CN111575259B - Ester type catechin synthetase, coding gene and application thereof - Google Patents

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to an ester type catechin synthase, a coding gene and application thereof. The invention obtains recombinant protein by constructing recombinant engineering bacteria, and verifies the genes of coding serine carboxypeptidase acyltransferase CsSCPL11-IA, CsSCPL13-IA and CsSCPL14-IA in tea trees by using the recombinant protein of the genetic engineering bacteria as catalytic enzyme by an enzyme reaction method. The invention describes three acetyltransferase genes capable of catalyzing the synthesis of ester catechin for the first time and application values of the acetyltransferase genes in the breeding of excellent tea varieties and the processing of tea.

Description

Ester type catechin synthetase, coding gene and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to an ester type catechin synthase, a coding gene and application thereof.

Background

Tea polyphenol is a natural polyphenol compound extracted from tea leaves, accounts for about 25% of the dry weight of the tea, is a general name of more than 30 polyphenol compounds in the tea leaves, has wide medicinal value and is one of the main medicinal components of the tea. The catechins are one of the main components of tea polyphenol, and account for 50-70% of the total weight of the tea polyphenol. The catechins in tea leaves contain a number of components, mainly classified into ester-type and non-ester-type catechins. Non-ester catechins include catechin (C, (+) -catechin), epicatechin (EC, (-) -epicatechin), catechin gallate (GC, (+) -gallocatehin, and catechin epicatechin (EGC, (-) -epigallocatehin), ester catechins include epicatechin gallate (ECG, (-) -epicatechin-3-gallate) and epigallocatechin gallate (EGCG, (-) -epigallocatechin-3-gallate), wherein ester catechins account for the majority, around 75%, contributing to the bitter and astringent taste, astringency, and refreshing taste of tea soup.

The health care and medicinal functions of tea are continuously proved, and in recent decades, the pharmacological function mechanism of tea is gradually revealed, so people can understand tea more deeply. Catechins have high medicinal value, including antitumor effect, antioxidant effect, cardiovascular system regulating effect, antibacterial and antiviral effect, and radioprotective effect. Among them, it has been found that the antioxidant effect can effectively inhibit the oxidation of animal and vegetable oils such as lard, cream, etc., and has significant antioxidant effect on various foods such as fried food, instant noodles, aquatic products, etc., and simultaneously, the antioxidant effect can stimulate fat metabolism in liver, increase bile acid excretion, accelerate cholesterol metabolism in vivo, and achieve the effect of losing weight.

C3 of C ring of flavantriol (catechin) has hydroxyl group, and is easily catalyzed by enzyme, and can be esterified with phenolic acid such as gallic acid to form gallate. Therefore, non-ester monomeric catechins such as EC, C, GC, EGC, etc. form their gallic acid esters. Although it is known that there are generally two types of enzymes that catalyze the esterification of such organic acids with flavonoids such as flavantriols: BAHD and SCPL family of enzymes, but since their respective families include many members, the mechanism of formation of catechin gallates in tea plant has not been established to date.

Disclosure of Invention

The invention provides an ester type catechin synthetase, a coding gene and application thereof, aiming at solving part of problems in the prior art or at least relieving part of problems in the prior art.

The invention is realized in such a way that an ester type catechin synthase CsSCPL11-IA has an amino acid sequence shown in SEQ ID NO.2, or has an amino acid sequence with the same protein function after the substitution and/or deletion and/or addition of a plurality of amino acid residues of the sequence shown in SEQ ID NO. 2; or derived from the amino acid sequence shown in SEQ ID NO.2, has more than 98 percent of homology and has the same protein function.

Further, the nucleotide sequence of the gene of the ester type catechin synthetase is shown in SEQ ID NO.1, or a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.1 and encodes the protein with the same function; or DNA molecule which has more than 90% of homology with the DNA sequence limited by SEQ ID NO.1 and codes the same functional protein.

The invention also discloses an ester type catechin synthase CsSCPL13-IA, the amino acid sequence is shown in SEQ ID NO.4, or the sequence shown by SEQ ID NO.4 is subjected to substitution and/or deletion and/or addition of a plurality of amino acid residues, and the amino acid sequences have the same protein function; or an amino acid sequence which is derived from the amino acid sequence shown in SEQ ID NO.4, has more than 98 percent of homology and has the same protein function.

Further, the nucleotide sequence of the gene of the ester type catechin synthetase is shown in SEQ ID NO.3, or a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.3 and encodes the protein with the same function; or DNA molecule which has more than 90% of homology with the DNA sequence limited by SEQ ID NO.3 and codes the same functional protein.

The invention also discloses an ester type catechin synthase CsSCPL14-IA, the amino acid sequence is shown in SEQ ID NO.6, or the sequence shown by SEQ ID NO.6 is subjected to substitution and/or deletion and/or addition of a plurality of amino acid residues, and the amino acid sequences have the same protein function; or an amino acid sequence which is derived from the amino acid sequence shown in SEQ ID NO.6, has more than 98 percent of homology and has the same protein function.

Further, the nucleotide sequence of the gene of the ester type catechin synthetase is shown in SEQ ID NO.5, or a DNA sequence which is hybridized with the DNA sequence limited by SEQ ID NO.5 and encodes the protein with the same function; or DNA molecule which has more than 90% of homology with the DNA sequence limited by SEQ ID NO.5 and codes the same functional protein.

The invention also discloses application of the ester-type catechin synthetase in serving as acyltransferase.

The invention also discloses application of the ester type catechin synthetase in the breeding of tea tree fine varieties.

The invention also discloses application of the ester type catechin synthetase in tea processing.

