BamH1

R(SEQ ID NO.6)：

GGAATTCTCACTTAGCTTTTTCGACGGC EcoR1

the specific primer sequences for CsHPL3 are as follows (the outlined parts are restriction sites):

F(SEQ ID NO.7)：

TGGATCCATGGAGGCCATCTCACTGTCTCT BamH1

R(SEQ ID NO.8)：

CAAGCTTCTAGCACGCTTGGAGGCGAATT Hind3

(2) extracting total RNA of a tea tree sample according to the instructions of a plant total RNA extraction kit and a first strand cDNA synthesis kit (purchased from TIANGEN, Cat # DP441), and performing reverse transcription to obtain cDNA;

(3) respectively amplifying by using the specific primers by using reverse transcribed cDNA as a template, wherein the amplification procedure comprises pre-denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 30s, extension at 68 ℃ for 1min, 35 cycles, and continuous extension at 68 ℃ for 5min, and the obtained PCR product is stored at 4 ℃; wherein, the nucleotide sequence of the lipid hydroperoxide lyase gene CsHPL1 is shown as SEQ ID NO.1, and the amino acid sequence of the coded protein is shown as SEQ ID NO. 2; the nucleotide sequence of the lipid hydroperoxide lyase gene CsHPL3 is shown as SEQ ID NO.3, and the amino acid sequence of the coded protein is shown as SEQ ID NO. 4;

(4) the PCR product was purified using a PCR purification kit (purchased from CWBIO, Cat CW2302M, century Biotech Co., Ltd.), ligated to pGEM-T Easy and transformed into DH 5. alpha. to carry out colony PCR verification, gel running verification and sequencing verification, thereby obtaining a positive colony, and a T vector (CsHPL1-pGEM or CsHPL3-pGEM) containing the CsHPL1 gene or CsHPL3 was obtained, and then Escherichia coli DH 5. alpha. comprising the sequence of the lipoperoxidase lyase gene CsHPL1 or CsHPL3 was obtained.

2. Preparation of fusion vector containing CsHPL3

(1) Preparation of recombinant plasmid CsHPL3-PET28A

The CsHPL3-pGEM obtained in Experimental example 3 was double-digested with restriction enzymes BamHI and Hind3, and the digested product was recovered. The pET-28a (+) vector was subjected to double digestion with restriction enzymes BamH I and Hind3, and the vector backbone was recovered. And connecting the recovered enzyme digestion product with a vector framework to obtain the recombinant plasmid CsHPL3-PET 28A.

According to the sequencing results, the recombinant plasmid was structurally described as follows: a double-stranded DNA molecule represented by CsHPL3 was inserted between the BamHI and Hind3 sites of the pET-28a (+) vector. The recombinant plasmid has a fusion gene shown in CsHPL3, expresses a fusion protein shown in CsHPL3, and the fusion protein is also called CsHPL3 protein with a 6 XHis tag.

(2) Preparation of recombinant plasmid CsHPL3-PB2GW7

The sequences of the specific primers are as follows (the underlined parts are linker sequences):

F(SEQ ID NO.9)：

GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGGCCATCTC ACTGTCTCT；

R(SEQ ID NO.10)：

GGGGACCACTTTGTACAAGAAAGCTGGGTCTAGCACGCTTGGAGG CGAATT；

the CsHPL3-pGEM obtained in the experimental example 3 is used as a template, the specific primer in the experimental example is used for amplification, and a homologous recombination method (Gateway technology) is utilized to construct CsHPL3-PB2GW7 through PCR verification, gel running verification and sequencing verification in sequence, wherein the fusion vector has a 35S strong promoter.

Experimental example 3 preparation of recombinant bacterium containing CsHPL3 and expression and purification of target protein

1. Preparation of recombinant bacterium containing CsHPL3

The recombinant plasmid CsHPL3-PET28A constructed in the experimental example 2 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacterium A; introducing a pET-28a (+) vector into escherichia coli BL21(DE3) to obtain a recombinant bacterium B; introducing the recombinant plasmid CsHPL3-PB2GW7 constructed in the experimental example 2 into agrobacterium GV3101 to obtain recombinant bacterium C; the PB2GW7(+) vector is introduced into agrobacterium GV310 to obtain a recombinant strain D.

