CN103805630A - Novel plant fertility regulation structure and application thereof - Google Patents
Novel plant fertility regulation structure and application thereof Download PDFInfo
- Publication number
- CN103805630A CN103805630A CN201310548284.3A CN201310548284A CN103805630A CN 103805630 A CN103805630 A CN 103805630A CN 201310548284 A CN201310548284 A CN 201310548284A CN 103805630 A CN103805630 A CN 103805630A
- Authority
- CN
- China
- Prior art keywords
- gene
- rice
- plant
- line
- male
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to the field of plant breeding, and particularly relates to the fertility restoration of a homozygous recessive genic male sterility rice plant. Furthermore, the invention relates to a method for establishing a plant male sterile line and a maintainer line and a genetic transformation material, and more particularly relates to a structure, a rice cell, tissue or organ, a method for establishing a rice male sterile line and a maintainer line, a method for restoring the male fertility of a rice sterile plant, a method for preparing rice seeds, a genetic transformation material, a method for preparing hybrid rice and an application of the rice male sterile line in preparation of hybrid rice.
Description
Technical field
The present invention relates to field of plant breeding.Particularly, the present invention relates to the fertility restorer of recessive nucleus male sterility rice plant and uses thereof that isozygotys.Further the present invention relates to build method and the genetic transformation material of male sterility line of plants, maintenance line, more specifically, the present invention relates to a kind of construct, a kind of rice cell, tissue or organ, a kind of method that builds male sterible series of rice and maintenance line, a kind of method of recovering paddy rice sterile plant male fertile, a kind of method of preparing rice paddy seed, a kind of genetic transformation material, for the preparation of a method for hybrid rice, and the purposes of male sterible series of rice in preparation hybrid rice.
Background technology
Cross-breeding is seed selection new variety main paties, is the most important method of breeding in modern age, and initiative, utilization and the industrialization of cross-fertilize seed is the focus that industry market competition is planted by International Agriculture transnational group.Because hybridization causes gene recombination, the good character genotype that offspring there will be combination parents to control, produces additive effect, and utilizes some interaction of genes, forms the super close type of tool newly individual.Crop hybrid breeding has huge development potentiality, has become the main path that improves grain yield.In recent decades, hybrid vigour as a kind ofly improving crop yield, Crop Improvement quality, improve pest-resistant, disease-resistant, the degeneration-resistant means of crop and be widely used.Utilize breeding for heterosis to become the main breeding method of many crops.Thereby be the key that acquisition high purity hybridization F1 seed utilizes crop heterosis and effectively control crop self-pollination, be fertilized.And being (1), the key issue that must solve in cross-breeding obtains available sterile line: be generally male sterile (by cytoplasmic sterility or Recessive Male sterility control); (2) hybridization combo: sterile line can have with corresponding paternal plant combinations produce the filial generation of good character; (3) breeding of sterile line: sterile line can recover fertility is under certain condition maintained it.Therefore, the seed selection of crop male sterile line is the key link of heterosis utilization.
The 1970s and 1980s in last century, Chinese Scientists take Yuan Longping as representative utilize paddy rice Yebai cytoplasmic sterile gene resource to formulate " three are " hybrid rice, make rice yield improve nearly 20%, be called as " Green Revolution " for the second time, play very important effect for ensureing China's staple food supply, make the rice breeding of China and production technology in world lead level, also shown heterotic powerful effect to common people.What in paddy rice cross breeding breeding, commonly use is " three are " and " two are " hybridization." three are " hybridization need to have specific restorer and maintenance line, the procedure of breeding and production link complexity, and cycle of seed selection new sterile line and new combination is long, efficiency is low, and the utilization ratio of germ plasm resource is lower than 5%.In addition, triple crossing japonica rice advantage is not strong, and sterile cytoplasm is more single, the potentially dangerous that exists certain crushing disease and pest to break out." two are " hybrid rice is owing to not being subject to the restriction of relation between restorer, maintenance line, parent's genetic diversity be improved significantly, the speed that selects High-Yielding Hybrid Rice combination is obviously accelerated, and has promoted research and the production of super hybridized rice.But the sterile line adopting in " two are " hybridization mostly at present is " light is temperature sensitive " sterile line, and its fertility is subject to temperature and the illumination effect in environment.The unstable meeting of these environmental factorss directly affects purity and the quantity of cenospecies, strengthens risk in hybrid seed production, and serious Shi Huishi enterprise and peasant cause heavy economic losses, the spread of restriction " two are " hybridisation rice.And the two-line hybrid rice sterile line that utilizes current technology to select is very limited, for example in japonica rice variety, almost there is no good double-line hybrid combination, limit making full use of of variety source.Thereby cultivating stable sterile line not affected by environment and that can independently breed has become the technical bottleneck of restriction " two are " hybridization technique widespread use.
Corn is to utilize hybrid vigour the earliest, and the cross-fertilize seed the most successful crop of penetration and promotion in the world.Corn is diclinism crop, the crop that breeding coefficient is high, and when cross-fertilize seed produces, in isolated area, father, female parent are planted in proportion, and maternal tassel pulls out while just having exposed, paternal pollen free pollination hybridization.The utilization of corn hybridization advantage and the upper application of production cross-fertilize seed, make Level Maize Production produce great variety.But corn hybrid seed exists conventional breeding parent's hereditary basis difference in producing is large not, and therefore have influence on main breeding objective as high yield, stable yields, degeneration-resistant, precocious etc. realization as early as possible.Meanwhile, in cross-fertilize seed production process, exist maternal emasculation work heavy and not thoroughly and then affect cross-fertilize seed output and the unsettled problem of quality, anxious to be resolved.
Hybrid vigour is also applied in as the production of tobacco and rape in dicotyledons.Rape is the third-largest oil crops in the world, and the total product of china rape and area account for the world 1/3rd, are maximum rape producing countries, and the rape heterosis utilization of China is in world lead level.In rape, conventional cross-breeding is also based on cytoplasmic sterility and the large class of nucleus sterile two, has " three are " and " two are " cross-breeding, therefore, the same with paddy rice, has the same problem that germ plasm resource utilization ratio is low, purity of hybrid is lower.
Thereby current plant hybridization breeding technique still haves much room for improvement.
Summary of the invention
The present invention one of is intended to solve the problems of the technologies described above at least to a certain extent or at least provides a kind of useful business to select.For this reason, one object of the present invention be to propose a kind of have can effectively build male sterible series of rice and the corresponding maintenance line of novel stabilising and make full use of Rice Germplasm Resources for cross-breeding, improve the means of purity of hybrid.
In a first aspect of the present invention, contriver has proposed a kind of method of regulating plant fertility, and concrete scheme is described as: the present invention is isozygotied recessive nucleus male sterility mutant as a kind of novel maintenance line of transformation receptor material initiative take plant.By closely linked 2 target genes (fertility restorer gene and dithering gene) are converted into and are isozygotied in recessive sterile acceptor plant.Wherein, fertility restorer gene can make transformation receptor fertility restorer; obtain by transformation receptor self-fertility is separable the transgenic seed that foreign gene (being above-mentioned 2 target genes) isozygotys; further cultivate and become plant; obtain heterozygosis transgenic seed with sterile line pollination hybridization, further cultivate as plant is as maintenance line; Maintenance line can produce two class pollen of equivalent, and half is for containing transgenosis, and second half is not for containing transgenosis.Maintenance line is made to male parent and isozygotied after recessive sterile line pollination hybridization, solid generation two class seeds, one class is for containing genetically modified seed, another kind of for not containing genetically modified seed, screening-gene can be for the sorting of two class seeds, the non-transgenic seed sorting out is produced cross-fertilize seed as breeding sterile line, and transgenic seed still can continue to serve as maintenance line, hybridizes with continuously, stably produces sterile line with sterile line.
The definition of " maintenance line " described in the present invention is that construct conversion of plant is isozygotied after recessive nucleus male sterility mutant, the offspring plant or the seed that contain the recessive Male sterile gene of plant and foreign gene (being 2 goal gene that construct contains) that produce, wherein the recessive Male sterile gene of plant site is recessive homozygotic state, and foreign gene (i.e. 2 goal gene) site is transgenosis heterozygous state.
Fertility restorer gene of the present invention is separable from any plant, and described fertility regulate and control method can be applicable to any plant, and described plant includes but not limited to corn (Zea mays), leaf mustard (Brassica napus, Brassica rapassp.), alfalfa (Medicago sativa), paddy rice (Oryza sativa), rye (Secale cereale), Chinese sorghum (Sorghum bicolor, Sorghum vulgare), Sunflower Receptacle (Helianthus annuus), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), broomcorn millet (Panicumspp.), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Gossypium hirsutum) Ipomoea batatas (Ipomoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), tangerine (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), Fructus Fici (Ficus casica), piscidia (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), oat (Avena sativa), barley (Hordeum vulgare), rape (Brassica napus) vegetables, decorative plant and softwood tree.Preferably, plant comprises corn, soybean, Sunflower Receptacle, safflower, leaf mustard, wheat, barley, rye, alfalfa, paddy rice, cotton, rape and Chinese sorghum.
Those skilled in the art should know, and the male sterile of mentioning in the present invention refers to the phenomenon that microgamete can not normal development, once form, are heritable, this kind of male sterile plant, the normal development of gynoecium energy.The male sterility gene of mentioning in the present invention, refer to cause one of key gene that microgamete can not normal development by sudden change, contain or be subject to the result that other impact is caused, its wild-type sequence structure can be used as fertility restorer gene.
In order better to implement this programme, described male sterile is for completely sterile, be the complete non-activity of sterile strain pollen or thorough WUHUAFEN, fertility restorer gene preferably has the restorability (more than the fertility restorer to 90% by complete sterile plant) of thorough recovery fertility.
Up to the present, document has been delivered disclosed fertile gene has a lot, comprising Arabidopsis ABORTED MICROSPORES (AMS) gene, Sorensen et al., The Plant Journal (2003) 33 (2): 413-423); Arabidopsis MS1 gene (Wilson et al., The Plant Journal (2001) 39 (2): 170-181); NEF1 gene (Ariizumi et al., The Plant Journal (2004) 39 (2): 170-181); Arabidopsis AtGPAT1 gene (Zheng et al., The Plant Cell (2003) 15:1872-1887); Arabdiopsis dde2-2 (it demonstrates the defect of allene oxide synthase (syntase) gene) (Malek et al., Planta (2002) 216:187-192) that suddenly change; Arabidopsis anonymity (faceless) pollen-1 gene (flp1) (Ariizumi et al, Plant Mol.Biol. (2003) 53:107-116); Arabidopisis MALE MEIOCYTE DEATH1 gene (Yang et al., The Plant Cell (2003) 15:1281-1295); Tapetum specificity zinc finger gene TAZ1 (Kapoor et al., The Plant Cell (2002) 14:2353-2367) and TAPETUM DETERMINANT1 gene (Lan et al, The Plant Cell (2003) 15:2792-2804).
Dithering gene of the present invention, includes but not limited to red fluorescence gene, cyan fluorescent protein gene, yellow fluorescence protein gene, luciferase gene, green fluorescence protein gene, anthocyanin p1 gene and careless fourth phosphinothricin acetyl transferring enzyme encoding gene.