The invention also discloses application of the ester-type catechin synthetase in catalyzing conversion of EC into ECG and/or EGC into EGCG.

In summary, the advantages and positive effects of the invention are:

the invention describes three acetyltransferase genes capable of catalyzing the synthesis of ester catechin for the first time and application values of the acetyltransferase genes in the breeding of excellent tea varieties and the processing of tea.

The invention obtains recombinant protein by constructing recombinant engineering bacteria, and verifies the genes of coding serine carboxypeptidase acyltransferase CsSCPL11-IA, CsSCPL13-IA and CsSCPL14-IA in tea trees by using the recombinant protein of the genetic engineering bacteria as catalytic enzyme by an enzyme reaction method.

Drawings

FIG. 1 shows the results of tissue-specific expression of an ester-type catechin synthase gene;

FIG. 2 is an SDS-PAGE protein electrophoretic analysis diagram of the recombinant protein of the ester-type catechin synthase; wherein M represents Marker, C represents control (no IPTG), T represents total protein, P represents precipitate, and S represents supernatant;

FIG. 3 is a graph showing the results of HPLC analysis of the enzymatic activity products catalyzed by CsSCPL 11-IA;

FIG. 4 is the product analysis and identification of the ester-type catechin synthesis reaction catalyzed by CsSCPL11 recombinant protein;

FIG. 5 shows the ester catechin synthesis reaction catalyzed by CsSCPL13 recombinant protein;

FIG. 6 shows the analysis and identification of the product of ester catechin synthesis reaction catalyzed by CsSCPL13 recombinant protein;

FIG. 7 shows the ester catechin synthesis reaction catalyzed by CsSCPL14 recombinant protein;

FIG. 8 shows the product analysis and identification of the ester-type catechin synthesis reaction catalyzed by CsSCPL14 recombinant protein;

FIG. 9 is a schematic chemical structure of purified recombinase-catalyzed translation

FIG. 10 shows the results of changes in the expression levels of CsSCPL11-IA, CsSCPL13-IA and CsSCPL14-IA under different treatments;

FIG. 11 is a phylogenetic tree of CsSCPL11-IA, CsSCPL13-IA, and CsSCPL 14-IA;

FIG. 12 is a correlation analysis of the catechin, epicatechin, and gallate content thereof in tea plant tissue with the expression pattern of the CsSCPL family gene.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

The invention relates to three ester type catechin synthase genes and coding proteins thereof, which are respectively named as serine carboxypeptidase acylase CsSCPL11-IA, wherein the nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO. 2; serine carboxypeptidase acyltransferase CsSCPL13-IA, the nucleotide sequence of the gene is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO. 4; the nucleotide sequence of the serine carboxypeptidase acyltransferase CsSCPL14-IA gene is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO. 6.

Materials involved in embodiments of the invention include: tea tree species: shucha Zao (Camellia sinensis var. sinensis cv. Shuchazao), tea seed seedling germinated in vermiculite, greenhouse temperature controlled at 22 + -2 deg.C, collecting material, freezing with liquid nitrogen, and storing in-80 deg.C refrigerator for use. Coli: DH5 α, for gene cloning; rosetta, for protein induction. Vectors are well known in the art: carrier: pGEM-T Easy, pDONR221, pDEST 17. LB culture medium: weighing 10g of NaCl, 5g of yeast extract and 10g of tryptone, adding 950mL of ultrapure water, stirring and dissolving, adding water to a constant volume of 1000mL, and sterilizing for 15min by high-pressure steam to obtain an LB liquid culture medium, wherein the LB solid culture medium is obtained by adding 15g of agar powder into the LB liquid culture medium. Ampicillin mother liquor (Amp +, 50 mg/ml): weighing 0.5g ampicillin Amp, dissolving in 10mL sterile water, filtering, sterilizing, packaging into small tubes, and storing at-20 deg.C; kanamycin mother liquor (Kan +, 50 mg/ml): 0.5g kanamycin Kan is weighed, dissolved in 10mL sterile water, filtered and sterilized, and then subpackaged into small tubes to be preserved at-20 ℃. IPTG mother liquor (isopropylthio- β -D-galactoside, 1M): 2.383g of IPTG were weighed, dissolved in sterilized ultrapure water, adjusted to a constant volume of 10mL, sterilized by filtration, dispensed and stored at-20 ℃.

Examples cloning, expression and enzymatic Property detection of serine carboxypeptidase Acyltransferase genes

1. Cloning of the CsSCPL11-IA, CsSCPL13-IA and CsSCPL14-IA genes

The primer sequences of the three genes are shown below.

>CsSCPL11-IA-F

ATGTTTCCACCAAAGTCATA，SEQ ID NO.7；

>CsSCPL11-IA-R

CTAAATAGGATAGTAATGAA，SEQ ID NO.8；

>CsSCPL13-IA-F

ATGGTGCAAGTAGAAGCCAT，SEQ ID NO.9；

>CsSCPL13-IA-R

AACAGGATTATAATTAATCC，SEQ ID NO.10；

>CsSCPL14-IA-F

ATGGTGCAAGTAGAAGCCAT，SEQ ID NO.11；

>CsSCPL14-IA-R

CTAGGAGTGGTGAGTTAGGT，SEQ ID NO.12；

Extracting total RNA of the early tender leaves of the Shucha according to the instruction of a TIANGEN plant total RNA extraction kit and an M-MLV cDNA synthesis kit, and performing reverse transcription to obtain cDNA.