2. Expression and purification of target protein in recombinant bacteria A and B

Inoculating the above recombinant bacteria A and B into liquid LB culture medium containing 50mg/L kanamycin, and shake-culturing at 37 deg.C and 180rpm to OD_600nm0.6. Then, IPTG (isopropyl-. beta. -D-thiogalactoside) was added to the system to give a concentration of 0.5mmol/L in the system, and shaking culture was carried out at 16 ℃ and 180rpm for 16 hours. After the shaking culture was completed, centrifugation was carried out at 12000rpm for 10min, the pellet was collected, and the pellet was lysed with a lysis buffer (25 mL of a 1M aqueous solution of Tris, 30mL of a 5M aqueous solution of NaCl and 945mL of ddH)₂O) suspension, followed by ultrasonication (300W, 4s per 3s of ultrasonication, 100 times) in an ice bath, followed by centrifugation at 10000rpm for 30min and collection of the supernatant.

Taking the supernatant, purifying by using Ni-NTA agar gel, and using Wash Buffer (prepared from 25mL of 1M Tris aqueous solution, 30mL of 5M NaCl aqueous solution, 3mL of 5M imidazole aqueous solution and 942mL of ddH in the purification process₂O) to remove the hetero-proteins, using an Elution Buffer (consisting of 25mL of 1M Tris aqueous solution, 20mL of 5M imidazole aqueous solution, and 955mL of ddH₂O) to collect the target protein, to obtain a protein solution.

The recombinant bacterium A is adopted to carry out the expression and purification steps, and the obtained protein solution is named as CsHPL3 protein solution. And (3) carrying out the expression and purification steps by adopting the recombinant bacterium B, and naming the obtained protein solution as a control protein solution.

3. Expression of target protein in recombinant bacteria C and D

Recombinant strains C and D are selected and inoculated into 5mL of LB liquid culture medium (containing 100 mu g/mL gentamicin and 50 mu g/mL spectinomycin), and shake culture is carried out at 28 ℃. 1mL of overnight cultured Agrobacterium was transferred to 25mL of LB liquid medium (containing 100. mu.g/mL gentamicin, 50. mu.g/mL spectinomycin, and autoclaved acetosyringone), and OD of overnight cultured bacterial liquid was detected₆₀₀The value of (c). 5000g, 15min pooling, resuspension (10mM MgCl)₂10mM 2- (N-morpholino) ethanesulfonic acid (p)H5.6), 100. mu.M acetosyringone) resuspended cells, final OD₆₀₀Is 0.4. Standing at room temperature for 2-3 h, and injecting into tobacco. The infestations were filled into 5mL syringes and the liquid was injected into tobacco leaves from the lower skin of the leaf (without using the cotyledons) by pressing the syringe back plate with the thumb. After injection, tobacco leaves are wet.

3 days after injection, taking an injection leaf, performing an in vitro enzyme activity experiment by taking 13-HPOT (linolenic acid hydroperoxide at the 13 site) as a reaction substrate, diluting 10 mu L of CsHPL3 protein solution and 10 mu L of the substrate to 3mL by 0.05mol/L of phosphate buffer solution (pH 6.0), and performing volatile matter and jasmonic acid substance determination after reacting for 30 min.

As shown in fig. 5, which is a graph showing the expression level results of the gene CsHPL1 in experimental example 4 and the gene CsHPL3 in experimental example 3 of the present invention, it can be seen from B in fig. 5 that the expression level of the tobacco transiently expressed gene CsHPL3, and that the expression level of the gene CsHPL3 is transiently expressed, significantly increased.

As shown in FIG. 6, which is the result of the experiment of the exoenzyme activity in Experimental example 3 of the present invention, it was shown that volatile substances such as n-decanol, hexanol, etc. can be generated by using 13-HPOT (linolenic acid hydroperoxide at position 13) as a reaction substrate and purified supernatant protein induced by CsHPL3 as a catalyst.

