CN111575255B

CN111575255B - Oxidase, DNA molecule for coding oxidase and application thereof

Info

Publication number: CN111575255B
Application number: CN202010407545.XA
Authority: CN
Inventors: 赵剑; 张高阳; 崔单单; 赵丹丹
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2020-05-14
Filing date: 2020-05-14
Publication date: 2022-03-15
Anticipated expiration: 2040-05-14
Also published as: CN111575255A

Abstract

The invention belongs to the technical field of tea processing, and particularly relates to oxidase, a DNA molecule for coding the oxidase and application of the oxidase. The invention discovers two oxidases capable of catalyzing catechin compounds to synthesize theaflavin from Shucha, has the activities of peroxidase and polyphenol oxidase, and is named CsGPX1 protein and CsSPX1 protein respectively. The two proteins can be used as indexes, and black tea with expected theaflavin content can be obtained by setting black tea fermentation parameters (temperature, humidity, pH, time and the like in the tea processing process) through objective data, so that the standardization, automation and mechanization of tea processing are effectively promoted. The two proteins can also be used for tea tree breeding, or screening of excellent tea tree varieties, or adjusting the content of theaflavin compounds in tea leaves, or as a marker for screening of tea tree varieties suitable for making green tea and/or tea tree varieties suitable for making black tea.

Description

Oxidase, DNA molecule for coding oxidase and application thereof

Technical Field

The invention belongs to the technical field of tea processing, and particularly relates to oxidase, a DNA molecule for coding the oxidase and application of the oxidase.

Background

In order to ensure that ester catechins (EGC, EGCG, ECG and CG) and non-ester catechins (EC and C) are not oxidized and degraded in the green tea processing process, enzyme deactivation is often adopted to inactivate oxidases (mainly peroxidase and polyphenol oxidase) in tea bodies. The temperature and time of fixation vary from tea plant species to tea plant species, and therefore green tea processing automation and standardization is affected.

The content of the theaflavin compounds generated in the black tea processing process generally accounts for 0.3% -1.5% of the dry weight of the tea, and 4 main theaflavin compounds are as follows: TF, TF2A, TF2B and TF 3. The theaflavin compounds are obtained by oxidation and condensation of catechin compounds under the action of oxidase in tea leaves in different combinations.

The theaflavin compound has the effects of regulating blood fat and preventing cardiovascular diseases, has no toxic or side effect, and is even superior to catechin in certain aspects. The theaflavin plays an important role in the liquor color and the taste of the black tea. Therefore, the high and low content of theaflavin determines the sale price of black tea and is one of the key factors for determining the quality of tea beverage. The natural medicine and the functional food which take the theaflavin as the raw material have wide research and development prospects. Screening specific peroxidase and polyphenol oxidase enzyme sources, synthesizing theaflavin compounds by utilizing enzymatic oxidation, researching the synthesis mechanism of the theaflavin compounds, and having important theoretical and practical significance. Although Peroxidase (POD) and polyphenol oxidase (PPO) are very important in black tea processing, there is a lack of genetic and genetic understanding of these enzymes. Analyzing the coding gene of the protein mainly responsible for the fermentation and oxidation of catechin by black tea to synthesize theaflavin in the tea can help molecular breeding of tea trees, cultivating low-expression peroxidase and polyphenol oxidase varieties to be convenient for specially manufacturing green tea, cultivating high-expression peroxidase and polyphenol oxidase varieties to be convenient for manufacturing black tea, being convenient for controlling the stability control in the processing process of the green tea or the black tea and being convenient for standardized automatic tea production.

Oxidase (mainly peroxidase and polyphenol oxidase) catalyzes and oxidizes catechin compounds to generate o-quinone substances, the o-quinone substances are further polymerized to generate the o-phenol quinones, the o-phenol quinones are further oxidized to generate theaflavin monomers, and the monomers are subjected to coupling oxidation to generate the theaflavin compounds. Researches prove that theaflavin is a dimer compound formed by oxidation polymerization of catechin and related gallic acid, and four main theaflavin formation mechanisms are as follows: (L) -EGC + (L) -EC → TF: theaflavins; (L) -EGCG + (L) -EC → TF 2A; (L) -ECG + (L) -EGC → TF 2B; (L) -EGCG + (L) -ECG → TF 3.

EGC is called epigallocatechin. EGCG is known as epigallocatechin gallate. ECG is known as epicatechin gallate. CG is known as catechin gallate. EC is collectively referred to as epicatechin. And C is totally called catechin. TF is known as theaflavin. TF2A is known as theaflavin-3-gallate. TF2B is known as theaflavin-3' gallate. TF3 is known as theaflavin digallate. GC is known collectively as gallocatechin. GCG is known as gallocatechin gallate.

Disclosure of Invention

The invention provides an oxidase, a DNA molecule encoding the oxidase and application thereof, aiming at solving part of the problems in the prior art or at least alleviating part of the problems in the prior art.

The oxidase has an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO. 2.

Further, the oxidase is a peroxidase and/or a polyphenol oxidase.

Further, the oxidase is tagged at the end, as shown in table 1 below.

TABLE 1 sequences of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL
HA
		9	YPYDVPDYA

Furthermore, the amino acid sequence of the oxidase is the amino acid sequence which is shown by SEQ ID NO.1 or SEQ ID NO.2 and has the same function after the substitution and/or deletion and/or addition of a plurality of amino acid residues; or an amino acid sequence which is derived from the amino acid sequence shown in SEQ ID NO.2, has more than 98 percent of homology and has the same function.

Further, the nucleotide sequence of the oxidase which codes the sequence shown in SEQ ID NO.1 is shown in SEQ ID NO. 3; the nucleotide sequence of oxidase for coding the sequence shown in SEQ ID NO.2 is shown in SEQ ID NO. 4.