Using reverse transcription cDNA as a template, using a primer and TAKARA ExTaq polymerase to carry out amplification, wherein the amplification procedure comprises pre-denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 30s, extension at 68 ℃ for 2min, 35 cycles, and continuous extension at 68 ℃ for 5min, and the obtained PCR product is stored at 4 ℃. The PCR system was 50. mu.L, containing 0.5. mu.L of enzyme, 2. mu.L of LDNA template, 5. mu.L of buffer, 4. mu.L of dNTPs, 2.5. mu.L of each of the forward and reverse primers, and the remainder was filled with sterilized water.

After the PCR product is purified by a PCR purification kit, the PCR product is connected and transformed by a pGEM-T kit of Promega company to obtain a T vector containing the CsSCPL11-IA gene, and meanwhile, the bacterial liquid is sent to the company of Biotechnology engineering (Shanghai) for sequencing.

2. Prokaryotic expression of CsSCPL11-IA, CsSCPL13-IA and CsSCPL14-IA genes

The CsSCPL11-IA and CsSCPL14-IA delete the first 150bp (corresponding to the first 50 codons in the amino acid sequence) and insert ATG codon (corresponding to the 51 st M codon in the amino acid sequence), design specific primers with attB linker sequence, whose primer sequence is shown below, and PCR amplification and purification are performed using the single clone colony plasmid with correct PCR sequencing as a template. Storing at-20 deg.C.

>CsSCPL11-IA-F，SEQ ID NO.13；

GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAACTTCCCTTTAAACT

>CsSCPL11-IA-R，SEQ ID NO.14；

GGGGACCACTTTGTACAAGAAAGCTGGGTCTAAATAGGATAGTAATGAA

>CsSCPL13-IA-F，SEQ ID NO.15；

GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTGCAAGTAGAAGCCAT

>CsSCPL13-IA-R，SEQ ID NO.16；

GGGGACCACTTTGTACAAGAAAGCTGGGTAACAGGATTATAATTAATCC

>CsSCPL14-IA-F，SEQ ID NO.17；

GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAGCGTTGATGATTCGGA

>CsSCPL14-IA-R，SEQ ID NO.18；

GGGGACCACTTTGTACAAGAAAGCTGGGTCTAGGAGTGGTGAGTTAGGT

By using Gateway cloning technology, 1 μ L of the above PCR product, pDONR221 intermediate vector with the same mass as the PCR product, and finally 1 μ L of BP clone Mix were added, and DH5 α was transformed overnight at room temperature to verify positive clones, which was the same as in step 1.

Plasmid of positive clone with correct sequencing is extracted, 1 μ L is taken and added with pDEST17 overexpression vector with equal quantity, finally 1 μ L LR clone Mix is added, Rosetta is transformed after overnight at room temperature, and positive single clone is verified.

The overnight grown positive monoclonal was diluted in 300mL LB medium (1: 100) containing ampicillin (50. mu.g/mL) and placed in a shaker at 37 ℃. When OD is reached₆₀₀When 0.8 to 1.0 is reached, 0.2mM isopropyl 1-beta-D thiogalactose is addedGlycoside (IPTG) was added to the broth and transferred to a 25 ℃ shaker. After 10 hours of incubation, the bacterial fluid was collected, centrifuged at 12,000rpm for 30 minutes, and then resuspended in 20mL lysis buffer [200mM Tris-HCl (pH 8.0), 0.1% Triton X-100, and 5mM medium beta-mercaptoethanol]And left on ice for 1 h. The cells were then disrupted by sonication and centrifuged at 12,000rpm for 30 minutes at 4 ℃. The supernatant was collected and purified using nickel resin purification kit (Promega). The protein extracts were examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

The SDS-PAGE protein electrophoresis analysis chart is shown in figure 2, and the result shows that all three proteins are successfully expressed. The active polypeptide chain is obtained by partial purification through prokaryotic expression of six His tag fusion proteins of complete or nitrogen-terminal-removed transmembrane domain peptide chain-about 50 amino acids of CsSCPL11, CsSCPL13 and CsSCPL 14. These recombinant proteins were then used for activity assays.

3. Enzymatic activity detection assay for CsSCPL11-IA, CsSCPL13-IA and CsSCPL14-IA recombinant proteins

For the enzyme activity assay, the total reaction system was 50. mu.L, containing 50mM potassium phosphate buffer (pH 6.0), 1.0mM catechin (C), Epicatechin (EC), Gallocatechin (GC), Epigallocatechin (EGC), 0.4 mM 1, 21, 3,4, 6-pentyl-O-galloyl- β -D-glucose (PGG) and 1.0. mu.g of purified recombinase for verifying the gallate activity of CsSCPL11-IA, CsSCPL13-IA and CsSCPL 14-IA. The reaction was carried out at 30 ℃ for 20 minutes, then quenched by the addition of an equal amount of 100% methanol, and the samples were analyzed by High Performance Liquid Chromatography (HPLC) and liquid chromatography-mass spectrometry (LC-MS). The detection method refers to: wei C, Yang H, Wang S, ZHao J, Liu C, Gao L, Xia E, Lu Y, Tai Y, She G, Sun J, Cao H, Tong W, Gao Q, Li Y, Deng W, Jiang X, Wang W, Chen Q, Zhang S, Li H, Wu J, Wang P, Li P, Shi C, Zheng F, Jian J, Huang B, Shann D, Shi M, Fan C, Yue Y, Li F, Li D, Wei S, Han B, Jiang C, Yin Y, Xia T, Zhang Z, Bennett JL, Zhao S, Wan X. (2018) Draft gene sequence of Camellia site science 17135, Shen Z, Bennett JO S, Wan X. (2018) Draft gene sequence of catalog science 17125, USA, 4151, 4135, and 35, USA, 4135, USA, 4151, USA, 35, and 35.