Experimental example 4 in vitro oligonucleotide antisense inhibition experiment of Gene CsHPL1

1. A primer for synthesizing the antisense oligonucleotide is designed according to the gene CsHPL1, and the sequence of the primer is as follows:

2. dissolving with 80mM sucrose solution to obtain inhibition buffer solution, and making blank (control group) into sucrose solution;

3. shearing two leaves with one bud and two leaves which are basically consistent in size, bright in color, healthy in color and free of insects and diseases by using scissors, inserting the two leaves with one bud into a 96-well plate filled with a buffer solution, and ensuring that the tail of the two leaves with one bud is immersed into the buffer solution;

4. putting the 96-well plate into an illumination incubator, and carrying out illumination culture according to illumination of 16 h/darkness of 8h, wherein the temperature of the incubator is 28 ℃;

5. taking the treated 3d primer treatment sample and the blank sample, and measuring volatile matters and jasmonic acid substances.

As shown in fig. 5, which is a graph showing the expression level results of the gene CsHPL1 in experimental example 4 and the gene CsHPL3 in experimental example 3 of the present invention, it can be seen from a in fig. 5 that the expression level of the lipid hydroperoxide lyase gene CsHPL1 in the in vitro oligonucleotide antisense suppression experiment can be significantly suppressed compared to the control group CsHPL1, and the suppression rate is close to 50%.

Experimental example 5 volatile matter measurement

Volatile determination was performed on the volatile in the leaf of the CsHPL3 protein solution injected in experimental example 3 and the CsHPL1 in vitro oligonucleotide antisense suppression sample obtained in experimental example 4: determination of volatile matter is determined by using a headspace solid-phase microextraction (HS-SPME) method combined with gas-phase mass spectrometry (GC-MS, Agilent 7890A), extracting volatile matters of in vitro oligonucleotide antisense inhibition samples and blank samples by using an extraction head containing 50/30 mu m DVB/CAR/PDMS (Supelco), extracting at 60 ℃ for 1h, then taking out the extraction head, inserting the extraction head into a GC-MS sample inlet, desorbing for 5min, and starting an instrument to collect data.

The chromatographic conditions for GC-MS detection are as follows: the temperature of a sample inlet is 240 ℃, the carrier gas is high-purity nitrogen, the purity is more than 99.99 percent, the flow rate is 0.8ml/min, and split-flow sample injection is not carried out; the chromatography column model was HP-5MS quartz capillary column (60 m.times.0.32 mm.times.0.25 μm); the column temperature is initially 40 deg.C, held for 3min, ramped to 90 deg.C at 2 deg.C/min, held for 5min, ramped to 160 deg.C at 3 deg.C/min, ramped to 250 deg.C at 10 deg.C/min, and held for 5 min.

The mass spectrum conditions for GC-MS detection are as follows: the ion source is an EI source, the temperature of the ion source is 230 ℃, the electron energy is 70eV, the temperature of a quadrupole rod is 150 ℃, the interface temperature is 280 ℃, the voltage of an electron multiplier is 1680V, and the scanning range m/z is 35-350 amu.

As shown in fig. 7, the measurement result of the volatile matter after the in vitro tobacco transiently expresses CsHPL3 in the invention experimental example 3 (the control group is the tobacco leaves transformed by injecting the empty vector), it can be seen that the measurement result of the volatile matter after the in vitro tobacco transient expression experiment 3d, the result shows that the content of 3-hexen-1-ol, 2-hexenal, 2, 4-heptadienal and nonanal is increased after the transient expression CsHPL3, especially the content of 2-hexenal and nonanal is significantly increased, which is respectively increased by about 80% and 4.7 times.

As shown in FIG. 8, the volatile measurement results after the in vitro oligonucleotide antisense inhibition experiment (control group is sucrose solution) in the Experimental example 4 of the present invention can be seen, and the volatile measurement results after the in vitro oligonucleotide antisense inhibition experiment 3d can be seen, which shows that the content of hexanal, 2-hexenal, 3-hexen-1-ol, 2, 4-adienal, 2, 4-heptadienal, 3-hexenyl acetate, 2-ethylhexanol, benzyl alcohol, linalool, nonanal, phenethyl alcohol, nonadienal, nonenal, geraniol, 3-hexenoic acid cis-3-hexenyl ester, and hexanoic acid-2-hexenyl ester is reduced, especially reduced by hexanal and 2-hexenal by about 86% and 76%, respectively, after the in vitro CsHPL1 inhibition.