Those skilled in the art should know, obtaining any one recessive nucleus male sterility mutant material that isozygotys, and after corresponding fertility restorer gene, all can apply the carrier that scheme constructs disclosed in this invention contains fertility restorer gene and dithering gene, transform the recessive nucleus male sterility mutant vegetable material that isozygotys accordingly, obtain by transformation receptor self-fertility is separable the transgenic seed that foreign gene (being fertility restorer gene and dithering gene) isozygotys, further cultivate and become plant, obtain heterozygosis transgenic seed with sterile line pollination hybridization, further cultivate and become plant as maintenance line, the maintenance line wherein obtaining can continue with sterile line hybridization for the production of sterile line and corresponding maintenance line, and to obtain stable 50% the maintenance line separating and 50% sterile line, the sterile line of acquisition can be directly used in hybrid seeding.
In a second aspect of the present invention, particularly, contriver has proposed a kind of method of adjusting and controlling rice fertility, and concrete scheme is described as: contriver is take the recessive nucleus male sterility rice mutant that isozygotys as a kind of novel maintenance line of transformation receptor material initiative.By closely linked 2 target genes (fertility restorer gene and dithering gene) are converted into and are isozygotied in recessive sterile acceptor plant.Wherein, fertility restorer gene can make transformation receptor fertility restorer, and the transgenic seed isozygotying by the separable foreign gene of transformation receptor self-fertility is further cultivated and become plant; obtain heterozygosis transgenic seed with sterile line pollination hybridization, further cultivate and become plant as maintenance line; Maintenance line can produce two class pollen of equivalent, and half is for containing transgenosis, and second half is not for containing transgenosis.Maintenance line is made to male parent and isozygotied after recessive sterile line pollination hybridization, solid generation two class seeds, one class is for containing genetically modified seed, another kind of for not containing genetically modified seed, dithering gene can be for the sorting of two class seeds, the non-transgenic seed sorting out is produced cross-fertilize seed as sterile line, and transgenic seed still can continue to serve as maintenance line, hybridizes with continuously, stably produces sterile line with sterile line.
More specifically, , the present invention can the recessive sterile ms26/ms26 mutant of paddy rice core be genetic transformation acceptor material, by extremely above-mentioned acceptor material of closely linked 2 target genes (Ms26 is that OsCYP704B2 and fluorescence color are selected gene) genetic transformation, the corresponding wild-type Ms26 of the fertility restorer gene OsCYP704B2(gene of one of target gene) can make transformation receptor fertility restorer, pass through self-fertility, the seed that separable foreign gene isozygotys, further cultivate as transfer-gen plant, make sterile line fertility restorer with sterile line pollination hybridization, and the solid seed that obtains transgenosis heterozygosis, further cultivate as plant, be, stable maintenance line (ms26/ms26, transgenosis heterozygosis), another target gene is after fluorescence color selects gene to hybridize for maintenance line and corresponding sterile line pollination, solid transgenic seed and the sorting of non-transgenic seed on sterile line plant, the non-transgenic seed sorting out is produced cross-fertilize seed as sterile line, and transgenic seed continues to serve as maintenance line and sterile line is pollinated hybridization stably to produce continuously sterile line and maintenance line.Because this technology is utilized biotechnology production non-transgenic product, solve the bottleneck problem facing in paddy rice cross breeding production of hybrid seeds process, i.e. three series resource utilization problem low and sterile line fertility instability in bilinear method.
In a third aspect of the present invention, the present invention proposes a kind of construct of regulating plant fertility, this construct comprises: the first expression cassette, described the first expression cassette contains the first nucleic acid molecule, and described the first nucleic acid molecule encoding plants male sterility recovers gene; And second expression cassette, described the second expression cassette contains the second nucleic acid molecule, described the second nucleic acid molecule encoding screening-gene (as fluorescence color is selected gene).Utilize this construct, can effectively plants male sterility be recovered to gene and screening-gene is incorporated into plant and isozygotys in recessive nucleus male sterility mutant plant, pass through self-fertility, the transgenic seed that separable foreign gene isozygotys, further cultivate as plant, hybridize with sterile line pollination the seed that obtains transgenosis heterozygosis, further cultivate as plant, be stable maintenance line, the seed of foreign gene-carrying and plant be not as sterile line.Thus, can be effectively for plant hybridization breeding.
Wherein, the first described expression cassette can further include: the first promotor, described the first promotor is operationally connected with described the first nucleic acid molecule, described the first promotor is the specificity promoter in microgamete growth course, and concrete described microgamete specificity promoter can start the first connected nucleic acid molecule expression in microgamete specifically and can recover the fertility of the above-mentioned recessive nucleus male sterility rice mutant that isozygotys; And first terminator, described the first terminator is operationally connected with described the first nucleic acid molecule.
In one embodiment of the invention, described the second expression cassette further comprises: the second promotor, described the second promotor is operationally connected with described the second nucleic acid molecule, and described the second promotor is the specific promotor such as callus and/or seed, seed coat, embryo and endosperm; The second terminator, described the second terminator is operationally connected with described the second nucleic acid molecule.
In a fourth aspect of the present invention, concrete, the present invention proposes the construct of adjusting and controlling rice fertility, this construct comprises: the first expression cassette, described the first expression cassette contains the first nucleic acid molecule, and described the first nucleic acid molecule encoding male sterility of rice recovers gene; And second expression cassette, described the second expression cassette contains the second nucleic acid molecule, described the second nucleic acid molecule encoding screening-gene (as fluorescence color is selected gene).Utilize this construct, can effectively male sterility of rice be recovered to gene and screening-gene is incorporated into and isozygotys in recessive nucleus male sterility rice mutant plant, pass through self-fertility, the transgenic seed that separable foreign gene isozygotys, further cultivate as plant, obtain transgenosis heterozygosis seed with sterile line pollination hybridization, further cultivate as plant, be stable maintenance line, the seed of foreign gene-carrying is not as sterile line.Thus, can be effectively for paddy rice cross breeding breeding.
Wherein, the first expression cassette of the construct of described adjusting and controlling rice fertility can further include: the first promotor, described the first promotor is operationally connected with described the first nucleic acid molecule, described the first promotor is microgamete specificity promoter, concrete described microgamete specificity promoter can start the first connected nucleic acid molecule expression in microgamete specifically, and can recover the fertility of the above-mentioned recessive nucleus male sterility rice mutant that isozygotys; And first terminator, described the first terminator is operationally connected with described the first nucleic acid molecule.Particularly, according to embodiments of the invention, for fertility restorer gene OsCYP704B2(Ms26), can adopt the sequence of endogenesis promoter, ORF district or genome sequence and the terminator of OsCYP704B2, be wild-type rice genome sequence.In one embodiment of the invention, described the first promotor has the nucleotide sequence as shown in SEQ ID NO:11.In one embodiment of the invention, described the first terminator has the nucleotide sequence as shown in SEQ ID NO:12.Contriver is surprised to find, utilize the combination of this promotor and terminator, can improve significantly the efficiency of expressing corresponding protein, and then can improve the efficiency of utilizing this construct to build maintenance line and sterile line, and can more effectively make the fertility of the sterile acceptor plant of paddy rice ms26/ms26 be restored.
Wherein, the second expression cassette of the construct of described adjusting and controlling rice fertility further comprises: the second promotor, described the second promotor is operationally connected with described the second nucleic acid molecule, and described the second promotor is the specific promotor such as callus and/or seed, seed coat, embryo and endosperm; The second terminator, described the second terminator is operationally connected with described the second nucleic acid molecule.Particularly, in one embodiment of the invention, described the second promotor comprises a 35S enhanser and LTP2 promotor, and wherein 35s enhanser has the nucleotide sequence as shown in SEQ ID NO:17, and LTP2 has the nucleotide sequence as shown in SEQ ID NO:2.In one embodiment of the invention, described the second terminator has the nucleotide sequence as shown in SEQ ID NO:6.Thus, according to one embodiment of present invention, the opening code-reading frame of RFP (r) is connected in from barley and between callus and seed (seed coat) specificity promoter LTP2 and the terminator PIN II from potato, before LTP2 promotor, also have a 35S enhancer sequence from tobacco mosaic virus (TMV), reassemble into RFP (r) expression casette (35S::LTP2 ﹕ ﹕ RFP (r) ﹕ ﹕ PINII).The rice callus that contains this expression cassette and seed present the redness that is very easy to identification under fluorescence excitation, and therefore this expression cassette is in the present invention for the selection markers of genetic transformation with for identification and sorting maintenance line and male-sterile seed.
Thus, can pass through routine techniques, aforementioned construct is incorporated in corresponding vegetable cell, tissue or organ, can the follow-up sample for studying, hybridizing to obtain.Thereby, in a fifth aspect of the present invention, the present invention proposes a kind of vegetable cell, tissue or organ.Known according to foregoing, in this vegetable cell, tissue or organ, contain foregoing construct.
In the present invention, described by nucleotide sequence or construct " introducing " to plant, expression can obtain by the method directly transforming, as vegetable cell, tissue or organ are carried out to agriculture bacillus mediated conversion, microparticle bombardment, electroporation, or several different methods well known by persons skilled in the art is any; Or, can, by plant and another plant with heterologous nucleotide sequence are hybridized to obtain, make its offspring there is this heterologous nucleotide sequence.Particularly, can pass through routine techniques, for example agrobacterium-mediated transformation, is incorporated into aforementioned construct in cell, tissue or the organ of paddy rice, can the follow-up sample for studying, hybridizing to obtain.Thereby, the present invention proposes a kind of rice cell, tissue or organ.According to embodiments of the invention, in this rice cell, tissue or organ, contain foregoing construct.
In a sixth aspect of the present invention, the present invention proposes a kind of method that builds male sterility line of plants and maintenance line.According to embodiments of the invention, the method comprises: foregoing construct is incorporated into the first plant and isozygotys in recessive male sterile plants, to obtain the second plant of foreign gene-carrying, described the second rice plant can produce can educate male gamete, pass through self-fertility, separablely obtain the transgenic seed that foreign gene isozygotys, and further cultivation becomes plant and sterile line pollination hybridization, make sterile line recover solid, seed genetic background (the isozygoty recessive male sterility gene site identical with the second plant obtaining, heterozygosis foreign gene site), make this second plant obtain expanding numerous, thereby be configured to stable maintenance line, expand maintenance line (the recessive male sterility gene site of isozygotying obtaining after numerous by described the second plant or by the second plant, heterozygosis foreign gene site) hybridize with sterile line pollination, make sterile line plant recover solid, produce the seed of the not foreign gene-carrying of half, thereby build male sterility line of plants.Further, constructed maintenance line can produce pollen and the pollen of foreign gene-carrying not of the foreign gene-carrying of equivalent, after sterile line pollination hybridization, makes sterile line plant recover solid, obtains that two classes are carried respectively and the seed of foreign gene-carrying not.Wherein, the seed of foreign gene-carrying, as maintenance line, can continue continuously to produce sterile line and maintenance line with sterile line hybridization, and the plant of foreign gene-carrying not can be used as the parent of sterile line as hybridization.