Further, the nucleotide sequence of the oxidase which codes the sequence shown in SEQ ID NO.1 is a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.3 and codes the same functional protein; or has more than 90 percent or more than 95 percent or more than 98 percent of homology with the DNA sequence limited by SEQ ID NO.3 and encodes the DNA molecule of the same functional protein;

the nucleotide sequence of the oxidase which codes the sequence shown in SEQ ID NO.2 is a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.4 and codes the same functional protein; or DNA molecule which has more than 90% or more than 95% or more than 98% homology with the DNA sequence limited by SEQ ID NO.4 and codes the same functional protein.

The stringent conditions can be hybridization and washing with 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS solution at 65 ℃ in DNA or RNA hybridization experiments.

Use of an oxidase as described above as and/or in the preparation of an oxidase.

Use of a DNA molecule encoding an oxidase as described above for the preparation of an oxidase.

Use of an oxidase as described above as a peroxidase or a polyphenol oxidase and/or in the preparation of a peroxidase or a polyphenol oxidase.

Use of a DNA molecule encoding an oxidase as described above for the preparation of a peroxidase or a polyphenol oxidase.

The use of an oxidase as described above, or a DNA molecule encoding an oxidase as described above, in the breeding of tea plant, or the screening of superior tea plant varieties, or the adjustment of the content of theaflavin-like compounds in tea, or as a marker for the screening of tea plant varieties suitable for the production of green tea and/or tea plant varieties suitable for the production of black tea.

Further, the excellent tea plant variety includes a tea plant variety with high disease resistance.

Further, the theaflavin compound is prepared by catalyzing with catechin compound or epigallocatechin or epicatechin as substrate.

An oxidase as described above, or a DNA molecule encoding an oxidase as described above, is used as an indicator for investigation in the control of black tea processing.

The invention also provides application of substances for inhibiting the expression of the CsGPX1 gene and the CsSPX1 gene in preparing transgenic plants or transgenic plant tissues with reduced theaflavin level. The plant is tea tree. The substance for suppressing the expression of the CsGPX1 gene and the CsSPX1 gene may specifically be a specific DNA molecule described later or a recombinant expression vector having the specific DNA molecule.

The invention also provides application of substances for detecting the activity and/or level of the CsGPX1 protein and the CsSPX1 protein in cultivating plants with reduced theaflavin level. The plant is tea tree.

The present invention also provides use of a substance for detecting expression levels of the CsGPX1 gene and the CsSPX1 gene, which is at least one of the following (d1) to (d 5):

(d1) evaluating whether the variety or the individual of the tea tree to be tested is suitable for making green tea or black tea;

(d2) evaluating the capacity of the variety or individual of the tea tree to be tested for producing theaflavin;

(d3) evaluating the disease resistance of the variety or the individual of the tea tree to be tested;

(d4) screening tea varieties or individuals suitable for making green tea;

(d5) and screening tea varieties or individuals suitable for making black tea.

The substance for detecting the expression levels of the CsGPX1 gene and the CsSPX1 gene may specifically be a specific primer set described later.

The present invention also provides an application of a substance for detecting the levels of CsGPX1 protein and CsSPX1 protein, which is at least one of (d1) to (d5) as follows:

(d4) screening tea varieties or individuals suitable for making green tea;

(d5) and screening tea varieties or individuals suitable for making black tea.

In summary, the advantages and positive effects of the invention are:

according to the invention, through transcriptome data analysis of tea trees, prokaryotic expression and functional verification are combined, two oxidases capable of catalyzing catechin compounds to synthesize theaflavin are found from Shucha, have activities of peroxidase and polyphenol oxidase and are respectively named as CsGPX1 protein and CsSPX1 protein.

At present, the determination of the parameters (time length, temperature, humidity and the like) of the black tea processing and fermenting process mostly depends on the judgment of professional tea makers and is limited to the judgment of the tea fermentation performance by the feelings (such as vision, touch and the like) of the professional tea makers. The different and inaccurate feeling experience greatly limits the standardization and mechanization of tea processing, causes great change of tea quality and extremely poor repeatability consistency among batches, so that large-scale production cannot be realized, and the tea production quality, stability and uniformity in China cannot be compared with the international famous brand. By taking the protein levels of CsGPX1 protein and CsSPX1 as indexes, black tea with expected theaflavin content can be obtained by setting black tea fermentation parameters (temperature, humidity, pH, time and the like in the tea processing process) through objective data, so that the standardization, automation and mechanization of tea processing are effectively promoted.

The invention can be used for tea tree breeding. The tea variety with low expression CsGPX1 gene and CsSPX1 gene is cultivated, and green tea is convenient to produce. The tea tree varieties with high expression CsGPX1 gene and CsSPX1 gene are cultivated, and the black tea is convenient to make. The conventional breeding period of woody plant tea trees is long (10-20 years of heterosis selection is generally needed), and molecular breeding can greatly shorten the breeding time and reduce the manpower and time for large-scale screening.

The invention can be used for screening tea plant varieties suitable for making black tea and tea plant varieties suitable for making green tea. Specifically, the method is realized by detecting the expression levels of the CsGPX1 gene and the CsSPX1 gene, if the expression levels of the CsGPX1 gene and the CsSPX1 gene are high, the tea plant variety is suitable for making black tea, and if the expression levels of the CsGPX1 gene and the CsSPX1 gene are low, the tea plant variety is suitable for making green tea.

Based on the prior art, the high level of peroxidase indicates that the tea plant variety or individual has stronger disease resistance, and the higher the activity of peroxidase is, the stronger the disease resistance of the plant is. Therefore, the invention can be used for cultivating tea plant varieties with improved disease resistance, and can also be used for screening tea plant varieties or individuals with high disease resistance.