Experimental example 6 measurement of jasmonates

Volatiles in the leaf of the CsHPL3 protein solution injected in experimental example 3 and the CsHPL1 in vitro oligonucleotide antisense inhibition sample obtained in experimental example 4 were respectively ground into powders in liquid nitrogen and extracted under the condition of keeping out of the light, and the specific method is as follows:

preparing an extraction buffer solution formula, wherein methanol: ddH₂Acetic acid 80:19:1(V: V). Weighing about 0.1g of sample into a 2mL centrifuge tube, adding 750 mu L of extraction solution, reversing, mixing evenly, placing on ice, wherein the process needs to be carried out under the condition of keeping out of the sun, and carrying out rotary extraction for more than 16h under the condition of keeping out of the sun at 4 ℃. Then, the mixture was centrifuged at 13000rpm for 10min at 4 ℃, the supernatant was aspirated into a new centrifuge tube, 750. mu.L of the extract was added again, and the mixture was extracted in the dark at 4 ℃ for 16 hours or more, centrifuged, and the two supernatants were combined.

Filtering with 0.22 μm filter membrane (organic filter membrane), blowing with nitrogen gas, adding 200 μ L methanol, reversing several times, and dissolving at 4 deg.C for 3-6 h (the process is carried out under dark condition).

After the lysate was centrifuged at 13000rpm for 15min at 4 ℃, 180. mu.L of the supernatant was gently aspirated into the inner cannula, and placed in a sample bottle dedicated to mass spectrometry for detection by the machine. The hormone samples were analyzed by LC-MS, the liquid chromatograph is Shimadzu LC-20AD type, and the quantitative analysis was performed by external standard method.

The detection method specifically comprises the following steps: the liquid chromatography adopts a binary solvent system, the liquid A of the mobile phase is methanol, the liquid B of the mobile phase is 0.05 percent formic acid aqueous solution, an Eclipse plus C18(5 mu m, 2.1 x 150mm) chromatographic column is selected, the flow rate is controlled to be 300 mu L/min, the column temperature is 30 ℃, and the sample injection is 10 mu L each time. Gradient elution was used with a gradient of 10% methanol starting and held for 2min, increasing gradually to 90% for 5min at 10 min. At 15.1min, methanol dropped to the initial gradient and was held for 7 min.

TABLE 1 liquid phase elution conditions for phytohormones

The mass spectrum conditions are as follows: the ion source is electrospray ion source (ESI), the voltage of the ion source is-4.5 KV, the temperature of the ion source is 500 deg.C, and N is used₂For assisting heating gas2(50psi), atomizing gas1(60psi) and air curtain gas (30psi), the object to be tested is in a negative ion mode. The standard mixture was separated in reverse phase liquid chromatography and quantitatively analyzed in tandem triple quadrupole mass spectrometry multiple reaction detection (MRM) mode with a scan time of 50 ms.

As shown in fig. 9, which is a determination result of Jasmonic acid substances after antisense inhibition of CsHPL1 by using oligonucleotides in vitro in experimental example 4 of the present invention (a control group is a sucrose solution), it can be seen that the Jasmonic acid substance determination result after antisense inhibition of CsHPL 3d by using oligonucleotides in vitro, inhibition of expression of CsHPL1 can significantly promote the contents of Jasmonic acid precursor OPDA, dnOPDA (dinor-OPDA, dioxo-12-oxophytodienoic acid) and Jasmonic acid substances JA, JA-Ile (Jasmonic acid isoluteine, Jasmonic acid isoleucine) and the like, and the MeJA (methyl jasmonate) content is increased by 45% compared with the control.

As shown in fig. 10, which is a jasmonic acid determination result after the in vitro tobacco is transiently expressed CsHPL3 (the control group is a tobacco leaf transformed by injecting an empty vector), it can be seen that the jasmonic acid determination result after the in vitro tobacco transient expression experiment 3d significantly reduces the contents of jasmonic acid precursor OPDA, dnOPDA, jasmonic acid substances JA, JA-Ile, MeJA, and the like after the CsHPL3 is transiently expressed, and compared with the control group, the MeJA content of 1/3 is reduced.