The results of the measurements are shown in FIGS. 3-8, and are shown in FIG. 3: in the ester catechin synthesis reaction catalyzed by the CsSCPL11 recombinant protein, the recombinase of CsSCPL11-I adds the substrate EGC (the retention time in an HPLC (high performance liquid chromatography) pattern is about 5.8 minutes) and the gallic acid group to convert the substrate EGC into EGCG (the retention time in an HPLC pattern is about 7.5 minutes). The recombinant enzyme CsSCPL11-I was active on EC as a reaction substrate (retention time in HPLC profile about 2 min) and converted EC gallation (galloylation) to ECG (retention time in HPLC profile about 7.1 min).

FIG. 4 illustrates that the key product ECG and the product EGCG were analyzed and identified by mass spectrometry, respectively, and the ECG mass spectrum peaks [ ECG ] +442.37, and [ EGCG ] +458.33, were substantially identical to those of the standard.

FIG. 5 shows that the recombinant enzyme CsSCPL13 also converted the substrate EGC (retention time in HPLC profile about 5.8 min) to EGCG (retention time in HPLC profile about 7.5 min). The recombinant enzyme CsSCPL13 also showed gallation (galloylation) activity on EC as a substrate for the reaction (retention time in HPLC profile about 2.1 min) to convert EC to ECG (retention time in HPLC profile about 7.1 min).

FIG. 6 illustrates that the key product ECG and the product EGCG were analyzed and identified by mass spectrometry, respectively, and the ECG mass spectrum peaks [ ECG ] +442.37, and [ EGCG ] +458.33, were substantially identical to those of the standard.

FIG. 7 shows that the recombinant enzyme CsSCPL14 can also catalyze the conversion of EC reaction substrate (retention time in HPLC profile is about 2.1 min) to ECG (retention time in HPLC profile is about 7.1 min) and EGC (retention time in HPLC profile is about 5.8 min) substrate to EGCG (retention time in HPLC profile is about 7.5 min).

FIG. 8 illustrates that the key product ECG and the product EGCG were analyzed and identified by liquid chromatography-triple quadrupole mass spectrometry coupling, respectively, and the ECG mass peaks [ ECG ] +442.37, and [ EGCG ] +458.33, were substantially identical to those of the standard.

The chemical structure schematic diagram of the three purified recombinant enzymes is shown in FIG. 9.

4. Detection of tissue-specific expression and gene expression levels after different treatments

Taking different tissues of tea tree or different treated samples, quickly freezing in liquid nitrogen, and storing in a refrigerator at-80 deg.C for use. RNA was extracted and reverse transcribed as described above to obtain cDNA template, which was detected using iQ5 fluorescent quantitative PCR detection system from Bio-Rad, 20. mu.L of PCR reaction containing 2.5. mu.L of 2X Power SYBR Master Mix (Applied Biosystems), 1. mu.L of primer Mix, 2. mu.L of 1: 30 diluted cDNA template, the remainder was made up with water. PCR programs and analytical methods are described in Ahmad MZ, Li P, Wang J, Rehman NU, Zhao J. (2017) Isoflex malonyltransferases GmIMaT1 and GmIMaT3 differential modification isoflex carbohydrates in sobean (Glycine max) under vacuum stresses.

The tissue-specific expression results of the ester-type catechin synthase gene are shown in FIG. 1. Ester type catechins in tea trees are mainly accumulated in young bud leaves, which are often the original material for processing tea leaves. Real-time quantitative PCR analysis shows that the CsSCPL11, 13 and 14 genes are mainly expressed in young bud leaves or young stems, which is consistent with the accumulation mode of the ester catechin, and indicates that the CsSCPL11, 13 and 14 genes are involved in the synthesis of the ester catechin.

The results of the changes in the expression levels of the three genes in the different treatments are shown in FIG. 10, and the low-temperature treatment, sodium chloride treatment, aluminum treatment, shading treatment, methyl jasmonate treatment and polyethylene glycol treatment were performed in this order from the right, and the transcriptome data was derived from TPIA: http:// tpia. teaplan. org/index. html, and heat maps were made using mev4.9.0. The changes of the SCPL gene expression of the TEA tree under the environmental stress are associated with the accumulation of ester type catechin, and the gene expressions of CsSCPL11(TEA023451), CsSCPL13(TEA034055) and CsSCPL14(TEA027270) are all inhibited by low temperature cold injury, and are consistent with the mode that the accumulation of ester type catechin synthesis is inhibited simultaneously by the low temperature cold injury. Methyl jasmonate treatments stimulated accumulation of ester catechins, while these treatments also activated expression of CsSCPL13(TEA034055), and CsSCPL14(TEA 027270). Similarly, TEA tree, under shade, reduced the synthesis of ester catechin and also inhibited the expression of CsSCPL14(TEA 027270). In the PEG-treated TEA seedlings, the ester catechin content was also increased as the expression of CsSCPL13(TEA034055) and CsSCPL14(TEA027270) was up-regulated. All of these results show that three genes, CsSCPL11(TEA023451), CsSCPL13(TEA034055), and CsSCPL14(TEA027270), are involved in the synthesis or inhibition of ester catechins in the TEA plant in response to stress or environmental changes.

In the invention, a phylogenetic tree of three genes is prepared and analyzed by MEGA6.0 software, as shown in figure 11, for SCPL gene families in tea trees and other species, a rootless evolutionary tree is constructed by using NJ hair, a bootstrap value is set to be 1000, and other parameters are defaults. The results show that SCLP11,13,14 and proteins cloned from other plants that have been found to function as acetyltransferases are included in a gene cluster (SCPL-IA). Three proteins, CsSCPL11(TEA023451), CsSCPL13(TEA034055) and CsSCPL (TEA027270), were closely related in system evolution to the SCPL-1A type gene in other plants reported to have acetyltransferase function.