Drawings

FIG. 1 is the results of polyphenol oxidase enzyme activity and peroxidase enzyme activity of total protein of each sample in example 2;

FIG. 2 is the results of the content of catechins in example 2;

FIG. 3 is the results of expression amounts of the CsGPX1 gene and CsSPX1 gene in example 2;

FIG. 4 is the result of the difference in expression of CsGPX1 gene and CsSPX1 gene in different tissues of Shuchazao in example 3;

FIG. 5 shows the results of comparison of enzyme activities of different tea varieties in example 4;

FIG. 6 shows the results of the difference in expression of the CsGPX1 gene and CsSPX1 gene in different tea plant varieties in example 5;

FIG. 7 is the polyacrylamide gel electrophoresis chart of the recombinant bacterium in example 6 during the expression and purification of the target protein;

FIG. 8 shows the results of enzyme activity detection in step five in example 6;

FIG. 9 shows the results of the enzymatic property test in step seven of example 6;

FIG. 10 is a photograph showing the end of the reaction in step six of example 6;

FIG. 11 is a chromatogram of an HPLC assay in step six of example 6;

FIG. 12 is the results of the catechin concentration and the theaflavin content in the reaction system at the time of completion of the reaction in step six of example 6;

FIG. 13 shows the results of LC-MS in step six of example 6;

FIG. 14 is a result of reducing theaflavin content by suppressing the expression of CsGPX1 gene and CsSPX1 gene, respectively, in example 7.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

The proteins or fragments thereof involved in the present invention may be recombinant, natural, synthetic proteins or fragments thereof; the proteins or fragments thereof involved in the present invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques.

The invention discloses an oxidase, a DNA molecule for coding the oxidase and application thereof, which are shown in the following examples. The quantitative tests in the following examples, all set up three replicates and the results averaged. The spectrophotometer used in the examples was Spectra MAX 190(SoftMax Pro 5serial number: SMP 500-14530-XUSL). The Shuchazao tea and other tea tree varieties related in the invention are planted in Guo river tea tree varieties and germplasm resource gardens of Anhui province, Anhui agriculture university, and the leaf picking condition is 25-28 ℃.

The method for measuring the enzymatic activity of polyphenol oxidase (colorimetric method): the reaction system is 400 mu L; the initial system consists of 50 mu L of a sample to be tested (providing protein), catechol (serving as a substrate) and 0.1mM phosphate buffer solution with the pH value of 7.0, wherein the concentration of the catechol is 0.2 percent (weight to volume ratio, g/mL); standing the initial system at room temperature for 3min to obtain a terminated system; respectively detecting the light absorption values of the initial system and the termination system at 460nm by using a spectrophotometer, wherein the light absorption value of the termination system-the light absorption value of the initial system is the absorbance difference; polyphenol oxidase enzyme activity ═ absorbance difference ÷ (total protein content × reaction time), total protein units are mg, reaction time units are min.

Peroxidase enzyme activity determination method (colorimetric method): the reaction system is 1 mL; the initial system consists of 50 mu L of sample to be detected (providing protein), guaiacol (serving as substrate), 30% hydrogen peroxide solution and phosphate buffer solution with pH of 6.0 and 0.1M, wherein the concentration of the guaiacol is 0.56 mu L/mL, and the concentration of the hydrogen peroxide is 0.38 mu L/mL; standing the initial system at room temperature for 3min to obtain a terminated system; respectively detecting the light absorption values of an initial system and a termination system at 470nm by using a spectrophotometer, wherein the light absorption value of the termination system-the light absorption value of the initial system is an absorbance difference value; peroxidase enzyme activity ═ absorbance difference ÷ (total protein content × reaction time), total protein units are mg, reaction time units are min.

Example 1 discovery and characterization of peroxidase CsGPX1 protein and CsSPX1 protein

The tea variety Shucha Zao is called Shucha Zao for short. According to the invention, through transcriptome data analysis of tea trees, prokaryotic expression and functional verification are combined, two oxidases capable of catalyzing catechin compounds to synthesize theaflavin are found from Shucha, have activities of peroxidase and polyphenol oxidase and are respectively named CsGPX1 protein and CsSPX1 protein, and amino acid sequences are respectively shown in SEQ ID No.1 and SEQ ID No. 2. The gene for coding the CsGPX1 protein is named as CsGPX1 gene, and the open reading frame is shown in SEQ ID NO. 3; the gene coding the protein CsSPX1 is named as CsSPX1 gene, and the open reading frame is shown in SEQ ID NO. 4. Blastn and blastp analyses were performed at tea plant sites http:// teaplan. org/CsGPX 1 protein and CsSPX1 protein, respectively, with DNA and protein sequence alignments of 99% and 100%, respectively.

Example 2 changes in peroxidase and Polyphenol oxidase Activity, Catechin content, and Gene expression during Black tea/Green tea manufacturing

Obtaining of each sample

The preparation process of the green tea mainly comprises the steps of picking, spreading, deactivating enzymes, rolling and drying. The method specifically comprises the following steps: picking one bud and one leaf of Shucha early plant (in this case, a fresh leaf sample); spreading at room temperature for about 3h (spreading the sample after completion); deactivating enzyme at 180 deg.C for 3-5min (completing the sample); kneading into a certain shape by hand (kneading sample after completion); drying at 110 ℃ for about 15min (drying samples after completion).

The preparation process of the black tea mainly comprises the steps of picking, withering, rolling, fermenting and drying. The method specifically comprises the following steps: picking one bud and one leaf of Shucha early plant (in this case, a fresh leaf sample); spreading at room temperature for about 16h (withering sample after completion); firstly, lightly kneading tea leaves into a spherical shape, then heavily kneading and lightly kneading (a kneading sample is obtained after the completion); wrapping the tea leaves with gauze, fermenting at 30 deg.C for 12h (fermentation sample after completion), dispersing every 2h during fermentation period, and continuing fermentation; drying at 110 ℃ for about 15min (drying samples after completion).

II, enzyme activity

And (3) taking each sample obtained in the step one, and performing protein extraction by a conventional method to obtain a protein extraction solution containing total protein. And (3) taking the protein extraction solution or a diluent thereof (diluted by a potassium phosphate buffer solution with the pH value of 6.0 and the pH value of 0.1M) as a sample to be detected, detecting the enzymatic activity of the polyphenol oxidase and the enzymatic activity of the peroxidase, and calculating to obtain the enzymatic activity of the polyphenol oxidase and the enzymatic activity of the peroxidase of the total protein.