In a seventh aspect of the present invention, particularly, the present invention proposes a kind of method that builds male sterible series of rice and maintenance line.According to embodiments of the invention, the method comprises: foregoing construct is incorporated into the first paddy rice and isozygotys in recessive male sterile plants, to obtain the second rice plant of foreign gene-carrying, described the second rice plant can produce can educate male gamete, pass through self-fertility, separablely obtain the transgenic seed that foreign gene isozygotys, and further cultivation becomes plant and sterile line hybridization, make sterile line recover solid, seed genetic background (the isozygoty recessive male sterility gene site identical with the second plant obtaining, heterozygosis foreign gene site), make this second rice plant obtain expanding numerous, thereby be configured to stable maintenance line, expand maintenance line (the recessive male sterility gene site of isozygotying obtaining after numerous by described the second rice plant or by the second rice plant, heterozygosis foreign gene site) hybridize with sterile line pollination, make sterile line plant recover solid, produce the seed of the not foreign gene-carrying of half, thereby build male sterible series of rice.Further, constructed maintenance line can produce pollen and the pollen of foreign gene-carrying not of the foreign gene-carrying of equivalent, after sterile line pollination hybridization, makes sterile line plant recover solid, obtains that two classes are carried respectively and the seed of foreign gene-carrying not.Wherein, the seed of foreign gene-carrying, as maintenance line, can continue continuously to produce sterile line and maintenance line with sterile line hybridization, and the plant of foreign gene-carrying not can be used as the parent of sterile line as hybridization.Thus, can be effectively for paddy rice cross breeding.
In a eighth aspect of the present invention, the present invention proposes a kind of method of recovering paddy rice sterile plant male fertile.According to embodiments of the invention, the method comprises: foregoing construct is incorporated into paddy rice and isozygotys in recessive male sterile plants.
In a ninth aspect of the present invention, the present invention proposes a kind of method of preparing rice paddy seed.According to embodiments of the invention, the method comprises the following steps: foregoing construct is incorporated in rice plant; And by described rice plant selfing, separablely obtain the transgenic seed that foreign gene isozygotys, and further cultivate become plant with sterile line hybridization, to obtain the seed that contains foregoing construct.
In a tenth aspect of the present invention, the present invention proposes a kind of rice conversion material.According to embodiments of the invention, in the genome of this rice conversion material, comprise and be selected from SEQ ID NO:3 and 9 at least one DNA sequence dna.Thus, according to embodiments of the invention, the present invention proposes a plant material, wherein, in the genome of described vegetable material, comprised at least one DNA sequence dna or its complementary sequence that are selected from SEQ ID NO:3 and 9.And the present invention proposes the seed, cell and the tissue that are obtained by this plant derivation.
In a eleventh aspect of the present invention, the present invention proposes a kind of method for the preparation of hybrid rice.According to embodiments of the invention, the method adopts Novel rice male sterile line and maintenance line, and this Novel rice male sterile line and maintenance line are that the method by building male sterible series of rice and maintenance line above builds.
In a twelveth aspect of the present invention, the present invention proposes the purposes of male sterible series of rice in preparation hybrid rice.According to embodiments of the invention, described male sterible series of rice is that the method by building male sterible series of rice above builds.
In still another aspect of the invention, the invention allows for a kind of method that builds male sterible series of rice, it is to utilize molecule marker and hybridization initiative Novel rice sterile line.According to embodiments of the invention, the method comprises: adopt paddy rice ms26/ms26 male sterile plants as female parent, the described paddy rice Recessive alleles that isozygotys that recessive male sterile plants comprises Ms26 gene that isozygotys; Described female parent and recurrent parent are carried out to backcross transformation, to obtain the male sterible series of rice with described recurrent parent proterties, wherein, described recurrent parent does not have the Recessive alleles that isozygotys of Ms26 gene.Thus, utilize method of the present invention, can, on ms26 isozygotys the basis of recessive male rice sterile line, develop the sterile line of more different genetic backgrounds.According to embodiments of the invention, utilize conventional back cross breeding method, all dissimilar paddy rice can be formulated into corresponding sterile line, and hybrid vigour resource utilization is reached more than 95%.
Additional aspect of the present invention and advantage in the following description part provide, and part will become obviously from the following description, or recognize by practice of the present invention.
Accompanying drawing explanation
Above-mentioned and/or additional aspect of the present invention and advantage accompanying drawing below combination is understood becoming the description of embodiment obviously and easily, wherein:
Fig. 1 is the structural representation of plant expression vector pZN1 according to an embodiment of the invention, wherein, from right margin (RB) to left margin (LB), comprise successively OsCYP704B2 gene expression frame, 35S enhanser:: Ltp2 promotor:: red fluorescent protein gene (RFP):: PINII terminator expression cassette;
Fig. 2 is the structure schematic diagram of plant expression vector pZN1 according to an embodiment of the invention;
Fig. 3 has shown according to one embodiment of the invention, the acceptor material that the recessive sterile ms26/ms26 mutant of paddy rice core is genetic transformation, the transformant obtaining by the construct of conversion Fig. 1 and Fig. 2 is passed through self-fertility, separablely obtain the transgenic seed (Fig. 3-1) that foreign gene isozygotys, and further cultivation becomes plant and sterile line pollination hybridization expansion numerous (Fig. 3-2), the transgenic seed that obtains foreign gene heterozygosis is cultivated into after plant further and sterile line hybridization, makes sterile line recover the solid schematic diagram (Fig. 3-3) that obtains sterile line and maintenance line;
Fig. 4 has shown after maintenance line and sterile line pollination hybridization according to an embodiment of the invention, the fluorescent seeds of the solid generation of sterile line plant and the result of non-fluorescent seeds;
Fig. 5 shows according to one embodiment of the invention, carrys out to build by backcross transformation the schematic flow sheet of sterile line by the method for molecule marker assisting sifting (MAS).
Fig. 6 has increased after 35S enhanser (35S enhancer) before being presented at the promotor of fluorogene of carrier, the fluorescence intensity of the seed that this carrier produces all will be far away higher than the transgenic seed of other carriers that does not increase 35S enhancer sequence, wherein LTP2 is promotor, and RFP is red fluorescent protein gene.
Detailed description of the Invention
Describe embodiments of the invention below in detail.Be exemplary below by the embodiment being described with reference to the drawings, be intended to for explaining the present invention, and can not be interpreted as limitation of the present invention.
All reference mentioned in this article are all incorporated to herein by reference.
Indicate unless had on the contrary, all technology used herein and scientific terminology all have common the understood identical implication with one skilled in the art of the present invention.Indicate unless had on the contrary, technology that use or that mention is standard technique known to a person of ordinary skill in the art herein.Material, method and example are only used as to set forth, but not are limited.
Term " first ", " second " be only for describing object, and can not be interpreted as indication or hint relative importance or the implicit quantity that indicates indicated technical characterictic.Thus, one or more these features can be expressed or impliedly be comprised to the feature that is limited with " first ", " second ".In description of the invention, the implication of " multiple " is two or more, unless otherwise expressly limited specifically.
The following discovery of the present invention based on contriver completes: contriver is isozygotied the recessive sterile mutant of core as genetic transformation acceptor material take paddy rice, by closely linked 2 target genes are converted into sterile line, wherein, fertility restorer gene can make transformation receptor and maintenance line fertility restorer, screening-gene can be for after maintenance line and sterile line hybridization, the sorting of the transgenic seed that sterile line plant is solid and non-transgenic seed, the non-transgenic seed sorting out is produced cross-fertilize seed as sterile line, transgenic seed comes continuously as maintenance line and sterile line pollination hybridization, stably produce sterile line and maintenance line.For example, according to one embodiment of present invention, can isozygoty the recessive sterile ms26/ms26 mutant of core as transformation receptor material take paddy rice, closely linked 2 target genes are converted into sterile line: fertility restorer gene OsCYP704B2(Ms26) can make transformation receptor and maintenance line fertility restorer, after fluorescence color selects gene for maintenance line and sterile line hybridization, the sorting of the transgenic seed during sterile line is solid and non-transgenic seed, the non-transgenic seed sorting out is produced cross-fertilize seed as sterile line, transgenic seed hybridizes to come continuously as maintenance line and sterile line, stably produce sterile line and maintenance line.This technology utilizes biotechnology to produce non-transgenic product, has solved the bottleneck problem facing in paddy rice cross breeding production of hybrid seeds process, i.e. three series resource utilization problem low and sterile line fertility instability in bilinear method.
Thus, in one embodiment of the present of invention, the present invention proposes a kind of construct.According to embodiments of the invention, this construct comprises: the first expression cassette, and described the first expression cassette contains the first nucleic acid molecule, and described the first nucleic acid molecule encoding male sterility of rice recovers gene; And second expression cassette, described the second expression cassette contains the second nucleic acid molecule, described the second nucleic acid molecule encoding screening-gene.Utilize this construct, can effectively male sterility of rice be recovered to gene and screening-gene is incorporated into for example paddy rice of rice plant and isozygotys in recessive male sterile plants, thereby obtain the fertile plant of foreign gene-carrying through self-fertility, isolating the cultivating seeds that foreign gene isozygotys becomes after plant, expand and make the solid and seed of results of sterile line after numerous with sterile line pollination hybridization, can be used as maintenance line, the male-sterile seed of foreign gene-carrying and plant thereof can be as the parents among hybridization.Thus, can be effectively for paddy rice cross breeding.
In this article, the form of construct is not particularly limited, and according to concrete example of the present invention, it can be plasmid, phage, artificial chromosome, clay (Cosmid), virus at least one.According to concrete example of the present invention, construct (sometimes also referred to as expression vector, Genetic carrier or carrier) is the form of plasmid.Plasmid is as Genetic carrier, has simple to operately, can carry the character compared with large fragment, convenient operation and processing.The form of plasmid is also not particularly limited, and can be both circular plasmids, can be also linear plasmid, can be strand, can be also double-stranded.Those skilled in the art can select as required.According to embodiments of the invention, can adopt Ti carrier, for example can adopt the first and second expression cassettes are arranged between the border, left and right of T-DNA of expression vector pZN1.Thus, can the first and second expression cassettes be converted into acceptor plant by agriculture bacillus mediated method for transformation, for example, in paddy rice ms26/ms26 recessive nucleus male sterility mutant, thus, can obtain the not Transgenic Rice strain containing Herbicid resistant marker gene and antibiotics resistance marker gene, through self-fertility, and further expand the stable maintenance line of numerous rear acquisition according to method of the present invention, the maintenance line so obtaining has following features: (1) maintenance line produces two class pollen, half pollen is not containing foreign gene, and half contains foreign gene; (2) maintenance line and sterile line hybridization, sterile line can be solid, tie can breeding son be 1:1 with the ratio of sterile seed, fertile plant (with foreign gene) is as maintenance line, can be by producing easily, continuously sterile line and maintenance line with sterile line hybridization, sterile strain (not containing transgene component) is used as the parent of hybrid seeding on producing; (3) because sterile strain, not containing transgenosis, does not therefore contain transgenosis with the cenospecies of its production, the paddy rice commodity grain of producing with this cross-fertilize seed does not more contain transgenosis, thereby has eliminated the hidden danger of genetically modified organism safety.This novel cross-breeding system makes full use of rice heterosis, and practicable technology new breakthrough is provided.
The term " nucleic acid " that used in the present invention can be any polymkeric substance that comprises deoxyribonucleotide or ribonucleotide, includes but not limited to that its length is not subject to any special restriction through that modify or not modified DNA, RNA.For the carrier for building reconstitution cell, preferred nucleic acid is DNA, because DNA is for RNA, it is more stable, and easy handling.
According to embodiments of the invention, male sterility of rice recovers the type of gene and is not particularly limited, and can adopt but be not limited to Ms26, Ms22, Ms45, Ms1, etc.In one embodiment of the invention, described male sterility of rice recovers the nucleotide sequence of gene as shown in SEQ ID NO:9, and its coding has the protein of the aminoacid sequence as shown in SEQ ID NO:10.That is, it is OsCYP704B2(Ms26 that the male sterility of rice that can adopt recovers gene), thus, can set it as the wild-type fertility restorer gene of paddy rice acceptor ms26/ms26 homozygous mutation body (holandry is sterile).The albumen of OsCYP704B2 genes encoding belongs to cytochrome P-450 family, at the P8 of anther development to specifically expressing in the suede adhesion coating in P10 stage and sporule.After this transgenation, can cause suede adhesion coating to expand, extine is incomplete and grow and stop and flower pesticide stratum corneum stops growing, thereby causes plant male sterile, and female fertility is normal.Further chemical composition analysis is found, in the flower pesticide of this deletion mutant body, almost can't detect cutin monomer, and then finds that the function of this gene is that catalysis produces the hydroxy fatty acid that contains 16 and 18 carbochains.