And the correlation analysis of the catechin, epicatechin and gallate content in the tea tree tissue and the expression pattern of the CsSCPL family gene is shown in the figure 12.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> agriculture university of Anhui

<120> ester type catechin synthetase, coding gene and application thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1350

<212> DNA

<213> ester type catechin synthase (CsSCPL11-IA)

<400> 1

atgtttccac caaagtcata cagttctagc ttctctgcta actgtgatag atatgggttg 60

tacatccatt attttctgct tctgcttcta ctctcagcac aagctgtctt aggcggccac 120

attgtcaagt acttaccggg ttatgatggc gaacttccct ttaaacttga aactgggtat 180

gctctaattt atattagagt aaatgagtcg gaattgttct actatttcat tgagtcacaa 240

gggaatcctc aagaggaccc gattttcctt tggctcccag gcggccctgg ctgttcttct 300

ttccatgaac ttgtttatgg atttggtatg gtgaaaattt taattgtcaa gactgctagc 360

attatatttc ttgatgcacc cgtggggacc gggttctcct attcaagaac agcggatggt 420

tggccaacct ctgactccaa atcagcagaa caatcttacc aattccttag agagtggttt 480

gatgaacacc ctcaatatct agcagttcaa ctatttgttg gtggcaataa agatggagtc 540

aagccattta tgaacctcaa gggttactta cttgggagcc cacgaacaga ttcggttatt 600

gatgagaatt cgaaagtagt tttcgctcat aggatggcac ttatatcgga tgagatttat 660

gagaatgcca aaacgggttg caatgacact tacgtgagta tagacccagc aaacacagca 720

tgtatagttg cgctcggcaa tatcaaaacg tgcattaaag atctgtttcg caatgatatt 780

ttggaaccga aatgtgtttt tgcaactcct gaccctggag aagaacctgc agcacgaagg 840

tctcttgaag agggtccttc agatttcctt ctctcacctc caatgatccc gaatctttgg 900

tgccgaaatt ttaattatgt actctcctac atctggtcaa atgatgatac tgttcaagaa 960

gttttacatg ttcgaaaggg atctgtattg aattgggaga gatgcaacaa gagcttatca 1020

tacacaaaag acatcttgac tgttgttcct gttcatgaag aactcaaaga attaggctta 1080

gaagtgcttg tagagactgg tgaccgtgac atggttgttc catttgtggg tactgtgaaa 1140

tggataaagt ctctgaattt gacagttgtc aatgattgga ggccatggtt cgttgacggt 1200

caagttgcag gatacacaat aaagtattct gagcatgggt atcgtttgac atatgcaact 1260

gtaaaaggtg ctggtcacac agctccagag tactatcgca tggaatgcta ttacatgttt 1320

gacagatgga ttcattacta tcctatttag 1350

<210> 2

<211> 451

<212> PRT

<213> ester type catechin synthase (CsSCPL11-IA)