While the present invention has been described in detail with reference to the preferred embodiments, it should be understood that the above description should not be taken as limiting the invention. Various modifications and alterations to this invention will become apparent to those skilled in the art upon reading the foregoing description. Accordingly, the scope of the invention should be determined from the following claims.

Sequence listing

<110> agriculture university of Anhui

<120> lipid hydroperoxide lyase, gene, primer and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1476

<212> DNA

<213> Artificial Sequence

<400> 1

atgtcggcag tgatggcgaa aatgatgagc atatcaccag gtatgccctc accctcacca 60

tccctaacac cgccatcgcc gtcgtcaatt tcagcgccgg tccgcacaat cccgggcggc 120

tacgggtggc cggtgctggg tccgatttcc gaccgactcg actacttctg gttccaaggt 180

ccagaaacat tcttcaggaa gagaattgag aaacacaaga gtaccgtgtt ccgtacaaat 240

cttcccccaa cttttccttt cttctacggt gtaaacccta acgtagtggc cctgctggat 300

tgcaaatctt tcgctcatat gtttaatatg gagatcgttg agaagaagaa tgttctcgtc 360

ggagatttca tgcctagtgt ttcctacacc ggcgatttga gagtttgtgc ttatcttgat 420

acatctgagt ctctccattc taaggtcaag aactttgcgc tggacatcct aaaacgaagc 480

tccaccatat gggtccccac actcagctcc accctggaca ccatgtggtc cagcatagag 540

tccagcctcg ccaagtccgg ctctgccagc tacctcgtcc cgatacaaca gttcatcttc 600

agcttcttca ctcgcactct catcggcgct gacacggcgg cttcgcctga aatcgccagt 660

tccggctacg ccatgctgga catctggctc gctctccagc tcctacccac cgtcaagatc 720

ggcattcttc aacccctcga agagctcttt cttcactcct acgcttaccc tttcttcctc 780

gtcagcggcg gctacaacaa gctcgtcaaa tttattgaag aacatggcaa agaagttatc 840

cagagaggcg agaccgagtt cggactcact aagcatgaaa cgattcacaa ccttctcttc 900

attctcggct tcaatgccta cggcggtttc tctattttct tgccgaccct gttgagccaa 960

ctcggaaccg acacaaccgg gattcaacaa aagctgaggg aagaagtaag agcaaaaagc 1020

gggtcgactc tgagtttcga ctcagtaaaa gaaatggaac tcgttaagtc attcgtttac 1080

gaaacgctcc gactcaaccc gcccgtaccg cttcaatacg ctcgagcgag gaaggacttc 1140

gtactgagtt cgcatgactc ggcgtacgag atcaagaaag gtgagttact gtgtggttat 1200

cagaccctgg tgatgagaga ttcgaaggtg tttgacgatc cagagaaatt tattttcgat 1260

cgatttacga aggagaaggg gagtgagtta ctgagttact tgtactggtc gaatgggcca 1320

cagaccgggt caccgagcga gtcgaataaa cagtgtgcgg ctaaggacta tgttacgctc 1380

actgcgtgcc ttttcgtggc gcatctgtac cgtaggtatg actcgatcac gtgtaactcg 1440

tctggggcaa tcacggccgt cgaaaaagct aagtga 1476

<210> 2

<211> 491

<212> PRT

<213> Artificial Sequence

<400> 2

Met Ser Ala Val Met Ala Lys Met Met Ser Ile Ser Pro Gly Met Pro

1 5 10 15

Ser Pro Ser Pro Ser Leu Thr Pro Pro Ser Pro Ser Ser Ile Ser Ala

20 25 30

Pro Val Arg Thr Ile Pro Gly Gly Tyr Gly Trp Pro Val Leu Gly Pro

35 40 45

Ile Ser Asp Arg Leu Asp Tyr Phe Trp Phe Gln Gly Pro Glu Thr Phe

50 55 60

Phe Arg Lys Arg Ile Glu Lys His Lys Ser Thr Val Phe Arg Thr Asn

65 70 75 80