According to a particular embodiment of the invention, in one embodiment of the invention, described male sterility of rice recovers gene OsCYP704B2(Ms26) there is the nucleotide sequence as shown in SEQ ID NO:9.OsCYP704B2(Ms26 with wild-type) compared with gene, nucleotide sequence shown in SEQ ID NO:9 has been introduced respectively three single nucleotide mutations, but do not change the aminoacid sequence of its coding, position and the concrete sudden change of these three single nucleotide mutations on OsCYP704B2 gene coding region is respectively: 238 Nucleotide A sport C; The Nucleotide G of 240 sports C; The Nucleotide G of 243 sports C.Contriver is surprised to find, and utilizes the nucleotide sequence shown in this SEQ ID NO:9 can be convenient to distinguish foreign gene and native gene in various Molecular Identification, and can more effectively make the fertility of the sterile acceptor plant of paddy rice ms26/ms26 be restored.Paddy rice acceptor ms26/ms26 homozygous mutation body is through radiation-induced gained, sudden change is to cause (disappearance section physical location: ensembl plants oryza japonica group version64.6 (MSU6) chromosome3:3 by 3103bp disappearance (comprising the most of fragment of OsCYP704B2), 701,319-3,704,421).Large fragment deletion sudden change makes the probability of reverse mutation extremely low, and therefore sterile proterties is stable, thereby has ensured the stability of sterile line, reduces hybrid seeding risk.
In one embodiment of the invention, described the first expression cassette can further include: the first promotor, and described the first promotor is operationally connected with described the first nucleic acid molecule, and described the first promotor is microgamete specificity promoter; And first terminator, described the first terminator is operationally connected with described the first nucleic acid molecule.According to embodiments of the invention, the type of the first promotor and the first terminator is also not particularly limited.According to one embodiment of present invention, for OsCYP704B2(Ms26) gene, can adopt the sequence of endogenesis promoter, ORF district or genome sequence and the terminator of OsCYP704B2, be wild-type rice genome sequence.In one embodiment of the invention, described the first promotor has the nucleotide sequence as shown in SEQ ID NO:11.In one embodiment of the invention, described the first terminator has the nucleotide sequence as shown in SEQ ID NO:12.Contriver is surprised to find, utilize the combination of this promotor and terminator, can further improve significantly the efficiency of expressing corresponding protein, and then can improve the efficiency of utilizing construct to build maintenance line and sterile line, and can more effectively make the fertility of the sterile acceptor plant of paddy rice ms26/ms26 be restored.
In addition, according to embodiments of the invention, construct can further include: the second expression cassette, and described the second expression cassette comprises the second nucleic acid molecule, described the second nucleic acid molecule encoding screening-gene, described screening-gene is bioluminescence gene.Thus, be convenient to determine by the expression of screening-gene whether plant and part thereof contain the gene that construct is introduced.
According to embodiments of the invention, can adopt be selected from red fluorescence gene, cyan fluorescent protein gene, yellow fluorescence protein gene, luciferase gene, green fluorescence protein gene, anthocyanin p1 gene and careless fourth phosphinothricin acetyl transferring enzyme encoding gene at least one as screening-gene, but be not limited to these and can be used as the gene of screening.In one embodiment of the invention, can adopt red fluorescent protein as screening-gene.Red fluorescent protein gene (RFP), derives from reef coral (Discosoma sp.), is the gene order in unique non-food crop source in expression cassette.Red fluorescent protein maximum absorption wavelength is 558nm, and maximum emission wavelength is 583nm.By the aminoacid sequence of RFP coding, by showing with anaphylactogen and toxalbumin sequence alignment, similarity is extremely low, nontoxicity and sensitization.RFP is commonly used for the screening-gene of genetic transformation, and the safe thing topic of genetically modified organism never occurred.In one embodiment of the invention, described screening-gene RFP has the nucleotide sequence as described in SEQ ID NO:3.Nucleotide sequence described in SEQ ID NO:3, compared with wild-type RFP gene (its nucleotide sequence is as shown in SEQ ID NO:4), has two single nucleotide mutations, called after RFP (r).These two single nucleotide mutations are respectively: be converted to G, be converted to C by the 315th bit base G by the 21st bit base C.Contriver is surprised to find, and the sudden change in these two sites can be expressed red fluorescent protein more effectively, strengthens the expression of red fluorescent protein gene in paddy rice.
In one embodiment of the invention, described the second expression cassette further comprises: the second promotor, described the second promotor is operationally connected with described the second nucleic acid molecule, and described the second promotor is the specific promotor such as callus and/or seed, seed coat, embryo and endosperm; The second terminator, described the second terminator is operationally connected with described the second nucleic acid molecule.In one embodiment of the invention, described the second promotor has the nucleotide sequence as shown in SEQ ID NO:2.In one embodiment of the invention, described the second terminator has the nucleotide sequence as shown in SEQ ID NO:6.Thus, according to one embodiment of present invention, the opening code-reading frame of RFP (r) is connected in from corn and between callus and seed (seed coat) specificity promoter LTP2 and the terminator PIN II from potato, before LTP2 promotor, also have a 35S enhancer sequence from tobacco mosaic virus (TMV), reassemble into RFP (r) expression casette (35Senhancer::LTP2 ﹕ ﹕ RFP (r) ﹕ ﹕ PINII).The rice callus that contains this expression cassette and seed present the redness that is very easy to identification under fluorescence excitation, and therefore this expression cassette is in the present invention for the selection markers of genetic transformation with for identification and sorting maintenance line and male-sterile seed.
Thus, according to embodiments of the invention, can utilize construct according to an embodiment of the invention, using the recessive nucleus male sterility paddy rice (ms26/ms26) of isozygotying as the acceptor transforming, carry out genetic transformation, obtain integrating and contain following closely linked two foreign gene RFP (r) and Ms26(OsCYP704B2 fertile gene) rice plant, further through self-fertility, expand after numerous and obtain maintenance line.The insertion of foreign gene and endogenous recessive nucleus male sterility site (ms26/ms26) right and wrong of isozygotying are chain, foreign gene (comprising RFP (r) and the OsCYP704B2 gene) integration site that the transgenic paddy rice maintenance line therefore obtaining contains the recessive sterile site of the ms26/ms26 independently isozygotying and heterozygosis.
Thus, can pass through routine techniques, for example agrobacterium-mediated transformation, is incorporated into aforementioned construct in cell, tissue or the organ of paddy rice, can the follow-up sample for studying, hybridizing to obtain.Thereby, in a second aspect of the present invention, the present invention proposes a kind of rice cell, tissue or organ.According to embodiments of the invention, in this rice cell, tissue or organ, contain foregoing construct.In one embodiment of the invention, described rice cell, tissue or organ are from the paddy rice recessive male sterile plants that isozygotys.In one embodiment of the invention, the described paddy rice Recessive alleles that isozygotys that recessive male sterile plants comprises Ms26 gene that isozygotys.Thus, rice cell of the present invention, tissue or organ, can effectively keep strain and further hybridize with sterile strain for building.About the described feature and advantage of construct, be also applicable to this rice cell, tissue or organ above, repeat no more.
Thus, in a third aspect of the present invention, the present invention proposes a kind of method that builds paddy rice maintenance line and further produce male sterile line.According to embodiments of the invention, with reference to figure 3, the method comprises:
The first step: foregoing construct is incorporated into the first paddy rice and isozygotys in recessive male sterile plants, to obtain the second rice plant that carries external source goal gene, described the second rice plant can produce can educate male gamete, and external source goal gene in the second rice plant is in heterozygous state;
Second step, and then cultivate the second rice plant of obtaining, make after its selfing solid, can obtain 25% seed and be ms26/ms26 the isozygoty seed of background and 50% of recessive and external source goal gene that isozygotys is isozygoty recessiveness and external source goal gene heterozygosis background (being maintenance line seed) of ms26/ms26, after seed germination, can be by this two classes Seed Identification out by Genomic PCR and quantitative PCR;
The 3rd step, cultivating 25% ms26/ms26 that second step obtains the isozygoty seed of background of recessive and external source goal gene that isozygotys is plant, and selfing is expanded numerous, and solid seed is all ms26/ms26 recessiveness and the external source goal gene background of isozygotying of isozygotying;
The 4th step, cultivating the seed that the 3rd step obtains is plant, whole pollen that this plant produces all contain external source goal gene, by being the recessive male sterile line plant pollination hybridization of isozygotying, can make sterile line recover solid, the seed obtaining is all the ms26/ms26 recessive and external source goal gene heterozygosis background of isozygotying, and is maintenance line seed; Make maintenance line seed obtain expanding numerous by the 3rd step and the 4th step;
The 5th step, the maintenance line seed of cultivating the 4th step is plant (background be ms26/ms26 isozygoty recessive mutation site and external source goal gene heterozygosis), also 50% the background that can cultivate that second step obtains is that the isozygoty seed (maintenance line) of recessive and external source goal gene heterozygosis of ms26/ms26 is plant, the pollen half that maintenance line plant produces contains external source goal gene, half is not containing external source goal gene, after hybridizing with the recessive male sterile line plant pollination of isozygotying, it is solid that male sterile line plant recovers, and produce two class seeds, wherein to contain external source goal gene be red fluorescence seed (background be ms26/ms26 isozygoty recessive mutation site and external source goal gene heterozygosis) to half, can be further used as maintenance line and sterile line pollination hybridization production sterile line and maintenance line seed, second half do not contain external source goal gene be the normal seed of non-fluorescence (background be ms26/ms26 isozygoty recessive mutation site and do not contain external source goal gene composition), can be further used as sterile line is cross-breeding.Two class seeds have or not fluorescence to be selected instrument to detect and to be sorted out by look easily according to it.
According to embodiments of the invention, the first paddy rice Recessive alleles that isozygotys that recessive male sterile plants comprises Ms26 gene that isozygotys.In addition, according to embodiments of the invention, can carry out seed sorting by fluoroscopic examination, whether carry bioluminescence gene by detecting rice paddy seed, for example, whether send fluorescence and sort, distinguish its whether foreign gene-carrying, as shown in Figure 4.About the described feature and advantage of construct, be also applicable to the method above, repeat no more.
In a fourth aspect of the present invention, the present invention proposes a kind of method of recovering paddy rice sterile plant male fertile.According to embodiments of the invention, the method comprises: foregoing construct is incorporated into paddy rice and isozygotys in recessive male sterile plants.In one embodiment of the invention, the described paddy rice Recessive alleles that isozygotys that recessive male sterile plants comprises Ms26 gene that isozygotys.About the described feature and advantage of construct, be also applicable to the method above, repeat no more.
In a fifth aspect of the present invention, the present invention proposes a kind of method of preparing rice paddy seed.According to embodiments of the invention, the method comprises the following steps: foregoing construct is incorporated in rice plant, further self-fertility, be maintenance line through expanding numerous again; By described paddy rice maintenance line and sterile line pollination hybridization, to obtain two class seeds on sterile line plant, contain the maintenance line seed of foregoing construct and do not contain the male-sterile seed of aforementioned construct.In one embodiment of the invention, described rice plant is the paddy rice recessive male sterile plants that isozygotys.In one embodiment of the invention, the described paddy rice Recessive alleles that isozygotys that recessive male sterile plants comprises Ms26 gene that isozygotys.