<400> 2

Met Phe Pro Pro Lys Ser Tyr Ser Ser Ser Phe Ser Ala Asn Cys Asp

1 5 10 15

Arg Tyr Gly Leu Tyr Ile His Tyr Phe Leu Leu Leu Leu Leu Leu Ser

20 25 30

Ala Gln Ala Val Leu Gly Gly His Ile Val Lys Tyr Leu Pro Gly Tyr

35 40 45

Asp Gly Met Glu Leu Pro Phe Lys Leu Glu Thr Gly Tyr Ala Leu Ile

50 55 60

Tyr Ile Arg Val Asn Glu Ser Glu Leu Phe Tyr Tyr Phe Ile Glu Ser

65 70 75 80

Gln Gly Asn Pro Gln Glu Asp Pro Ile Phe Leu Trp Leu Pro Gly Gly

85 90 95

Pro Gly Cys Ser Ser Phe His Glu Leu Val Tyr Gly Phe Gly Met Val

100 105 110

Lys Ile Leu Ile Val Lys Thr Ala Ser Ile Ile Phe Leu Asp Ala Pro

115 120 125

Val Gly Thr Gly Phe Ser Tyr Ser Arg Thr Ala Asp Gly Trp Pro Thr

130 135 140

Ser Asp Ser Lys Ser Ala Glu Gln Ser Tyr Gln Phe Leu Arg Glu Trp

145 150 155 160

Phe Asp Glu His Pro Gln Tyr Leu Ala Val Gln Leu Phe Val Gly Lys

165 170 175

Gly Asn Lys Asp Gly Val Lys Pro Phe Met Asn Leu Lys Gly Tyr Leu

180 185 190

Leu Gly Ser Pro Arg Thr Asp Ser Val Ile Asp Glu Asn Ser Lys Val

195 200 205

Val Phe Ala His Arg Met Ala Leu Ile Ser Asp Glu Ile Tyr Glu Asn

210 215 220

Ala Lys Thr Gly Cys Asn Asp Thr Tyr Val Ser Ile Asp Pro Ala Asn

225 230 235 240

Thr Ala Cys Ile Val Ala Leu Gly Asn Ile Lys Thr Cys Ile Lys Asp

245 250 255

Leu Phe Arg Asn Asp Ile Leu Glu Pro Lys Cys Val Phe Ala Thr Pro

260 265 270

Asp Pro Gly Glu Glu Pro Ala Ala Arg Arg Ser Leu Glu Glu Gly Pro

275 280 285

Ser Asp Phe Leu Leu Ser Pro Pro Met Ile Pro Asn Leu Trp Cys Arg

290 295 300

Asn Phe Asn Tyr Val Leu Ser Tyr Ile Trp Ser Asn Asp Asp Thr Val

305 310 315 320

Gln Glu Val Leu His Val Arg Lys Gly Ser Val Leu Asn Trp Glu Arg

325 330 335

Cys Asn Lys Ser Leu Ser Tyr Thr Lys Asp Ile Leu Thr Val Val Pro

340 345 350

Val His Glu Glu Leu Lys Glu Leu Gly Leu Glu Val Leu Val Glu Thr

355 360 365

Gly Asp Arg Asp Met Val Val Pro Phe Val Gly Thr Val Lys Trp Ile

370 375 380

Lys Ser Leu Asn Leu Thr Val Val Asn Asp Trp Arg Pro Trp Phe Val

385 390 395 400

Asp Gly Gln Val Ala Gly Tyr Thr Ile Lys Tyr Ser Glu His Gly Tyr

405 410 415

Arg Leu Thr Tyr Ala Thr Val Lys Gly Ala Gly His Thr Ala Pro Glu

420 425 430

Tyr Tyr Arg Met Glu Cys Tyr Tyr Met Phe Asp Arg Trp Ile His Tyr

435 440 445

Tyr Pro Ile

450

<210> 3

<211> 1494

<212> DNA

<213> ester type catechin synthase (CsSCPL13-IA)

<400> 3

atggtgcaag tagaagccat tgctgcttct cagaagcagc ttctacaaaa gccaagttgc 60

gcttggatca gatgggtaca aaaccatctt cttcttcaac ttctcttggc acaaccagtc 120

cttggtggtc agattgtcaa gtatttacct ggttttgatg gtgaacttcc cttcaaactt 180

gaaactgggc aattgaaatc tgatgatggg tttgttgttg attttgacag atatatcagc 240

gttgatgatt cggagttgtt ctattatttc attgaatcag aagggaaccc tcaagaagac 300

ccactttttc tttggctcac tggtggacct ggctgcactt ctttcagtgg actcctctat 360

gaagttggtc caatggagta tgacattgat aactacactg gagggttacc aaaattgaaa 420

tattatccat atgcaaggac gaagactgct agcatgatat ttcttgatgc acctgttggc 480

actggtttct cttatgcaag aacccctgga ggttggccta catcagacac aaaatcagct 540

gaacagtcgt accagttcct caggaagtgg ttggtcgaac acccacaatt tctctccgtt 600

caactatttg ttggtggtga ttcttatgca ggccttgctg tcccattgat cactaaaaag 660

ataatagatg gtaacaaaga aaaagccgag ccatatatga atatcaaagg atacttggtt 720

ggatgcccag ggactgattc agttattgat gggaactcaa gagtagattt tgctcataga 780

atggcactta tatcggatga gatctatgag aatgcgaaaa gaagttgcaa tgagaactat 840

ataaatgtag atccagcaaa tacggcatgc ataactgcta tgggtgctgt acaaaagtgt 900

ctggaagatc tgtctgacaa agatattttg aaacccaagt gcgatttatc atcccaagat 960

catccagaag gcccagaccg aagatttcta aaagaaggtt cttcagagtt cctactctcg 1020

ccatcaacgt ttccaaaatc ttggtgcact actttgaagc ttacacacaa tagcatttgg 1080

gcaaacgatg atggtgttca agaagcatta catgttcgga agggaactgt accacgttgg 1140

gagaggtgca acaacagctt atcatacacc aaagatgttt cgagtgttat tgctgttcat 1200

aaagaactaa gtagatcatc cttggaagta cttgtagaga gtggtgatca tgacatctct 1260

gttccttaca tgggtacctt aaaatggata aagtctctca atttgaccct cgttgacgat 1320

tggaggcctt ggtttgttga taatcaagtt gctggataca cgatgaagta ttcagaggag 1380

catggatatc acttgacttt tgcaaccata aagggcgcgg gtcaccctgc tccagagtac 1440

tatcgcaggg aatgttattg tttatttgac aggtggatta attataatcc tgtt 1494

<210> 4

<211> 498

<212> PRT

<213> ester type catechin synthase (CsSCPL13-IA)