The results of polyphenol oxidase enzyme activity and peroxidase enzyme activity of the total protein of each sample are shown in FIG. 1. In FIG. 1, the right picture is a photograph of the termination system, and the left picture is data on enzyme activity. During the processing of black tea, the POD/PPO activity reaches the highest in the fermentation stage. During green tea processing, deactivation of enzymes leads to a sharp decrease in PPO activity.

Content of catechin compounds

And (4) taking each sample obtained in the step one, and respectively detecting the content of the catechin compounds.

The method for detecting the content of the catechin compounds comprises the following steps:

adding 0.1g of sample into 1.5mL of 80% (volume ratio) methanol aqueous solution, performing vortex oscillation, fully and uniformly mixing, performing ultrasonic treatment in an ice bath for 30min, centrifuging at 13000rpm for 30min, filtering by using a filter screen with a pore diameter of 0.22 mu m, and collecting filtrate;

taking the filtrate, and detecting by HPLC (the parameters are the same as those in the HPLC detection in the sixth step of the example 6, and the sample amount is 15 mu L); the standard substances are respectively: GC. EGC, C, EGCG, EC, GCG, ECG. Under the same chromatographic conditions, the peak with the peak position within +/-0.5 min of the standard substance is judged to be the same substance. Under the same chromatographic condition, a standard curve of the content of the standard substance and the peak area is prepared, and the concentration of each theanine compound in the sample (how many mu g of catechin compound is contained in each mg sample) is obtained by calculating through contrasting the standard curve.

The results are shown in FIG. 2. During the processing of black tea, the content of each theaflavin compound is reduced, which indicates that most catechin compounds generate theaflavin compounds during the processing. During the green tea processing, the content of each theaflavin compound is not obviously changed.

Expression levels of CsGPX1 Gene and CsSPX1 Gene

And (3) taking each sample obtained in the first step, and respectively detecting the expression quantity of the CsGPX1 gene and the CsSPX1 gene (extracting total RNA and performing reverse transcription to obtain cDNA, adopting the CsACTIN gene as an internal reference gene, and adopting real-time quantitative PCR to detect the relative level of the CsGPX1 gene and the CsSPX1 gene.

Primer pairs for detecting the CsGPX1 gene and the CsSPX1 gene were as follows:

upstream primer (CsGPX1 qF): AGGTGGACTTCTTGGGGACA, SEQ ID NO. 5;

downstream primer (CsGPX1 qR): GAGAAGTCGTGGGAGCAT, SEQ ID NO. 6.

Upstream primer (CsSPX1 qF): GAGGAATGACAGGGGCACAC, SEQ ID NO. 7;

downstream primer (CsSPX1 qR): GTGCCAGTGAGAGGGTTGTT, SEQ ID NO. 8.

The results are shown in FIG. 3. The results show that: the expression of the CsGPX1 gene in the rolled leaves in the black tea processing process is increased by 18 percent compared with that in the fresh leaves; while the expression of the CsSPX1 gene in the fermented leaves was increased 3.4-fold compared to that in the withered leaves. The expression of CsGPX1 gene is almost unchanged compared with that in fresh leaves in the green tea processing process, while the expression of CsSPX1 gene in the green-removing leaves is increased by 5.6 times compared with that in the fresh leaves. The two genes are involved in the processing process of black tea and green tea.

Example 3 expression differences of CsGPX1 Gene and CsSPX1 Gene in different tissues of Shuchazao

Respectively picking the roots, stems, flowers, fruits, buds, one leaf, two leaves and three leaves of Shucha early plants. The expression levels of the CsGPX1 gene and the CsSPX1 gene in each sample were determined (by high-throughput sequencing).

The results are shown in FIG. 4. The CsGPX1 gene and the CsSPX1 gene have expression difference in different tissues of Shuchazao plants, and the CsGPX1 gene has the highest expression quantity in three leaves used for making tea. The basal expression level of the CsSPX1 gene was high.

Example 4 comparison of enzyme activities of different tea varieties

One leaf and three leaves of each tea plant variety are respectively picked (the one leaf and the three leaves are mixed to be used as a sample).

And (2) carrying out protein extraction on each sample to obtain a protein extraction solution containing the total protein, taking the protein extraction solution or a diluent thereof (diluted by a potassium phosphate buffer solution with the pH value of 6.0 and the pH value of 0.1M) as a sample to be detected, detecting the enzymatic activity of the polyphenol oxidase and the enzymatic activity of peroxidase, and calculating to obtain the enzymatic activity of the polyphenol oxidase and the enzymatic activity of peroxidase of the total protein.

The results are shown in FIG. 5. The difference between the POD/PPO activity of tea varieties suitable for making black tea and tea varieties suitable for making green tea is large. Indicating that POD/PPO activity is critical for the tea variety to determine which tea is suitable for making.

Example 5 expression differences between CsGPX1 Gene and CsSPX1 Gene in different tea plant varieties

One leaf and three leaves of each tea plant variety are respectively picked (the one leaf and the three leaves are mixed to be used as a sample). The expression levels of the CsGPX1 gene and the CsSPX1 gene in each sample were detected (by high-throughput sequencing).

The results are shown in FIG. 6. The expression difference of the CsGPX1 gene and the CsSPX1 gene in different typical tea plant varieties suitable for black tea and green tea is large. Therefore, the CsGPX1 gene and the CsSPX1 gene play a key role in determining that the tea plant variety is suitable for being used as green tea or black tea in different tea plant varieties.

Example 6 purification and functional validation of CsGPX1 protein and CsSPX1 protein

Construction of recombinant plasmid

1. Taking Shuchazao leaves, extracting total RNA by a conventional method, and carrying out reverse transcription to obtain cDNA.

2. And (3) carrying out PCR amplification by using the cDNA obtained in the step (1) as a template and adopting a primer pair consisting of F1 and R1.