In a sixth aspect of the present invention, the present invention proposes a kind of genetic transformation material.According to embodiments of the invention, described genetic transformation material isozygotys in recessive male sterile plants and obtains by foregoing construct being incorporated into paddy rice.In one embodiment of the invention, the described paddy rice Recessive alleles that isozygotys that recessive male sterile plants comprises Ms26 gene that isozygotys.In one embodiment of the invention, introduce described construct by agrobacterium-mediated transformation.
In a seventh aspect of the present invention, the present invention proposes a kind of method for the preparation of hybrid rice.According to embodiments of the invention, described male sterible series of rice is that the method by building male sterible series of rice above builds.The method adopts male sterible series of rice, can further carry out paddy rice cross breeding, improves the efficiency of paddy rice cross breeding.About the described feature and advantage of construct, be also applicable to the method above, repeat no more.
In a eighth aspect of the present invention, the present invention proposes the purposes of male sterible series of rice in preparation hybrid rice.According to embodiments of the invention, described male sterible series of rice is that the method by building male sterible series of rice above builds.Thus, can further utilize male sterible series of rice of the present invention to carry out paddy rice cross breeding, improve the efficiency of paddy rice cross breeding.About the described feature and advantage of construct, be also applicable to this purposes above, repeat no more.
In still another aspect of the invention, the invention allows for a kind of method that builds male sterible series of rice.According to embodiments of the invention, the method comprises and adopts paddy rice to isozygoty recessive male sterile plants as female parent, the described paddy rice Recessive alleles that isozygotys that recessive male sterile plants comprises ms26 gene that isozygotys; Female parent and recurrent parent are carried out to backcross transformation, to obtain the male sterible series of rice with described recurrent parent proterties, wherein, described recurrent parent does not have the Recessive alleles that isozygotys of Ms26 gene.Thus, utilize method of the present invention, can, on ms26 isozygotys the basis of recessive male rice sterile line, develop the sterile line of more different genetic backgrounds.According to embodiments of the invention, utilize conventional back cross breeding method, all dissimilar paddy rice can be formulated into corresponding sterile line (can produce continuously corresponding sterile line kind), and the hybrid vigour utilization of resources is reached more than 95%.
According to embodiments of the invention, the strain that can be used as recurrent parent is not particularly limited, according to specific embodiment, recurrent parent can have be selected from that combining ability is strong, plant type good, at least one proterties of disease-resistant, pest-resistant and high yield.Thus, can obtain the male rice sterile line with these proterties.According to embodiments of the invention, recurrent parent can in order to be selected from, Tian Feng, China 268, China be extensive 624, China 211, China are extensive 3411, China is extensive 451, China is extensive 2855, R608, China are extensive 374, China is extensive 3501, H451, R608, China account for, Huang Huazhan, H268, H819, Fujian, Shanghai round-grained rice etc. at least one.
According to a particular embodiment of the invention, with reference to figure 5, can come to build sterile line by backcross transformation by the method for molecule assisting sifting (MAS).Particularly, as shown in Figure 5, according to embodiments of the invention, described female parent and recurrent parent are carried out backcrossing at least 3 times.In addition, in the process backcrossing, can assist and carry out foreground selection and background selection by molecule marker.
Further, according to embodiments of the invention, the method for above-mentioned structure male sterible series of rice can comprise the following steps:
First, ms26/ms26 mutant (MS26 isozygoty recessive male rice sterile line) and recurrent parent are hybridized, obtain hybridizing F1;
Next, F1 and recurrent parent are backcrossed, obtain BC1F1;
Next, BC1F1 and recurrent parent are backcrossed, obtain BC2F1;
Then, BC2F1 is carried out to selfing, obtain BC2F2;
Then, BC2F2 and recurrent parent are backcrossed, to obtain BC3F1;
Finally, BC3F1 is carried out to selfing, obtain the new sterile line BC3F2 building.
According to embodiments of the invention, can carry out prospect (ms26 and foreign gene) selection and background selection (recurrent parent) to backcrossing with selfing product by molecule marker, to accelerate the initiative of novel sterile line.According to embodiments of the invention, can be that method by foregoing structure sterile line builds and obtains for the paddy rice of the backcross transformation recessive male sterile plants that isozygotys.About the described feature and advantage of construct, be also applicable to the method above, repeat no more.
It should be noted that, be that present inventor just completes through arduous creative work and Optimization Work according to construct of the embodiment of the present invention and uses thereof.During embodiment is stated, except as otherwise noted, the implication of " multiple " is two or more.
According to specific embodiment, the present invention will be described below.It should be noted that, these embodiment are only used to illustrate the present invention, and can not be interpreted as by any way limitation of the present invention.In addition, unless stated otherwise, related method is ordinary method in the following embodiments, and related material and preparation are also commercially available.
Specific embodiment
If do not specialize, the conventional means that the technique means adopting in embodiment is well known to those skilled in the art, can carry out with reference to " molecular cloning experiment guide " third edition or related products.The unreceipted person of production firm of agents useful for same or instrument, being can be by the conventional products of commercial acquisition.
Embodiment 1: rice fertility regulation and control vector construction
By assembling following DNA element, the expression vector that is called as pZN1 shown in design of graphics 1:
The first step: synthetic LTP2::RFP::PINII sequence, its DNA sequence dna is as shown in SEQ ID NO:1.Pin II-RFP (the 2SNP)-ltp2 sequence of pcr amplification synthetic, amplimer is:
F1:CTT
cGCATTCGCAAAACACACCTAGAC; In square frame, it is restriction enzyme Nae I restriction enzyme site;
R1:CAA
aTTGCAGTAC
aACCGTCTCTTCGTGAGAATAACCG, is respectively Pme I and Asc I restriction enzyme site in square frame.
Increase to such an extent that Pin II-RFP (2SNP)-ltp2 fragment (SEQ ID NO:1) connects after T order-checking correctly, with Nae I and Pme I
Double digestion is connected into the pCAMBIA1300 plasmid that Xmn I and Pme I enzyme are cut, and identifies and correctly obtains intermediate carrier 1.
Second step: from oryza sativa genomic dna, increase respectively cyp1 and cyp2, the amplimer of cyp1 is:
F2:TAT
gATTGGTCGAACACGAGGTAGGCG is Asc I restriction enzyme site in square frame;
R2:TCGAAGGACCGCACCGTGACC
aTG, is Sal I restriction enzyme site in square frame, and shade base is used the codon that paddy rice frequency of utilization is high and three SNP that specially introduce in order to distinguish the endogenous CYP sequence of paddy rice simultaneously),
Cyp2 amplimer is:
F3:CAT
gGTCACGGTGCGGTCCTTCGA, is Sal I restriction enzyme site in square frame, and shade base is used the codon that paddy rice frequency of utilization is high and three SNP that specially introduce in order to distinguish the endogenous CYP sequence of paddy rice simultaneously;
R3:ATA
aGGTGGAAGACAAGGTGGTGAGGAT be Pme I restriction enzyme site in square frame) two fragments, connect after the order-checking correctly of T-carrier, use respectively again AscI, Sal I and Sal I, Pme I double digestion, be connected into simultaneously and use Asc I, the intermediate carrier 1 of Pme I double digestion, identifies and correctly obtains intermediate carrier 2.
The 3rd step: the 35S enhancer sequence of pcr amplification synthetic, amplimer is:
F4:TT
aTCACATCAATCCACTTGCTTTGA is Asc I restriction enzyme site in square frame;
R4:GA
cGTCAACATGGTGGAGCACGACAC, is Asc I restriction enzyme site in square frame, increases to such an extent that 35S enhanser fragment connects after T order-checking correctly, is connected into the intermediate carrier 2 that Asc I enzyme cuts with Asc I enzyme after cutting, and identifies and correctly obtains carrier pZN1.
Embodiment 2: the acquisition of maintenance line, the production of expanding numerous and sterile line and principle
By designing and verifying, the invention provides a kind of structure paddy rice maintenance line, and the method for further producing male sterile line.According to embodiments of the invention, with reference to figure 3, the method comprises:
The first step: the construct described in embodiment 1 (contain fertility restorer gene and look selects gene expression frame) is incorporated into paddy rice by genetic transformation and isozygotys in recessive male sterile plants (ms26/ms26), obtain the T0 of foreign gene-carrying and can produce and can educate male gamete for rice plant, and T0 for the foreign gene of transfer-gen plant in heterozygous state (Fig. 3-1);
Second step, the T0 that the cultivation the first step obtains is for transfer-gen plant, make after its selfing solid, the T1 obtaining can be divided three classes according to genetic background for seed, wherein 25% seed is the ms26/ms26 recessive and foreign gene background of isozygotying of isozygotying, 50% seed is the ms26/ms26 recessive and foreign gene heterozygosis background (can be directly as maintenance line, enter following the 5th step and hybridize with sterile line) of isozygotying, and 25% seed is isozygoty recessive male sterile and do not contain transgenosis of ms/ms in addition; By seed fluorescence color choosing, 25% the non-fluorescent seeds that does not contain foreign gene is separated, and further cultivate after other all fluorescent seeds germinations of 75%, by extracting the genomic dna of seedling leaves, carry out seed or seedling that Genomic PCR or Q-PCR technology can contain foreign gene composition by two classes and identify out respectively (Fig. 3-1);
The 3rd step, cultivating in second step 25% ms26/ms26 the isozygoty T1 of background of recessive and foreign gene that isozygotys is that T1 is for plant for seed or seedling, being all the ms26/ms26 recessive and foreign gene background of isozygotying of isozygotying by T2 seed solid after selfing, is red fluorescence seed;
The 4th step, cultivating T2 in the 3rd step is that T2 is for plant for seed, these plant are the ms26/ms26 recessive and foreign gene background of isozygotying of isozygotying, be the recessive male sterile line plant pollination hybridization of isozygotying by these plant, can make sterile line plant recover normally solid, the seed obtaining be all ms26/ms26 isozygoty recessiveness and foreign gene heterozygosis background, be red fluorescence seed, be maintenance line, be able to thus the seed (Fig. 3-2) of fast-propagation maintenance line by the 3rd step and the 4th step;
The 5th step, the maintenance line seed of cultivating the 4th step is plant (background be ms26/ms26 isozygoty recessive and foreign gene heterozygosis), also can cultivate 50% the background producing in the first step simultaneously and be the isozygoty maintenance line seed of recessive and foreign gene heterozygosis of ms26/ms26 is plant, the pollen half that the maintenance line in these sources produces contains foreign gene, half is not containing foreign gene in addition, with the recessive male sterile line plant pollination hybridization of isozygotying, male sterile line is able to solid, in the seed producing, half 50% contains foreign gene and is red fluorescence seed (background be ms26/ms26 isozygoty recessive mutation site and foreign gene heterozygosis), can be further used as maintenance line, second half 50% do not contain foreign gene and for the non-fluorescent seeds of normal color (background be ms26/ms26 isozygoty recessive mutation site and do not contain transgene component), be sterile line.This two classes seed can select instrument to sort out by look, the seed that contains fluorescence repeats the experiment of the 4th step as maintenance line, can continue to expand numerous seed that obtains equivalent maintenance line and sterile line, and be not used as containing the genetically modified non-fluorescent seeds of external source, sterile line is cross-breeding or the production of hybrid seeds (Fig. 3-3).