<400> 4

Met Val Gln Val Glu Ala Ile Ala Ala Ser Gln Lys Gln Leu Leu Gln

1 5 10 15

Lys Pro Ser Cys Ala Trp Ile Arg Trp Val Gln Asn His Leu Leu Leu

20 25 30

Gln Leu Leu Leu Ala Gln Pro Val Leu Gly Gly Gln Ile Val Lys Tyr

35 40 45

Leu Pro Gly Phe Asp Gly Glu Leu Pro Phe Lys Leu Glu Thr Gly Gln

50 55 60

Leu Lys Ser Asp Asp Gly Phe Val Val Asp Phe Asp Arg Tyr Ile Ser

65 70 75 80

Val Asp Asp Ser Glu Leu Phe Tyr Tyr Phe Ile Glu Ser Glu Gly Asn

85 90 95

Pro Gln Glu Asp Pro Leu Phe Leu Trp Leu Thr Gly Gly Pro Gly Cys

100 105 110

Thr Ser Phe Ser Gly Leu Leu Tyr Glu Val Gly Pro Met Glu Tyr Asp

115 120 125

Ile Asp Asn Tyr Thr Gly Gly Leu Pro Lys Leu Lys Tyr Tyr Pro Tyr

130 135 140

Ala Arg Thr Lys Thr Ala Ser Met Ile Phe Leu Asp Ala Pro Val Gly

145 150 155 160

Thr Gly Phe Ser Tyr Ala Arg Thr Pro Gly Gly Trp Pro Thr Ser Asp

165 170 175

Thr Lys Ser Ala Glu Gln Ser Tyr Gln Phe Leu Arg Lys Trp Leu Val

180 185 190

Glu His Pro Gln Phe Leu Ser Val Gln Leu Phe Val Gly Gly Asp Ser

195 200 205

Tyr Ala Gly Leu Ala Val Pro Leu Ile Thr Lys Lys Ile Ile Asp Gly

210 215 220

Asn Lys Glu Lys Ala Glu Pro Tyr Met Asn Ile Lys Gly Tyr Leu Val

225 230 235 240

Gly Cys Pro Gly Thr Asp Ser Val Ile Asp Gly Asn Ser Arg Val Asp

245 250 255

Phe Ala His Arg Met Ala Leu Ile Ser Asp Glu Ile Tyr Glu Asn Ala

260 265 270

Lys Arg Ser Cys Asn Glu Asn Tyr Ile Asn Val Asp Pro Ala Asn Thr

275 280 285

Ala Cys Ile Thr Ala Met Gly Ala Val Gln Lys Cys Leu Glu Asp Leu

290 295 300

Ser Asp Lys Asp Ile Leu Lys Pro Lys Cys Asp Leu Ser Ser Gln Asp

305 310 315 320

His Pro Glu Gly Pro Asp Arg Arg Phe Leu Lys Glu Gly Ser Ser Glu

325 330 335

Phe Leu Leu Ser Pro Ser Thr Phe Pro Lys Ser Trp Cys Thr Thr Leu

340 345 350

Lys Leu Thr His Asn Ser Ile Trp Ala Asn Asp Asp Gly Val Gln Glu

355 360 365

Ala Leu His Val Arg Lys Gly Thr Val Pro Arg Trp Glu Arg Cys Asn

370 375 380

Asn Ser Leu Ser Tyr Thr Lys Asp Val Ser Ser Val Ile Ala Val His

385 390 395 400

Lys Glu Leu Ser Arg Ser Ser Leu Glu Val Leu Val Glu Ser Gly Asp

405 410 415

His Asp Ile Ser Val Pro Tyr Met Gly Thr Leu Lys Trp Ile Lys Ser

420 425 430

Leu Asn Leu Thr Leu Val Asp Asp Trp Arg Pro Trp Phe Val Asp Asn

435 440 445

Gln Val Ala Gly Tyr Thr Met Lys Tyr Ser Glu Glu His Gly Tyr His

450 455 460

Leu Thr Phe Ala Thr Ile Lys Gly Ala Gly His Pro Ala Pro Glu Tyr

465 470 475 480

Tyr Arg Arg Glu Cys Tyr Cys Leu Phe Asp Arg Trp Ile Asn Tyr Asn

485 490 495

Pro Val

<210> 5

<211> 1101

<212> DNA

<213> ester type catechin synthase (CsSCPL14-IA)

<400> 5

atggtgcaag tagaagccat tgctgcttct cagaagcagc ttctacaaaa gccaacttgc 60

gcttggatca gatgggtaca aaaccatctt cttcttctac tagttctctt ggcacaacca 120

gtccttggtg gtcagattgt caaatatatc agcgttgatg attcggagtt gttctattat 180

ttcattgaat cagaagggaa ccctcaagaa gacccacttt ttctttggct cactggtgga 240

cctggctgca cttcttttag tggactcctt tatgaagttg gtccaatgga gtatgacatt 300

gataactaca ctggagggtt accaaaattg aaatattatc catatgcaag gacgaagact 360

gctagcatga tatttcttga tgcacctgtt ggcactggtt tctcttatgc aagaacccct 420

ggaggttggc ctacatcaga cacaaaatca gctgaacagt cgtaccagtt cctcaggaag 480

ggatacttgg ttggatgccc agggactgat tcagttattg atgggaactc aagagtagat 540

tttgctcata gaatggcact tatatcggat gagatctatg agaatgcgaa aagaagttgc 600

aatgagaact atataaatgt agatccagca aatacggcat gcataactgc tatgggtgct 660

atacaaaagt gtctgaaaga tctgtctgac aaagatattt tgaaacccaa gtgcgattta 720

tcatcccaag atcatccaga aggcccagac cgaagatttc taaaagaagg ttcttcagag 780

ttcctactct cgccatcaac gtttccaaaa ccttggtgca ctactttgaa gcttacacac 840

aatagcattt gggcaaacga tgatggtgtt caagaagcat tacatgttcg gaagggaact 900

gtaccacgtt gggagagatg caacaacagc ttatcataca cccaagatgt cttgagtgtt 960

attgctgttc ataaagaact aagtagatca tccttggaag tacttgtaga gaggttcttc 1020

atcttctttc ttcttcttcc agcagccaac aggccttctc tcccctctag accacccgac 1080

aacctaactc accactccta g 1101

<210> 6

<211> 415

<212> PRT

<213> ester type catechin synthase (CsSCPL14-IA)