CsGPX1F：CGGATCCATGTATCTCTGTTCTTGTTCAG，SEQ ID NO.9；

CsGPX1R：TGTCGACTCACAACTCAGAACTTAAGCG，SEQ ID NO.10。

CsSPX1F:CGGATCCATGGGTTCCAAAGCTCTCTTC，SEQ ID NO.11；

CsSPX1R:AGTCGACCTAGTGGTGCTTGTTGGCAAC，SEQ ID NO.12；

3. And (3) taking the PCR amplification product obtained in the step (2), carrying out double enzyme digestion by using restriction enzymes BamH I and Sal I, and recovering the enzyme digestion product.

4. Taking pET-28a (+) vector, carrying out double enzyme digestion by using restriction enzymes BamH I and Sal I, and recovering the vector skeleton.

5. And (4) connecting the enzyme digestion product in the step (3) with the vector skeleton in the step (4) to obtain the recombinant plasmid. According to the sequencing results, the recombinant plasmid was structurally described as follows: double-stranded DNA molecules shown as SEQ ID NO.3 and SEQ ID NO.4 of the sequence list are inserted between BamHI and SalI cleavage sites of the pET-28a (+) vector. The recombinant plasmid has fusion genes shown in SEQ ID NO.3 and SEQ ID NO.4 of a sequence table. The fusion protein is also called CsGPX1 protein and CsSPX1 protein with 6 × His label.

Secondly, preparing recombinant bacteria

And (3) introducing the recombinant plasmid constructed in the step one into escherichia coli BL21(DE3) by a heat shock transformation method to obtain recombinant bacteria A and B.

The pET-28a (+) vector was introduced into E.coli BL21(DE3) to obtain recombinant C.

Expression and purification of target protein

1. Inoculating the recombinant strain into liquid LB culture medium containing 50mg/L kanamycin, and performing shaking culture at 37 ℃ and 180rpm until OD is reached_600nm＝0.6。

2. After completion of step 1, IPTG was added to the system so that the concentration thereof in the system became 0.5mmol/L, and 16 ℃ was cultured with shaking at 180rpm for 16 hours.

3. After completion of step 2, centrifugation was carried out at 12000rpm for 10min, and the pellet was collected.

4. And (3) taking the thallus precipitate obtained in the step (3), suspending the thallus precipitate by using a lysis buffer solution, carrying out ultrasonic disruption in an ice bath (300W, stopping 4s per 3s of ultrasonic disruption, 100 times), then centrifuging the thallus precipitate for 30min at 10000rpm, and collecting the precipitate and a supernatant.

Lysis buffer: from 25mL of 1M aqueous Tris solution, 30mL of 5M aqueous NaCl solution and 945mL of ddH₂And (C) O.

5. And (4) taking the supernatant obtained in the step (4), purifying by using Ni-NTA agar, washing by using Wash Buffer in the purification process to remove foreign proteins, and washing by using Elution Buffer to collect target proteins to obtain a protein solution.

Wash Buffer: from 25mL of 1M aqueous Tris solution, 30mL of 5M aqueous NaCl solution, 3mL of 5M aqueous imidazole solution and 942mL of ddH₂And (C) O.

Elution Buffer: from 25mL of 1M aqueous Tris solution, 20mL of 5M aqueous imidazole solution and 955mL of ddH₂And (C) O.

The recombinant bacterium A is adopted to carry out the steps, and the obtained protein solution is named as CsGPX1 protein solution.

And (3) carrying out the steps by adopting the recombinant bacterium B, and obtaining a protein solution named as CsSPX1 protein solution.

The recombinant bacterium C is adopted to carry out the steps, and the obtained protein solution is named as a control solution.

Respectively taking the recombinant bacterium A and the recombinant bacterium B to perform polyacrylamide gel electrophoresis on the following samples in the process of the steps: the supernatant sample collected after completion of step 1 (sample 1), the supernatant sample collected after completion of step 2 (sample 2), the pellet collected at step 4 (sample 3), and the CsGPX1 protein and CsSPX1 protein solutions obtained at step 5 (sample 4). The electrophoretogram is shown in FIG. 7.

Fourthly, enzyme activity detection

And taking the CsGPX1 protein and CsSPX1 protein solution or the reference solution prepared in the fourth step as a sample to be detected, detecting the enzymatic activity of the polyphenol oxidase and the enzymatic activity of the peroxidase, and calculating to obtain the enzymatic activity of the polyphenol oxidase and the enzymatic activity of the peroxidase of the total protein.

The photograph of the termination system is shown on the left of FIG. 8, and the results of enzyme activity are shown on the right of FIG. 8.

The polyphenol oxidase enzyme activities of the CsGPX1 protein and the CsSPX1 protein with 6 XHis tags are respectively 24.58 absorbance difference/(mg protein x min) and 44.44 absorbance difference/(mg protein x min).

Peroxidase enzyme activities of the CsGPX1 protein and the CsSPX1 protein with 6 XHis tags were 12.29 and 33.22 absorbance difference/(mg protein × min), respectively.

The polyphenol oxidase enzyme activity of the control solution was 0 absorbance difference/(mg protein × min).

The peroxidase enzyme activity of the control solution was 0 absorbance difference/(mg protein × min).

Fifth, detection of enzymological Properties

Peroxidase enzyme activity determination method (colorimetric method): the reaction system is 1 mL; the initial system consists of 50 mu L of a sample to be tested (providing protein), guaiacol (serving as a substrate), 30% hydrogen peroxide solution and 0.1mM phosphate buffer, wherein the concentration of the guaiacol is 0.56 mu L/mL, and the concentration of the hydrogen peroxide is 0.38 mu L/mL; standing the initial system for reaction for 3min to obtain a termination system; respectively detecting the light absorption values of an initial system and a termination system at 470nm by using a spectrophotometer, wherein the light absorption value of the termination system-the light absorption value of the initial system is an absorbance difference value; peroxidase enzyme activity ═ absorbance difference ÷ (total protein content × reaction time), total protein units are mg, reaction time units are min.

The following pH was used for the phosphate buffer: pH6.0, 6.5, 7.0, 7.5, 8.0. The reaction temperature was room temperature. The results are shown in FIG. 9.

The following reaction temperatures were used: 30. 40, 50, 60, 70 or 80 ℃. The phosphate buffer was used at pH 6.0. The results are shown in FIG. 9.