Embodiment 3: rice conversion
Utilize heat shock method that plasmid pZN1 is proceeded to Agrobacterium AGL0 bacterial strain, utilize agrobacterium-mediated transformation to carry out cotransformation to paddy rice, concrete transformation receptor material is the sterile homozygous mutation body of paddy rice ms26/ms26 holandry, see Chinese patent CN200910309083.1 and The Plant Cell Vol.22:173-190 about the specific descriptions of this material, in January, 2010, this material the current public can obtain, by these two pieces of documents references are incorporated to herein.Obtain the Transgenic Rice material of pZN1 carrier by genetic transformation process.
It should be noted that, also can, by the method for conventional gene knockout, by after all or part of the knocking out of paddy rice Ms26 gene, obtain the sterile homozygous mutation body of paddy rice ms26/ms26 holandry.
Embodiment 4:T0 separates than analyzing for the solid seed of transfer-gen plant
The T0 obtaining by embodiment 3 is for transgenosis seedling (background be ms26/ms26 isozygoty recessive and foreign gene heterozygosis), through laboratory hardening, simultaneously by extracting seedling leaves genomic dna, and utilize after quantitative PCR preliminary evaluation transgenosis copy number, selecting foreign gene is the plant that single copy inserts, be transplanted to booth and field is cultivated, carry out phenotype comparative analysis with non-transgenic adjoining tree (No. 7, the military fortune of wild-type non-transgenic rice varieties round-grained rice), between the two, do not observe obvious modal difference, and the male fertile of transfer-gen plant is restored.Point individual plant list fringe results after solid, choose at random 30 single fringes of difference of 30 plant, analyzed the segregation ratio of fluorescent seeds and non-fluorescent seeds, result shows that the seed of all single fringes separates than being fluorescent seeds: non-fluorescent seeds=3:1, meets the expection of experimental design completely.In addition, contriver is surprised to find, during due to carrier design, in order to strengthen the intensity of fluorescence in seed, before the promotor of the fluorogene of carrier, increased the sequence of 35S enhanser, and the fluorescence intensity of the seed that this carrier produces all will be far away higher than the transgenic seed of other carriers that does not increase enhancer sequence.The high expression level fluorogene of more easily differentiating in seed, plays decisive role by the tolerance range of the sorting to seed, and this is successfully one of key (Fig. 6) of this technology.
Embodiment 5: maintenance line plant pollen fertility detects
The Transgenic Rice material obtaining by embodiment 3, according to the described experimentation of embodiment 2, has obtained maintenance line (background be ms26/ms26 isozygoty recessive mutation site and foreign gene heterozygosis).Maintenance line plant and non-transgenic adjoining tree (No. 7, the military fortune of wild-type non-transgenic rice varieties round-grained rice) are carried out to phenotype analytical, between the two, do not observe obvious modal difference, and its male fertility ability is also basic identical.
For example, (can educate for No. 7 with the military fortune of the wild-type non-transgenic rice varieties round-grained rice that transformation receptor strain is corresponding, below referred to as CK1) and No. 7 ms26 mutant of non-transgenic rice strain corresponding to transgenic paddy rice military fortune round-grained rice (sterile, below referred to as CK2) be contrast, carry out the pollen rate of can dying and detect.
In Rice Flowering late period, respectively randomly draw individual plant from transgenic paddy rice (maintenance line), CK1Ji CK2 community, a flower is got in each strain, and every flower is got 1 flower pesticide, is placed in slide glass central authorities, drips the I of one 1%
2-IK solution, with after tweezers and dissecting needle release pollen, covered, examines under a microscope, counts can dye pollen number and pollen frequency.CK1 normally can educate with the normal sterile prerequisite of CK2 under, the pollen of analyzing transgenic paddy rice (maintenance line) can dye rate.Result shows that the educated rate that can educate contrast (CK1) is between 98.6%～100%; Sterile contrast (CK2) can the rate of educating be 0; And in multiple transgenosis (maintenance line) plant that extract immediately, pollen staining ratio, all with can to educate contrast (CK1) identical, proves that fertility is normal.Be transgenosis (maintenance line) strain owing to having transformed aforesaid construct in No. 7 ms26/ms26 mutant of force fortune round-grained rice, make pollen fertility from sterile transfer to normal.
Embodiment 6: after maintenance line and sterile line pollination hybridization, fluorescent seeds that sterile line produces and non-fluorescent seeds segregation ratio
The Transgenic Rice material obtaining by embodiment 3, carry out after field test according to the described experimentation of embodiment 2, obtain maintenance line (background be ms26/ms26 isozygoty recessive mutation site and foreign gene heterozygosis), pollinate after hybridization with sterile line, make sterile line plant recover solid, segregation ratio to the fluorescence on sterile line plant and non-fluorescent seeds is investigated, fluorescence on result demonstration sterile line plant and the ratio of non-fluorescent seeds are 1:1(Fig. 4), show that the each element of the expression vector providing in the present invention (fertility restorer gene and fluorescence color are selected gene) expresses well as a whole.Be the pollen of constructed maintenance line (fluorescent seeds) foreign gene-carrying that can produce equivalent and the pollen of foreign gene-carrying not, after sterile line pollination hybridization, make sterile line plant recover solid, obtain that two classes are carried respectively and the seed of foreign gene-carrying not, wherein, the fluorescent seeds of foreign gene-carrying is as maintenance line, can continue continuously to produce sterile line and maintenance line with sterile line hybridization, and the plant of the normal cultivating seeds of non-fluorescence of foreign gene-carrying not can be used as the parent of sterile line as cross-breeding.
Table 1: after maintenance line and sterile line plant pollination hybridization, fluorescent seeds that sterile line is tied and non-fluorescent seeds are counted ratio
| Numbering | Fluorescence | Non-fluorescence | Ratio % |
| 1 | 58 | 59 | 0.98 |
| 2 | 136 | 130 | 1.04 |
| 3 | 98 | 100 | 0.98 |
| 4 | 106 | 103 | 1.03 |
| 5 | 88 | 82 | 1.07 |
| 6 | 145 | 156 | 0.93 |
| 7 | 89 | 93 | 0.96 |
| 8 | 134 | 138 | 0.97 |
| 9 | 168 | 165 | 1.02 |
| 10 | 98 | 102 | 0.96 |
| 11 | 123 | 127 | 0.97 |
| 12 | 111 | 110 | 1.00 |
As can be seen from the above-described embodiment, the present invention has realized the goal of the invention of its stable initiative male sterible series of rice and maintenance line.
Embodiment 7: backcross transformation initiative sterile line
In existing Rice Germplasm Resources, selection traits is good, as strong in combining ability, disease-resistant, the rice material of the good economical characters such as pest-resistant and high yield is as male parent (recurrent parent, in an embodiment, adopt sky rich, China 268, China extensive 624, China 211, China extensive 3411, China extensive 451, China extensive 2855, R608, China extensive 374, China extensive 3501, H451, R608, China accounts for, Huang Huazhan, H268, H819, Fujian, Shanghai round-grained rice etc. are as recurrent parent), using the transgenic maintainer line material obtaining by aforesaid method as female parent, by backcross transformation, recurrent parent is made into novel maintenance line and the sterile line (Fig. 5) with good character, greatly expand the hybridization utilization ratio of variety source, especially can change the present situation that almost there is no good double-line hybrid combination in japonica rice, can expand Japonica Hybrid cultivated area, expand heterosis utilization scope, improve the utilising efficiency of variety source.
Embodiment 8: novel fertility regulation and control construct and the purposes in rape thereof
Plant fertility regulation and control construct and crossbreeding technology thought proposed by the invention also have same effect in dicotyledons, such as in rape, can build equally the carrier that contains fertility restorer gene and screening-gene, by transforming corresponding male sterile homozygous mutation body, and obtain maintenance line by principle and the step of above-described embodiment 2, can produce pollen and the pollen of foreign gene-carrying not of the foreign gene-carrying of equivalent, after sterile line pollination hybridization, make sterile line plant recover solid, obtain that two classes are carried respectively and the seed of foreign gene-carrying not, wherein, the fluorescent seeds of foreign gene-carrying is as maintenance line, can continue continuously to produce sterile line and maintenance line with sterile line hybridization, and the plant of the normal cultivating seeds of non-fluorescence of foreign gene-carrying not can be used as the parent of sterile line as cross-breeding.
Industrial applicibility
Construct of the present invention, can be effectively applied to the structure of male sterible series of rice and maintenance line, and then male sterible series of rice and the maintenance line of the stable fertility obtaining, the production of cenospecies can be applied to efficiently, thereby the hybrid rice seeds of safety, high-quality can be obtained.
Although the specific embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.According to disclosed all instructions, can carry out various modifications and replacement to those details, these change all within protection scope of the present invention.Four corner of the present invention is provided by claims and any equivalent thereof.
In the description of this specification sheets, the description of reference term " embodiment ", " some embodiment ", " illustrative examples ", " example ", " concrete example " or " some examples " etc. means to be contained at least one embodiment of the present invention or example in conjunction with specific features, structure, material or the feature of this embodiment or example description.In this manual, the schematic statement of above-mentioned term is not necessarily referred to identical embodiment or example.And specific features, structure, material or the feature of description can be with suitable mode combination in any one or more embodiment or example.