Leu Pro Pro Thr Phe Pro Phe Phe Tyr Gly Val Asn Pro Asn Val Val

85 90 95

Ala Leu Leu Asp Cys Lys Ser Phe Ala His Met Phe Asn Met Glu Ile

100 105 110

Val Glu Lys Lys Asn Val Leu Val Gly Asp Phe Met Pro Ser Val Ser

115 120 125

Tyr Thr Gly Asp Leu Arg Val Cys Ala Tyr Leu Asp Thr Ser Glu Ser

130 135 140

Leu His Ser Lys Val Lys Asn Phe Ala Leu Asp Ile Leu Lys Arg Ser

145 150 155 160

Ser Thr Ile Trp Val Pro Thr Leu Ser Ser Thr Leu Asp Thr Met Trp

165 170 175

Ser Ser Ile Glu Ser Ser Leu Ala Lys Ser Gly Ser Ala Ser Tyr Leu

180 185 190

Val Pro Ile Gln Gln Phe Ile Phe Ser Phe Phe Thr Arg Thr Leu Ile

195 200 205

Gly Ala Asp Thr Ala Ala Ser Pro Glu Ile Ala Ser Ser Gly Tyr Ala

210 215 220

Met Leu Asp Ile Trp Leu Ala Leu Gln Leu Leu Pro Thr Val Lys Ile

225 230 235 240

Gly Ile Leu Gln Pro Leu Glu Glu Leu Phe Leu His Ser Tyr Ala Tyr

245 250 255

Pro Phe Phe Leu Val Ser Gly Gly Tyr Asn Lys Leu Val Lys Phe Ile

260 265 270

Glu Glu His Gly Lys Glu Val Ile Gln Arg Gly Glu Thr Glu Phe Gly

275 280 285

Leu Thr Lys His Glu Thr Ile His Asn Leu Leu Phe Ile Leu Gly Phe

290 295 300

Asn Ala Tyr Gly Gly Phe Ser Ile Phe Leu Pro Thr Leu Leu Ser Gln

305 310 315 320

Leu Gly Thr Asp Thr Thr Gly Ile Gln Gln Lys Leu Arg Glu Glu Val

325 330 335

Arg Ala Lys Ser Gly Ser Thr Leu Ser Phe Asp Ser Val Lys Glu Met

340 345 350

Glu Leu Val Lys Ser Phe Val Tyr Glu Thr Leu Arg Leu Asn Pro Pro

355 360 365

Val Pro Leu Gln Tyr Ala Arg Ala Arg Lys Asp Phe Val Leu Ser Ser

370 375 380

His Asp Ser Ala Tyr Glu Ile Lys Lys Gly Glu Leu Leu Cys Gly Tyr

385 390 395 400

Gln Thr Leu Val Met Arg Asp Ser Lys Val Phe Asp Asp Pro Glu Lys

405 410 415

Phe Ile Phe Asp Arg Phe Thr Lys Glu Lys Gly Ser Glu Leu Leu Ser

420 425 430

Tyr Leu Tyr Trp Ser Asn Gly Pro Gln Thr Gly Ser Pro Ser Glu Ser

435 440 445

Asn Lys Gln Cys Ala Ala Lys Asp Tyr Val Thr Leu Thr Ala Cys Leu

450 455 460

Phe Val Ala His Leu Tyr Arg Arg Tyr Asp Ser Ile Thr Cys Asn Ser

465 470 475 480

Ser Gly Ala Ile Thr Ala Val Glu Lys Ala Lys

485 490

<210> 3

<211> 1455

<212> DNA

<213> Artificial Sequence

<400> 3

atggaggcca tctcactgtc tctgtgtgtg gctcttcttg ttatctttct tactctctgc 60

ttcatctttg ctttcaaatc caattccaat aacacaaggc tgccacttcc accaggtagc 120

tatggatggc cgattattgg tgaaaccatg aaattcttct acaatcctga gaaatttgtg 180

actgacagaa tgacaaaata ctctcctgaa atcttcaaaa ccaagttttt caatgaaaaa 240

atcgctgtca tatgcggtcc caacggtcac aaattcctct tctccaatga ccacaaactc 300

ttctctcaat tccacccaaa agccatggaa aagctcttcc tctcttcatc atcccgcaaa 360

aaatcccacg ccgaagaagg agcctccctc gacaaggact taaaactagt acgcggccct 420

ggcgtgttca aaaccgacgc gttgatccat tatgtggcag ctatggattc aatcatccag 480

caaaaaatca aggccgagtt aaatgaagta gaggtggtga aggcttatcc cttttcgagg 540

aatataacct tgacgctcgc ttgtcgatac tttttgggaa tggagattag tgcagagcgt 600

atcgcgaggc ttgttgggta ttttgatcaa gtcacattgg ggatgcattc tatgccattg 660