<400> 6

Met Val Gln Val Glu Ala Ile Ala Ala Ser Gln Lys Gln Leu Leu Gln

1 5 10 15

Lys Pro Thr Cys Ala Trp Ile Arg Trp Val Gln Asn His Leu Leu Leu

20 25 30

Leu Leu Val Leu Leu Ala Gln Pro Val Leu Gly Gly Gln Ile Val Lys

35 40 45

Tyr Ile Met Ser Val Asp Asp Ser Ser Glu Leu Phe Tyr Tyr Phe Ile

50 55 60

Glu Ser Glu Gly Asn Pro Gln Glu Asp Pro Leu Phe Leu Trp Leu Thr

65 70 75 80

Gly Gly Pro Gly Cys Thr Ser Phe Ser Gly Leu Leu Tyr Glu Val Gly

85 90 95

Pro Met Glu Tyr Asp Ile Asp Asn Tyr Thr Gly Gly Leu Pro Lys Leu

100 105 110

Lys Tyr Tyr Pro Tyr Ala Arg Thr Lys Thr Ala Ser Met Ile Phe Leu

115 120 125

Asp Ala Pro Val Gly Thr Gly Phe Ser Tyr Ala Arg Thr Pro Gly Gly

130 135 140

Trp Pro Thr Ser Asp Thr Lys Ser Ala Glu Gln Ser Tyr Gln Phe Leu

145 150 155 160

Arg Lys Trp Leu Val Glu His Pro Gln Phe Leu Ser Val Gln Leu Phe

165 170 175

Val Gly Gly Asp Ser Tyr Ala Gly Leu Thr Val Pro Leu Ile Thr Lys

180 185 190

Lys Ile Ile Asp Gly Asn Lys Glu Lys Ala Lys Pro Tyr Met Asn Ile

195 200 205

Lys Gly Tyr Leu Val Gly Cys Pro Gly Thr Asp Ser Val Ile Asp Gly

210 215 220

Asn Ser Arg Val Asp Phe Ala His Arg Met Ala Leu Ile Ser Asp Glu

225 230 235 240

Ile Tyr Glu Asn Ala Lys Arg Ser Cys Asn Glu Asn Tyr Ile Asn Val

245 250 255

Asp Pro Ala Asn Thr Ala Cys Ile Thr Ala Met Gly Ala Ile Gln Lys

260 265 270

Cys Leu Lys Asp Leu Ser Asp Lys Asp Ile Leu Lys Pro Lys Cys Asp

275 280 285

Leu Ser Ser Gln Asp His Pro Glu Gly Pro Asp Arg Arg Phe Leu Lys

290 295 300

Glu Gly Ser Ser Glu Phe Leu Leu Ser Pro Ser Thr Phe Pro Lys Pro

305 310 315 320

Trp Cys Thr Thr Leu Lys Leu Thr His Asn Ser Ile Trp Ala Asn Asp

325 330 335

Asp Gly Val Gln Glu Ala Leu His Val Arg Lys Gly Thr Val Pro Arg

340 345 350

Trp Glu Arg Cys Asn Asn Ser Leu Ser Tyr Thr Gln Asp Val Leu Ser

355 360 365

Val Ile Ala Val His Lys Glu Leu Ser Arg Ser Ser Leu Glu Val Leu

370 375 380

Val Glu Arg Phe Phe Ile Phe Phe Leu Leu Leu Pro Ala Ala Asn Arg

385 390 395 400

Pro Ser Leu Pro Ser Arg Pro Pro Asp Asn Leu Thr His His Ser

405 410 415

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (CsSCPL11-IA-F)

<400> 7

atgtttccac caaagtcata 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (CsSCPL11-IA-R)

<400> 8

ctaaatagga tagtaatgaa 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (CsSCPL13-IA-F)

<400> 9

atggtgcaag tagaagccat 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (CsSCPL13-IA-R)

<400> 10

aacaggatta taattaatcc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (CsSCPL14-IA-F)

<400> 11

atggtgcaag tagaagccat 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (CsSCPL14-IA-R)

<400> 12

ctaggagtgg tgagttaggt 20

<210> 13

<211> 51

<212> DNA

<213> Artificial sequence (CsSCPL11-IA-F)

<400> 13

ggggacaagt ttgtacaaaa aagcaggctt catggaactt ccctttaaac t 51

<210> 14

<211> 49

<212> DNA

<213> Artificial sequence (CsSCPL11-IA-R)

<400> 14

ggggaccact ttgtacaaga aagctgggtc taaataggat agtaatgaa 49

<210> 15

<211> 51

<212> DNA

<213> Artificial sequence (CsSCPL13-IA-F)

<400> 15

ggggacaagt ttgtacaaaa aagcaggctt catggtgcaa gtagaagcca t 51

<210> 16

<211> 49

<212> DNA

<213> Artificial sequence (CsSCPL13-IA-R)

<400> 16

ggggaccact ttgtacaaga aagctgggta acaggattat aattaatcc 49

<210> 17

<211> 51

<212> DNA

<213> Artificial sequence (CsSCPL14-IA-F)

<400> 17

ggggacaagt ttgtacaaaa aagcaggctt catgagcgtt gatgattcgg a 51

<210> 18

<211> 49

<212> DNA

<213> Artificial sequence (CsSCPL14-IA-R)

<400> 18

ggggaccact ttgtacaaga aagctgggtc taggagtggt gagttaggt 49

Claims (4)

1. Ester type catechin synthetaseCsSCPL11-IAThe amino acid sequence is shown in SEQ ID number 2.

2. Encoding the ester-type catechin synthase according to claim 1CsSCPL11-IAThe gene of (a), characterized in that: the gene nucleotide sequence of the ester type catechin synthetase is shown in SEQ ID number 1.

3. Use of the ester-type catechin synthase according to claim 1 as an acyltransferase.

4. Use of the ester-type catechin synthase according to claim 1 for catalyzing the conversion of epicatechin to epicatechin gallate and/or for catalyzing the conversion of epicatechin to epigallocatechin gallate.

Images