The results show that CsGPX1 is most active at pH6.0 and temperature 50 ℃; whereas CsSPX1 was most active at pH8.0 and temperature 80 ℃.

Sixth, capability of preparing theaflavin compound

Reaction system (100 μ L): EC and EGC were added to a disodium hydrogen phosphate-citric acid buffer solution at pH8.0 so that their concentrations were 1mM each, followed by addition of the CsGPX1 protein and CsSPX1 protein solutions prepared in step three (total protein content 30. mu.g) and 1. mu.L of 30% hydrogen peroxide solution. A control system was set up in which the CsGPX1 protein and CsSPX1 protein solutions were replaced with an equal volume of control solution.

Reaction conditions are as follows: standing and reacting for 10min at room temperature.

The photograph of the reaction end point is shown in FIG. 10.

After the reaction is finished, filtering by using a filter screen with the aperture of 0.22 mu m, and collecting filtrate. The filtrate was subjected to HPLC detection and LC-MS detection, respectively.

HPLC detection parameters: waters e2695 high performance liquid chromatography, 2489 ultraviolet visible detector, Empower2 chromatographic work station, the chromatographic column is Phenomenex Gemini 5 mu m C18250 multiplied by 4.6 mm; the sample injection amount is 10 mu L; the mobile phase comprises phase A (0.2% acetic acid aqueous solution) and phase B (pure methanol), and the flow rate of the mobile phase is 1 mL/min. The elution process is shown in Table 2. The standard substance is epicatechin standard substance or theaflavin standard substance. Under the same chromatographic condition, the peak within +/-1 min of the peak position of the standard substance is judged to be the same substance. And (3) under the same chromatographic condition, making a standard curve of the content of the standard substance and the peak area, and obtaining the concentration of the corresponding compound in the system after the reaction is finished by comparing the standard curve and calculating.

TABLE 2

Time (min)	A％	B％
				0	5	95
2	5	95
			14	20	80
20	25	75
			22	42	58
28	42	58
			31	100	0
35	100	0
			38	5	95

The ratio of phases A and B at different times is shown in Table 2, and the elution is in fact a dynamic process, for example from 0 to 14min, described below: the volume fraction of phase A in the mobile phase was 5% during 0-2min (corresponding to a volume fraction of phase B in the mobile phase of 95%), and the volume fraction of phase A in the mobile phase increased linearly from 5% to 20% during 2-14min (corresponding to a linear decrease from 95% to 80% in the volume fraction of phase B in the mobile phase).

LC-MS detection parameters: agilent Technologies 1290Infinity liquid chromatography System, Mass Spectroscopy Detector (Model # G6545A, Serial # SG1637E002, made in Singapore), column Hypersil Gold column (2.1X 100mm, particle size of1.9 μm, Thermo Scientific); the mobile phase is A phase (aqueous solution containing 1% acetonitrile and 0.1% acetic acid,% represents volume ratio), B phase (acetonitrile solution containing 0.1% acetic acid,% represents volume ratio), and the flow rate of the mobile phase is 0.2 mL/min; the elution procedure was as follows: 0-1min, keeping the volume fraction of the B phase in the mobile phase at 5%; 1-12min, the volume fraction of the B phase in the mobile phase is linearly increased from 5% to 50%; the volume fraction of the phase B in the mobile phase is increased linearly to 100 percent within 12-13 min; 13-18min, keeping the volume fraction of the phase B in the mobile phase at 100%; for 18-18.1min, the volume fraction of the B phase in the mobile phase is linearly reduced from 100 percent to 5 percent; and the volume fraction of the phase B in the mobile phase is kept at 5 percent for 18.1-22 min.

The chromatogram for HPLC detection (369nm chromatogram) is shown in FIG. 11. At the end of the reaction, the results of epicatechin concentration in the reaction system are shown in FIG. 12, and the results of theaflavin concentration in the reaction system are shown in FIG. 12.

The results of LC-MS are shown in FIG. 13. The results indicate that the CsGPX1 protein and the CsSPX1 protein can indeed catalyze theaflavin production.

Example 7 reduction of theaflavin content by inhibiting CsGPX1 Gene and CsSPX1 Gene expression

One bud and one leaf of Shucha early plant, 60 samples of similar size were picked. The 60 samples were randomly divided into two groups of 30 samples each.

A first group: immersed in 80mM sucrose aqueous solution for 96 hours at room temperature;

second group: immersing in an aqueous solution containing 700. mu.M CsGPX1 gene antisense nucleic acid and 80mM sucrose for 96 hours at room temperature;

third group: immersing in an aqueous solution containing 700. mu.M of antisense nucleic acid of the CsSPX1 gene and 80mM of sucrose at room temperature for 96 hours;

antisense nucleic acid:

>asODNCsGPX1-1

GCTTTGGTACGCTTAGGTTT，SEQ ID NO.13；

>asODNCsGPX1-2

TGGGGCTTCTGGGATTGGCT，SEQ ID NO.14；

>asODNCsGPX1-3

ATATGGGGAATTCAGCCTTA，SEQ ID NO.15；

>asODNCsSPX1-1

CAGCTTCTTTGATGGTGTCA，SEQ ID NO.16；

>asODNCsSPX1-2

TGCTCTCATTGTGATCTGGT，SEQ ID NO.17；

>asODNCsSPX1-3

CCCTGTCATTCCTCACATAT，SEQ ID NO.18。

antisense nucleic acids are single-stranded DNA molecules, and are synthesized by the company.

After completion of the treatment, the expression amounts of the CsGPX1 gene and the CsSPX1 gene in the sample were measured in the same manner as in step four of example 2. The results showed that the expression levels of CsGPX1 gene and CsSPX1 gene were significantly reduced in the second and third set of treated samples compared to the first set of treated samples.