gattttcccg ggacgacgtt ttattatgct tgtaaagctg cagatgtgat tcggaaggag 720

ctttcgggga taattcagga gaagaaagct gaaatggcgg ctgctaagga aggaggagca 780

ccaaaagcac aagacctact gtcacatatg attgcagcca gctgtgagga tggaagtgag 840

gcagaggcag agattggtga taaaattatg ggattgattg tggctggata tgggactgtt 900

tcaactgcca taacttactt catgaaatat gttggagaga gacccgacat ctatcgtaag 960

atcctatcag agcaattgga gatctcaaag gggaaacagg ctggagaata tttaagctgg 1020

gatgacatgc agaaaatgaa gtattcatgg gctgtaatct gtgaagtgat gaggtttact 1080

cctccagttc aaggaaattt tagagtggct ctaactgact ccacttatgc tggttacact 1140

attccaaagg gttggaaggt attttggaca gtaactacaa cacaaaaaaa tccagagtac 1200

ttcagagaac cagaaaaatt tgacccttct cggttcattg atggtgatgg acctcctcca 1260

ttcacatacg tgccgtttgg aggtggacct ggaatgtgcc ctgggaaaga gtattcacga 1320

ttagttgtgc tcgctttcgt ccacaatgtg gttaagaagt ttaaatggga ggtactattt 1380

cccaatgaga aaattttggg caccatgttg ccaattcctg aaaaaggact tccaattcgc 1440

ctccaagcgt gctag 1455

<210> 4

<211> 484

<212> PRT

<213> Artificial Sequence

<400> 4

Met Glu Ala Ile Ser Leu Ser Leu Cys Val Ala Leu Leu Val Ile Phe

1 5 10 15

Leu Thr Leu Cys Phe Ile Phe Ala Phe Lys Ser Asn Ser Asn Asn Thr

20 25 30

Arg Leu Pro Leu Pro Pro Gly Ser Tyr Gly Trp Pro Ile Ile Gly Glu

35 40 45

Thr Met Lys Phe Phe Tyr Asn Pro Glu Lys Phe Val Thr Asp Arg Met

50 55 60

Thr Lys Tyr Ser Pro Glu Ile Phe Lys Thr Lys Phe Phe Asn Glu Lys

65 70 75 80

Ile Ala Val Ile Cys Gly Pro Asn Gly His Lys Phe Leu Phe Ser Asn

85 90 95

Asp His Lys Leu Phe Ser Gln Phe His Pro Lys Ala Met Glu Lys Leu

100 105 110

Phe Leu Ser Ser Ser Ser Arg Lys Lys Ser His Ala Glu Glu Gly Ala

115 120 125

Ser Leu Asp Lys Asp Leu Lys Leu Val Arg Gly Pro Gly Val Phe Lys

130 135 140

Thr Asp Ala Leu Ile His Tyr Val Ala Ala Met Asp Ser Ile Ile Gln

145 150 155 160

Gln Lys Ile Lys Ala Glu Leu Asn Glu Val Glu Val Val Lys Ala Tyr

165 170 175

Pro Phe Ser Arg Asn Ile Thr Leu Thr Leu Ala Cys Arg Tyr Phe Leu

180 185 190

Gly Met Glu Ile Ser Ala Glu Arg Ile Ala Arg Leu Val Gly Tyr Phe

195 200 205

Asp Gln Val Thr Leu Gly Met His Ser Met Pro Leu Asp Phe Pro Gly

210 215 220

Thr Thr Phe Tyr Tyr Ala Cys Lys Ala Ala Asp Val Ile Arg Lys Glu

225 230 235 240

Leu Ser Gly Ile Ile Gln Glu Lys Lys Ala Glu Met Ala Ala Ala Lys

245 250 255

Glu Gly Gly Ala Pro Lys Ala Gln Asp Leu Leu Ser His Met Ile Ala

260 265 270

Ala Ser Cys Glu Asp Gly Ser Glu Ala Glu Ala Glu Ile Gly Asp Lys

275 280 285

Ile Met Gly Leu Ile Val Ala Gly Tyr Gly Thr Val Ser Thr Ala Ile

290 295 300

Thr Tyr Phe Met Lys Tyr Val Gly Glu Arg Pro Asp Ile Tyr Arg Lys

305 310 315 320

Ile Leu Ser Glu Gln Leu Glu Ile Ser Lys Gly Lys Gln Ala Gly Glu

325 330 335

Tyr Leu Ser Trp Asp Asp Met Gln Lys Met Lys Tyr Ser Trp Ala Val

340 345 350

Ile Cys Glu Val Met Arg Phe Thr Pro Pro Val Gln Gly Asn Phe Arg

355 360 365

Val Ala Leu Thr Asp Ser Thr Tyr Ala Gly Tyr Thr Ile Pro Lys Gly

370 375 380