SEQUENCE LISTING
<110> is name laboratory, prosperous system Crop Design forward position (Beijing) company limited not
<120> novel plant fertility regulation and control construct and uses thereof
<150> 201210449494.2
<151> 2012-11-12
<160> 19
<170> PatentIn version 3.3
<210> 1
<211> 1839
<212> DNA
<213> synthetic
<400> 1
aaccgtctct tcgtgagaat aaccgtggcc taaaaataag ccgatgagga taaataaaat 60
gtggtggtac agtacttcaa gaggtttact catcaagagg atgcttttcc gatgagctct 120
agtagtacat cggacctcac atacctccat tgtggtgaaa tattttgtgc tcatttagtg 180
atgggtaaat tttgtttatg tcactctagg ttttgacatt tcagttttgc cactcttagg 240
ttttgacaaa taatttccat tccgcggcaa aagcaaaaca attttatttt acttttacca 300
ctcttagctt tcacaatgta tcacaaatgc cactctagaa attctgttta tgccacagaa 360
tgtgaaaaaa aacactcact tatttgaagc caaggtgttc atggcatgga aatgtgacat 420
aaagtaacgt tcgtgtataa gaaaaaattg tactcctcgt aacaagagac ggaaacatca 480
tgagacaatc gcgtttggaa ggctttgcat cacctttgga tgatgcgcat gaatggagtc 540
gtctgcttgc tagccttcgc ctaccgccca ctgagtccgg gcggcaacta ccatcggcga 600
acgacccagc tgacctctac cgaccggact tgaatgcgct accttcgtca gcgacgatgg 660
ccgcgtacgc tggcgacgtg cccccgcatg catggcggca catggcgagc tcagaccgtg 720
cgtggctggc tacaaatacg taccccgtga gtgccctagc tagaaactta cacctgcaac 780
tgcgagagcg agcgtgtgag tgtagccgag taatggcctc ctccgagaac gtgatcaccg 840
agttcatgcg cttcaaggtg cgcatggagg gcaccgtgaa cggccacgag ttcgagatcg 900
agggcgaggg cgagggccgc ccctacgagg gccacaacac cgtgaagctg aaggtgacca 960
agggcggccc cctgcccttc gcctgggaca tcctgtcccc ccagttccag tacggctcca 1020
aggtgtacgt taagcacccc gccgacatcc ccgactacaa gaagctgtcc ttccccgagg 1080
gcttcaagtg ggagcgcgtg atgaacttcg aggacggcgg cgtggccacc gtgacccagg 1140
actcctccct gcaggacggc tgcttcatct acaaggtgaa gttcatcggc gtgaacttcc 1200
cctccgacgg ccccgtgatg cagaagaaga ccatgggctg ggaggcctcc accgagcgcc 1260
tgtacccccg cgacggcgtg ctgaagggcg agacccacaa ggccctgaag ctgaaggacg 1320
gcggccacta cctggtggag ttcaagtcca tctacatggc caagaagccc gtgcagctgc 1380
ccggctacta ctacgtggac gccaagctgg acatcacctc ccacaacgag gactacacca 1440
tcgtggagca gtacgagcgc accgagggcc gccaccacct gttcctgtag ttcgaacgcg 1500
taggtaccac atggttaacc tagacttgtc catcttctgg attggccaac ttaattaatg 1560
tatgaaataa aaggatgcac acatagtgac atgctaatca ctataatgtg ggcatcaaag 1620
ttgtgtgtta tgtgtaatta ctagttatct gaataaaaga gaaagagatc atccatattt 1680
cttatcctaa atgaatgtca cgtgtcttta taattctttg atgaaccaga tgcatttcat 1740
taaccaaatc catatacata taaatattaa tcatatataa ttaatatcaa ttgggttagc 1800
aaaacaaatc tagtctaggt gtgttttgcg aatgcggcc 1839
<210> 2
<211> 812
<212> DNA
<213> barley (Hordeum vulgare)
<400> 2
aaccgtctct tcgtgagaat aaccgtggcc taaaaataag ccgatgagga taaataaaat 60
gtggtggtac agtacttcaa gaggtttact catcaagagg atgcttttcc gatgagctct 120
agtagtacat cggacctcac atacctccat tgtggtgaaa tattttgtgc tcatttagtg 180
atgggtaaat tttgtttatg tcactctagg ttttgacatt tcagttttgc cactcttagg 240
ttttgacaaa taatttccat tccgcggcaa aagcaaaaca attttatttt acttttacca 300
ctcttagctt tcacaatgta tcacaaatgc cactctagaa attctgttta tgccacagaa 360
tgtgaaaaaa aacactcact tatttgaagc caaggtgttc atggcatgga aatgtgacat 420
aaagtaacgt tcgtgtataa gaaaaaattg tactcctcgt aacaagagac ggaaacatca 480
tgagacaatc gcgtttggaa ggctttgcat cacctttgga tgatgcgcat gaatggagtc 540
gtctgcttgc tagccttcgc ctaccgccca ctgagtccgg gcggcaacta ccatcggcga 600
acgacccagc tgacctctac cgaccggact tgaatgcgct accttcgtca gcgacgatgg 660
ccgcgtacgc tggcgacgtg cccccgcatg catggcggca catggcgagc tcagaccgtg 720
cgtggctggc tacaaatacg taccccgtga gtgccctagc tagaaactta cacctgcaac 780
tgcgagagcg agcgtgtgag tgtagccgag ta 812
<210> 3
<211> 678
<212> DNA
<213> synthetic
<400> 3
atggcctcct ccgagaacgt gatcaccgag ttcatgcgct tcaaggtgcg catggagggc 60
accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120
cacaacaccg tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180
ctgtcccccc agttccagta cggctccaag gtgtacgtta agcaccccgc cgacatcccc 240
gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300
gacggcggcg tggccaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360
aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420
atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480
acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540
tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600
atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660
caccacctgt tcctgtag 678
<210> 4
<211> 678
<212> DNA
<213> reef coral (Discosoma sp.)
<400> 4
atggcctcct ccgagaacgt catcaccgag ttcatgcgct tcaaggtgcg catggagggc 60
accgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 120
cacaacaccg tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc 180
ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc 240
gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 300
gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac 360
aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc 420
atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag 480
acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc 540
tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac 600
atcacctccc acaacgagga ctacaccatc gtggagcagt acgagcgcac cgagggccgc 660
caccacctgt tcctgtag 678
<210> 5
<211> 225
<212> PRT
<213> reef coral (Discosoma sp.)
<400> 5
Met Ala Ser Ser Glu Asn Val Ile Thr Glu Phe Met Arg Phe Lys Val
1 5 10 15
Arg Met Glu Gly Thr Val Asn Gly His Glu Phe Glu Ile Glu Gly Glu
20 25 30
Gly Glu Gly Arg Pro Tyr Glu Gly His Asn Thr Val Lys Leu Lys Val
35 40 45
Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile Leu Ser Pro Gln
50 55 60
Phe Gln Tyr Gly Ser Lys Val Tyr Val Lys His Pro Ala Asp Ile Pro
65 70 75 80
Asp Tyr Lys Lys Leu Ser Phe Pro Glu Gly Phe Lys Trp Glu Arg Val
85 90 95
Met Asn Phe Glu Asp Gly Gly Val Ala Thr Val Thr Gln Asp Ser Ser
100 105 110
Leu Gln Asp Gly Cys Phe Ile Tyr Lys Val Lys Phe Ile Gly Val Asn
115 120 125
Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr Met Gly Trp Glu
130 135 140
Ala Ser Thr Glu Arg Leu Tyr Pro Arg Asp Gly Val Leu Lys Gly Glu
145 150 155 160
Thr His Lys Ala Leu Lys Leu Lys Asp Gly Gly His Tyr Leu Val Glu
165 170 175
Phe Lys Ser Ile Tyr Met Ala Lys Lys Pro Val Gln Leu Pro Gly Tyr
180 185 190
Tyr Tyr Val Asp Ala Lys Leu Asp Ile Thr Ser His Asn Glu Asp Tyr
195 200 205
Thr Ile Val Glu Gln Tyr Glu Arg Thr Glu Gly Arg His His Leu Phe
210 215 220
Leu
225
<210> 6
<211> 349
<212> DNA
<213> potato (Solanum tuberosum)
<400> 6
ttcgaacgcg taggtaccac atggttaacc tagacttgtc catcttctgg attggccaac 60
ttaattaatg tatgaaataa aaggatgcac acatagtgac atgctaatca ctataatgtg 120
ggcatcaaag ttgtgtgtta tgtgtaatta ctagttatct gaataaaaga gaaagagatc 180
atccatattt cttatcctaa atgaatgtca cgtgtcttta taattctttg atgaaccaga 240
tgcatttcat taaccaaatc catatacata taaatattaa tcatatataa ttaatatcaa 300
ttgggttagc aaaacaaatc tagtctaggt gtgttttgcg aatgcggcc 349
<210> 7
<211> 33
<212> DNA
<213> synthetic primer
<400> 7
cttgccggcc gcattcgcaa aacacaccta gac 33
<210> 8
<211> 54
<212> DNA
<213> synthetic primer
<400> 8
caagtttaaa cattgcagta cggcgcgcca accgtctctt cgtgagaata accg 54
<210> 9
<211> 1930
<212> DNA
<213> paddy rice (Oryza sativa)
<400> 9
atgaagagcc ccatggagga agctcatgca atgccagtga catcattctt cccagtagca 60
ggaatccaca agctcatagc tatcttcctt gttgtcctct catggatctt ggtccacaag 120
tggagcctga ggaaccagaa agggccaaga tcatggccaa tcatcggcgc gacagtggag 180
caactgaaga actaccacag gatgcatgac tggcttgtcg agtacttgtc gaaggaccgc 240
accgtgaccg tcgacatgcc tttcacctcc tacacctaca ttgccgaccc ggtgaacgtc 300
gagcatgtcc tgaagaccaa cttcaccaat taccccaagg taaaagaacc ataggatctt 360
cagtgtactg taaaatgtgc cttgcacagt actaacactg acacaaaaaa tgtctgaaaa 420
tatgcagggt gaagtgtaca ggtcttacat ggatgtgctg ctcggtgatg gcatattcaa 480
tgccgacggc gagatgtgga ggaagcaaag gaagacggcg agcttcgagt ttgcctccaa 540
gaacttgaga gacttcagca ctgtggtgtt cagggagtac tccctgaagc tatcaagcat 600
tctgagccaa gcatgcaagg ccggcagagt tgtagacatg caggtaacca actgaattcc 660
ttgcctaata cctaaacatt tcttgagaaa ccaaattgtt cagaattctg atgcaagaac 720
taaccaaaat tcaggaattg ttcatgagga tgacactgga ctcgatctgc aaggtcgggt 780
ttggggttga gatcgggacg ctgtcacctg atctcccgga gaacagcttt gcccaggcat 840
tcgacgctgc caacatcatc gtcacgctgc ggttcatcga tcctctgtgg cgtctgaaga 900
agttcttgca cgtcggatca gaggctctcc tcgagcagag catgaagctg gttgatgact 960
tcacctacag cgtgatccgc cgccgcaagg ctgagatctt gcaggctcga gccagcggca 1020
agcaagagaa ggtgatcctt cctctcttgc tcaaagaatc agtagaactg aactgacatg 1080
gtaatggtga tgatcagatc ggaaaaggtt ttgtttcttg atatcgttga tttgtaatgg 1140
cgagcagatc aagcacgaca tactgtcgcg gttcatcgag ctcggggagg ccggcggcga 1200
cgaggggggc ggcagcttcg gggacgacaa gagcctccgc gacgtggtgc tcaacttcgt 1260
gatcgccggg cgtgacacga cggcgacgac gctgtcgtgg ttcacgtaca tggcgatgac 1320
gcacccggcc gtcgccgaca agctccggcg cgagctggcc gcgttcgagg atgagcgcgc 1380
gcgcgaggag ggcgtcgcgc tcgccgacgc cgccggcgag gcgtcgttcg cggcgcgcgt 1440
ggcgcagttc gcgtcgctgc tgagctacga cgcggtgggg aagctggtgt acctgcacgc 1500
gtgcgtgacg gagacgctcc gcctctaccc ggcggtgccg caggacccca aggggatcgt 1560
ggaggacgac gtgctccccg acggcaccaa ggtgcgcgcc ggcgggatgg tgacgtacgt 1620
gccctactcc atggggagga tggagtacaa ctggggcccc gacgcggcga gcttccggcc 1680
ggagcggtgg ctcagcggcg acggcggcgc gttccggaac gcgtcgccgt tcaagttcac 1740
cgcgttccag gccgggccgc ggatctgcct cggcaaggac tccgcctacc tccagatgaa 1800
gatggcgctc gccatcctct tccgcttcta caccttcgac ctcgtcgagg accaccccgt 1860