After the treatment is finished, taking out the sample, and sequentially carrying out the following operations: absorbing surface water, spreading at room temperature for about 16h, kneading tea leaves into balls, kneading, wrapping the tea leaves with gauze, fermenting at 30 deg.C for 12h (dispersing every 2h during fermentation, and continuing fermentation), and drying at 110 deg.C for about 15min to obtain dried sample; then taking 0.1g of a dry sample, adding the dry sample into 1.5mL of 80% (volume ratio) methanol aqueous solution, carrying out vortex oscillation, fully and uniformly mixing, carrying out ultrasonic treatment in an ice bath for 30min, then carrying out centrifugation at 13000rpm for 30min, filtering by using a filter screen with a pore diameter of 0.22 mu m, and collecting filtrate; taking the filtrate, and detecting by HPLC (the parameters are the same as those in the HPLC detection in the sixth step of the example 6, and the sample amount is 15 mu L); and (3) judging that the standard substance is TF, determining that the peak within +/-0.5 min of the peak position of the standard substance and the peak position of the standard substance under the same chromatographic condition is the same substance, making a standard curve of the content of the standard substance and the peak area under the same chromatographic condition, and obtaining the concentration of TF (how much mu g of TF is contained in each g of dry sample) in the dry sample by comparing the standard curve and calculating. The results are shown in FIG. 14. The TF concentration was significantly reduced in the second and third set of dried samples compared to the first set of dried samples.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> agriculture university of Anhui

<120> oxidase, DNA molecule encoding oxidase and use thereof

<140> 202010407545X

<141> 2020-05-14

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 250

<212> PRT

<213> oxidase (CsGPX1)

<400> 1

Met Tyr Leu Cys Ser Cys Ser Val Ser Phe Pro Ile Arg Thr Asn Leu

1 5 10 15

Ser Val Pro Lys Gln Phe Ser Arg Leu Leu Lys Arg Thr His Phe Asp

20 25 30

Phe Leu Arg Asn Ser Ser Ile Pro Leu Leu Tyr Ser Pro Leu Lys Ala

35 40 45

Glu Ile Ser Cys Gly Ser Ser Ser Phe Arg Ile Tyr Gln Ser Asn Asn

50 55 60

Ala Ser Ser Thr Thr Arg Pro Val Leu Cys Ser Leu Arg Ser Glu His

65 70 75 80

Thr Met Ala Ser Gln Ser Gln Lys Pro Gln Ser Val His Glu Leu Thr

85 90 95

Val Lys Asp Val Lys Gly Asn Asp Val Asp Leu Ser Met Tyr Lys Gly

100 105 110

Lys Val Leu Leu Ile Val Asn Val Ala Ser Gln Cys Gly Leu Thr Asn

115 120 125

Ser Asn Tyr Thr Glu Leu Ser Lys Leu Tyr Glu Gln Tyr Lys Asp Lys

130 135 140

Gly Leu Glu Ile Leu Ala Phe Pro Cys Asn Gln Phe Gly Glu Gln Glu

145 150 155 160

Pro Gly Asn Asn Asp Gln Ile Leu Glu Phe Ala Cys Thr Arg Phe Lys

165 170 175

Ala Glu Phe Pro Ile Phe Asp Lys Val Asp Val Asn Gly Asp Asn Ala

180 185 190

Ala Pro Leu Tyr Lys Phe Leu Lys Ser Ser Lys Gly Gly Leu Leu Gly

195 200 205

Asp Ser Ile Lys Trp Asn Phe Ser Lys Phe Leu Val Asp Lys Glu Gly

210 215 220

Asn Val Val Asp Arg Tyr Ala Pro Thr Thr Ser Pro Leu Ser Ile Glu

225 230 235 240

Lys Asp Ile Lys Lys Leu Leu Gly Ser Ala

245 250

<210> 2

<211> 333

<212> PRT

<213> oxidase (CsSPX1)

<400> 2

Met Gly Ser Lys Ala Leu Phe Phe Phe Phe Ala Ile Phe Ser Phe Ser

1 5 10 15

Leu Val Thr Ser Ala Phe Ala Glu Asn Glu Glu Ala Asn Asp Pro Ala

20 25 30

Gly Leu Val Met Asn Phe Tyr Lys Asp Ser Cys Pro Gln Ala Glu Asp

35 40 45

Ile Ile Lys Glu Gln Val Lys Leu Leu Tyr Lys Arg His Lys Asn Thr

50 55 60

Ala Phe Ser Trp Leu Arg Asn Ile Phe His Asp Cys Ala Val Gln Ser

65 70 75 80

Cys Asp Ala Ser Leu Leu Leu Asp Ser Thr Arg Arg Ser Leu Ser Glu

85 90 95

Lys Glu Thr Asp Arg Ser Phe Gly Leu Arg Asn Phe Arg Tyr Leu Asp

100 105 110

Thr Ile Lys Glu Ala Val Glu Arg Glu Cys Pro Gly Val Val Ser Cys

115 120 125

Ala Asp Ile Leu Val Leu Ser Gly Arg Asp Gly Ile Val Ser Leu Gly

130 135 140

Gly Pro Tyr Ile Pro Leu Lys Thr Gly Arg Arg Asp Gly Arg Lys Ser

145 150 155 160

Arg Ala Glu Val Leu Glu Gln Tyr Leu Pro Asp His Asn Glu Ser Met

165 170 175

Ser Val Val Leu Glu Arg Phe Gly Ser Ile Gly Ile Asp Thr Pro Gly

180 185 190

Val Val Ala Leu Leu Gly Ala His Ser Val Gly Arg Thr His Cys Val

195 200 205

Lys Leu Val His Arg Leu Tyr Pro Glu Val Asp Pro Val Leu Asn Pro

210 215 220

Asp His Val Glu His Met Leu His Lys Cys Pro Asp Ser Ile Pro Asp

225 230 235 240

Pro Lys Ala Val Gln Tyr Val Arg Asn Asp Arg Gly Thr Pro Met Val

245 250 255

Leu Asp Asn Asn Tyr Tyr Arg Asn Ile Leu Asp Asn Lys Gly Leu Leu

260 265 270

Ile Val Asp His Gln Leu Ala Thr Asp Lys Arg Thr Lys Pro Tyr Val

275 280 285

Lys Lys Met Ala Lys Ser Gln Asp Tyr Phe Phe Lys Glu Phe Gly Arg

290 295 300

Ala Ile Thr Ile Leu Ser Glu Asn Asn Pro Leu Thr Gly Thr Gln Gly

305 310 315 320

Glu Ile Arg Leu Gln Cys Asn Val Ala Asn Lys His His

325 330

<210> 3

<211> 753

<212> DNA

<213> oxidase (CsGPX1)