Trp Lys Val Phe Trp Thr Val Thr Thr Thr Gln Lys Asn Pro Glu Tyr

385 390 395 400

Phe Arg Glu Pro Glu Lys Phe Asp Pro Ser Arg Phe Ile Asp Gly Asp

405 410 415

Gly Pro Pro Pro Phe Thr Tyr Val Pro Phe Gly Gly Gly Pro Gly Met

420 425 430

Cys Pro Gly Lys Glu Tyr Ser Arg Leu Val Val Leu Ala Phe Val His

435 440 445

Asn Val Val Lys Lys Phe Lys Trp Glu Val Leu Phe Pro Asn Glu Lys

450 455 460

Ile Leu Gly Thr Met Leu Pro Ile Pro Glu Lys Gly Leu Pro Ile Arg

465 470 475 480

Leu Gln Ala Cys

<210> 5

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 5

cggatccatg tcggcagtga tggcgaaaat g 31

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 6

ggaattctca cttagctttt tcgacggc 28

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 7

tggatccatg gaggccatct cactgtctct 30

<210> 8

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 8

caagcttcta gcacgcttgg aggcgaatt 29

<210> 9

<211> 54

<212> DNA

<213> Artificial Sequence

<400> 9

ggggacaagt ttgtacaaaa aagcaggctt catggaggcc atctcactgt ctct 54

<210> 10

<211> 51

<212> DNA

<213> Artificial Sequence

<400> 10

ggggaccact ttgtacaaga aagctgggtc tagcacgctt ggaggcgaat t 51

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

ggtgttaggg atggtgaggg 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

tccagggtgg agctgagtgt 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

gtacggaaca cggtactctt 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 14

tgccgatctt gacggtgggt 20

Claims (4)

1. A lipid hydroperoxide lyase gene for regulating volatile matters and jasmonic acid substances is characterized in that the nucleotide sequence of the gene is shown in SEQ ID NO. 3.

2. A lipid hydroperoxide lyase which regulates volatile substances and jasmonates, wherein the lyase is encoded by the gene of claim 1 and has the amino acid sequence shown in SEQ ID No. 4.

3. The PCR primer for a lipid hydroperoxide lyase gene as set forth in claim 1, wherein the nucleotide sequence of the upstream primer is represented by SEQ ID NO.7, and the nucleotide sequence of the downstream primer is represented by SEQ ID NO. 8.

4. The use of the lipid hydroperoxide lyase gene of claim 1, wherein the lyase gene is used to control the content of volatiles and jasmonates in plants; the plants are: tea trees; the lyase gene expression is used for improving the generation of volatile matters with grass fragrance C6-C9 in plants, and is used for inhibiting the increase of jasmonic acid precursor substances and the content of jasmonic acid substances; the jasmonic acid precursor substances are as follows: oxidized vegetable dienoic acids, dioxo-oxidized vegetable dienoic acids; the jasmonic acid substances are as follows: jasmonic acid, jasmonic acid-isoleucine complex, methyl jasmonate; the volatile matter with the grass aroma C6-C9 is: 3-hexen-1-ol, 2-hexenal, 2, 4-heptadienal, nonanal.

Images