<400> 3

atgtatctct gttcttgttc agttagcttc ccgatccgaa caaacctaag cgtaccaaag 60

caattctctc gtcttctcaa gcgaacccat ttcgattttc ttcgcaattc ttcaattcct 120

ttgctctatt cgcccttgaa agcagagatt tcttgtgggt catcatcatt tcgtatatat 180

cagagcaaca acgcttcttc aacaacaagg cctgtgctgt gtagtttgag atcggaacat 240

acaatggcta gccaatccca gaagccccaa tctgtccatg agctcaccgt caaggatgtt 300

aaaggaaatg atgtggatct tagcatgtac aaggggaagg tcctactgat tgtaaatgtc 360

gcatcacaat gcggcttgac caattcgaat tacacagagt tgagcaaatt atatgaacag 420

tacaaagata aaggtctgga gattctggca ttcccatgca atcagtttgg tgagcaggag 480

ccagggaata atgaccagat tttggagttt gcttgcactc gctttaaggc tgaattcccc 540

atatttgata aggttgatgt gaatggtgat aatgctgctc cactatacaa gttcctgaag 600

tcaagcaaag gtggacttct tggggacagc attaagtgga atttctctaa attcttggtt 660

gataaagaag gaaatgttgt cgatcgctat gctcccacga cttctcctct tagtatcgag 720

aaggatatca agaaacttct gggaagcgct taa 753

<210> 4

<211> 1002

<212> DNA

<213> oxidase (CsSPX1)

<400> 4

atgggttcca aagctctctt ctttttcttt gccatctttt ctttctcact agtaacatca 60

gcttttgcag aaaatgaaga agctaatgac ccagcaggtc ttgttatgaa cttctacaaa 120

gattcatgtc ctcaagctga agacatcatc aaagaacaag ttaagcttct ctacaagcgc 180

cacaagaaca ctgctttctc ttggctcaga aacatcttcc atgactgtgc tgttcagtca 240

tgtgatgctt cactactgct ggactcaaca agaaggagct tatctgagaa ggaaactgac 300

aggagctttg gactgaggaa ctttaggtac cttgacacca tcaaagaagc tgtggagaga 360

gagtgccctg gagttgtttc ttgtgcagat atccttgttt tgtctggtag agatggcatt 420

gtttcgcttg gagggcctta catccctcta aagaccggaa gaagagatgg gaggaagagc 480

agagcagaag tgctagagca atacctacca gatcacaatg agagcatgtc agttgtacta 540

gagaggtttg gatctattgg tattgacacc cccggagttg ttgccttgct aggtgctcac 600

agtgtgggtc gaacccactg tgtcaaattg gttcaccgat tgtacccaga ggtggaccct 660

gtgcttaacc ctgaccatgt tgagcacatg ctccacaagt gcccggactc gatccccgac 720

ccgaaagcag tccaatatgt gaggaatgac aggggcacac ccatggtact agacaacaac 780

tactacagaa acatattgga caacaaaggg ttgttgatag tggatcacca actagccaca 840

gacaagagga ctaagcctta cgtgaagaaa atggcaaaga gccaagacta cttcttcaag 900

gagtttggaa gagccatcac tattctgtct gagaacaacc ctctcactgg cactcagggt 960

gagatcagat tgcaatgcaa tgttgccaac aagcaccact ag 1002

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (CsGPX1qF)

<400> 5

aggtggactt cttggggaca 20

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence (CsGPX1qR)

<400> 6

gagaagtcgt gggagcat 18

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (CsSPX1qF)

<400> 7

gaggaatgac aggggcacac 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (CsSPX1qR)

<400> 8

gtgccagtga gagggttgtt 20

<210> 9

<211> 29

<212> DNA

<213> Artificial sequence (CsGPX1F)

<400> 9

cggatccatg tatctctgtt cttgttcag 29

<210> 10

<211> 28

<212> DNA

<213> Artificial sequence (CsGPX1R)

<400> 10

tgtcgactca caactcagaa cttaagcg 28

<210> 11

<211> 28

<212> DNA

<213> Artificial sequence (CsSPX1F)

<400> 11

cggatccatg ggttccaaag ctctcttc 28

<210> 12

<211> 28

<212> DNA

<213> Artificial sequence (CsSPX1R)

<400> 12

agtcgaccta gtggtgcttg ttggcaac 28

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (asODNCsGPX1-1)

<400> 13

gctttggtac gcttaggttt 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (asODNCsGPX1-2)

<400> 14

tggggcttct gggattggct 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (asODNCsGPX1-3)

<400> 15

atatggggaa ttcagcctta 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence (asODNCsSPX1-1)

<400> 16

cagcttcttt gatggtgtca 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (asODNCsSPX1-2)

<400> 17

tgctctcatt gtgatctggt 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence (asODNCsSPX1-3)

<400> 18

ccctgtcatt cctcacatat 20

Claims

1. An oxidase is used for regulating theaflavin compound content in tea or as marker for screening tea variety suitable for making green tea and/or tea variety suitable for making black tea; the amino acid sequence of the oxidase is shown in SEQ ID NO.1 or SEQ ID NO. 2.

2. The application of DNA molecule for coding oxidase in regulating theaflavin compound content in tea, or as marker for screening tea variety suitable for making green tea and/or tea variety suitable for making black tea; the DNA molecule for coding the oxidase comprises a nucleotide sequence SEQ ID NO.3 for coding the oxidase with a sequence shown in SEQ ID NO.1 or a nucleotide sequence SEQ ID NO.4 for coding the oxidase with a sequence shown in SEQ ID NO. 2.