caagtaccgg atgatgacca tcctctccat ggctcacggc ctcaaggtcc gcgtctccac 1920
ctccgtctga 1930
<210> 10
<211> 544
<212> PRT
<213> paddy rice (Oryza sativa)
<400> 10
Met Lys Ser Pro Met Glu Glu Ala His Ala Met Pro Val Thr Ser Phe
1 5 10 15
Phe Pro Val Ala Gly Ile His Lys Leu Ile Ala Ile Phe Leu Val Val
20 25 30
Leu Ser Trp Ile Leu Val His Lys Trp Ser Leu Arg Asn Gln Lys Gly
35 40 45
Pro Arg Ser Trp Pro Ile Ile Gly Ala Thr Val Glu Gln Leu Lys Asn
50 55 60
Tyr His Arg Met His Asp Trp Leu Val Glu Tyr Leu Ser Lys Asp Arg
65 70 75 80
Thr Val Thr Val Asp Met Pro Phe Thr Ser Tyr Thr Tyr Ile Ala Asp
85 90 95
Pro Val Asn Val Glu His Val Leu Lys Thr Asn Phe Thr Asn Tyr Pro
100 105 110
Lys Gly Glu Val Tyr Arg Ser Tyr Met Asp Val Leu Leu Gly Asp Gly
115 120 125
Ile Phe Asn Ala Asp Gly Glu Met Trp Arg Lys Gln Arg Lys Thr Ala
130 135 140
Ser Phe Glu Phe Ala Ser Lys Asn Leu Arg Asp Phe Ser Thr Val Val
145 150 155 160
Phe Arg Glu Tyr Ser Leu Lys Leu Ser Ser Ile Leu Ser Gln Ala Cys
165 170 175
Lys Ala Gly Arg Val Val Asp Met Gln Glu Leu Phe Met Arg Met Thr
180 185 190
Leu Asp Ser Ile Cys Lys Val Gly Phe Gly Val Glu Ile Gly Thr Leu
195 200 205
Ser Pro Asp Leu Pro Glu Asn Ser Phe Ala Gln Ala Phe Asp Ala Ala
210 215 220
Asn Ile Ile Val Thr Leu Arg Phe Ile Asp Pro Leu Trp Arg Leu Lys
225 230 235 240
Lys Phe Leu His Val Gly Ser Glu Ala Leu Leu Glu Gln Ser Met Lys
245 250 255
Leu Val Asp Asp Phe Thr Tyr Ser Val Ile Arg Arg Arg Lys Ala Glu
260 265 270
Ile Leu Gln Ala Arg Ala Ser Gly Lys Gln Glu Lys Ile Lys His Asp
275 280 285
Ile Leu Ser Arg Phe Ile Glu Leu Gly Glu Ala Gly Gly Asp Glu Gly
290 295 300
Gly Gly Ser Phe Gly Asp Asp Lys Ser Leu Arg Asp Val Val Leu Asn
305 310 315 320
Phe Val Ile Ala Gly Arg Asp Thr Thr Ala Thr Thr Leu Ser Trp Phe
325 330 335
Thr Tyr Met Ala Met Thr His Pro Ala Val Ala Asp Lys Leu Arg Arg
340 345 350
Glu Leu Ala Ala Phe Glu Asp Glu Arg Ala Arg Glu Glu Gly Val Ala
355 360 365
Leu Ala Asp Ala Ala Gly Glu Ala Ser Phe Ala Ala Arg Val Ala Gln
370 375 380
Phe Ala Ser Leu Leu Ser Tyr Asp Ala Val Gly Lys Leu Val Tyr Leu
385 390 395 400
His Ala Cys Val Thr Glu Thr Leu Arg Leu Tyr Pro Ala Val Pro Gln
405 410 415
Asp Pro Lys Gly Ile Val Glu Asp Asp Val Leu Pro Asp Gly Thr Lys
420 425 430
Val Arg Ala Gly Gly Met Val Thr Tyr Val Pro Tyr Ser Met Gly Arg
435 440 445
Met Glu Tyr Asn Trp Gly Pro Asp Ala Ala Ser Phe Arg Pro Glu Arg
450 455 460
Trp Leu Ser Gly Asp Gly Gly Ala Phe Arg Asn Ala Ser Pro Phe Lys
465 470 475 480
Phe Thr Ala Phe Gln Ala Gly Pro Arg Ile Cys Leu Gly Lys Asp Ser
485 490 495
Ala Tyr Leu Gln Met Lys Met Ala Leu Ala Ile Leu Phe Arg Phe Tyr
500 505 510
Thr Phe Asp Leu Val Glu Asp His Pro Val Lys Tyr Arg Met Met Thr
515 520 525
Ile Leu Ser Met Ala His Gly Leu Lys Val Arg Val Ser Thr Ser Val
530 535 540
<210> 11
<211> 1231
<212> DNA
<213> paddy rice (Oryza sativa)
<400> 11
aggtggaaga caaggtggtg aggattggga gggctaccta tggcagggta gtgaagaggc 60
aggcaatgag agctctcttc agacttacat tggatgctga cagtaacaaa agcctgtagg 120
ttttgatact cttgattgat tgtttattta gttacctagt atcttcagta acagatgaga 180
gatttattca gcaaatgctc cggtttgctc gaaggttgta ataagagtgt gggcaagaat 240
caaggtcaat ccataagagc actattttca tgctcttctg atcttggttt cagacttgtt 300
tcagtgttga cattggttat ttctcaattc attcgagtat ttgttgttac atcacaaagg 360
ataagttcta tagaaaaaat cttccttttc aagtgatgtt ctttaatttt ctgtagaatt 420
gtgccctgca atttctcaaa tctttgatag atggcttatt tgtattgact ggaaaagaaa 480
ttagttgtca ataactagaa gctttagaga tgcaaagtat tggatatatc ttggcaatag 540
tattttatat tgcttgttta tgtgagaatg ttttaactag atggcaactg atttctggga 600
caaaatcgct tctacaatag cattttatgg aactcgtact cgtcgatagc atttcttgga 660
tttgggtgtt tgtaaatggc atttcttgga ttttctcttc attaaaatag cctattcaga 720
tgaagtagaa ttcaggtgaa gtagaaacca actactttgg gttcacaatt tatatttctt 780
ttgaggatac cccatttcat tttagttgtc atcaaagact agacaatatc gacagaaaat 840
ggtaagcctg gtttcagttg gtgacaattt aacagaattc agatggatat ggttctgata 900
ttagaaggtg gcataccttt agtcgctgca aacgcttcag ttatctgaac aaaacaacga 960
acttggctga gcaggggaaa aaaatactgt agcattcatt ttgtgtttac atgagtaacg 1020
attcttttct aggtggacag atcacaaaaa gaaaactaaa gctaagatcc aactcctaag 1080
ggtgttaggt tagggacacc atatgaatga gacaatctta attcttggtc acacaaagat 1140
tgtctcaagg ttggtagcat cagtgcccaa tatatcacct aactatgcca tccaaaatgc 1200
tacatagcat ctcttgtaga ctgaaccctt c 1231
<210> 12
<211> 649
<212> DNA
<213> paddy rice (Oryza sativa)
<400> 12
cccccgccgc cgctcgccgg cagccgcgcc gccgccgccc gtatcgctta ccggagtagt 60
aaataagcct atgtaatctg gtttgaattt gaaatttgaa tgtaccatgt ttgattctag 120
gatttgttgg tcctagaccc tgcttgaaac ggtgcgaatt tcatctaaat ggttgagaaa 180
ttttatcgaa agctgttcca ttctacgcta caaatggtgg gactggattt aaacattggc 240
gacgtggaca aggccgtatc accatgtttg cacattttta aacctgtaat ctggtttgaa 300
tttgaatgta ccatgacacc atgtttgcaa aactttacat gaatgtttga gaaaaaatat 360
ggagaactgt tcaattagta tgcgtttaaa atgggactgg atttaaacat tggcgacgtg 420
gacaaggcta gtggactgag actctgagat gttgcggaag tcggggacgc agcggcggca 480
gccgccggcg tggcggcggt gccggagcct gcgacacatc aagcagatgc acgcggtgat 540
ggcgctccgg ggcttcctct ccgatccctc cgagctccgc gagctccttt tcgcctccgc 600
cgtcgcggtc cgcggcgcca tcgcgcacgc ctacctcgtg ttcgaccaa 649
<210> 13
<211> 35
<212> DNA
<213> synthetic
<400> 13
tatggcgcgc cgattggtcg aacacgaggt aggcg 35
<210> 14
<211> 30
<212> DNA
<213> synthetic
<400> 14
tcgaaggacc gcaccgtgac cgtcgacatg 30
<210> 15
<211> 30
<212> DNA
<213> synthetic
<400> 15
catgtcgacg gtcacggtgc ggtccttcga 30
<210> 16
<211> 36
<212> DNA
<213> synthetic
<400> 16
atagtttaaa caggtggaag acaaggtggt gaggat 36
<210> 17
<211> 331
<212> DNA
<213> synthetic
<400> 17
cgtcaacatg gtggagcacg acacgcttgt ctactccaaa aatatcaaag atacagtctc 60
agaagaccaa agggcaattg agacttttca acaaagggta atatccggaa acctcctcgg 120
attccattgc ccagctatct gtcactttat tgtgaagata gtggaaaagg aaggtggctc 180
ctacaaatgc catcattgcg ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag 240
tggtcccaaa gatggacccc cacccacgag gagcatcgtg gaaaaagaag acgttccaac 300
cacgtcttca aagcaagtgg attgatgtga t 331
<210> 18
<211> 34
<212> DNA
<213> synthetic
<400> 18
ttggcgcgcc atcacatcaa tccacttgct ttga 34
<210> 19
<211> 34
<212> DNA
<213> synthetic
<400> 19
gaggcgcgcc cgtcaacatg gtggagcacg acac 34
Claims (23)
1. a method, for creating plants maintenance line, is characterized in that described method comprises:
A) provide the first plant, it is the sterile line of recessive nucleus male sterility of isozygotying;
B) in the first plant, introduce construct, described construct contains the first nucleic acid molecule and the second nucleic acid molecule, and wherein said the first nucleic acid molecule is fertility restorer gene, and the second nucleic acid molecule is screening-gene; With
C) transfer-gen plant containing described construct obtaining had been both maintenance line.
2. method claimed in claim 1, wherein said maintenance line can be used for breeding male sterile line, and described method comprises: according to isozygotying or heterozygosis situation of the contained external source construct of described maintenance line, be divided into two kinds of approach and carry out the breeding of male sterile line:
I) maintenance line of transgenosis heterozygosis, by going out to stablize with the first plant outbreeding described in claim 1a the sterile line and the maintenance line that separate;
Ii) the maintenance line that transgenosis is isozygotied, first obtains the maintenance line of transgenosis heterozygosis with sterile line hybridization, then goes out to stablize with sterile line outbreeding the sterile line and the maintenance line that separate.
3. the method described in claim 1 or 2, the first wherein said nucleic acid molecule is operationally connected with trinucleotide sequence, the sequence-directed expression that prefers to male plant cell of described trinucleotide.
4. arbitrary described method of claim 1-3, the second wherein said nucleic acid molecule is operationally connected with tetranucleotide sequence, the sequence-directed expression preferring in callus and/or seed of described tetranucleotide.
5. the method described in claim 1 or 2, the first wherein said plant is rice male sterility mutant plant.
6. method claimed in claim 5, the first wherein said nucleic acid molecule is that male sterility of rice recovers gene.
7. the method described in claim 5 or 6, wherein said rice male sterility mutant is the male-sterile mutation body of paddy rice ms26 gene.
8. method claimed in claim 7, wherein said male sterility of rice recovers gene and has the nucleotide sequence as shown in SEQ ID NO:9.
9. method claimed in claim 8, wherein said male sterility of rice recovers genes encoding and has the aminoacid sequence as shown in SEQ ID NO:10.
10. arbitrary described method of claim 1-9, the second wherein said nucleic acid molecule is selected from the group that red fluorescence gene, cyan fluorescent protein gene, yellow fluorescence protein gene, luciferase gene, green fluorescence protein gene, cyanin p1 gene and careless fourth phosphinothricin acetyl transferring enzyme encoding gene form.
11. method claimed in claim 10, wherein said red fluorescence gene has the nucleotide sequence as shown in SEQ ID NO:3.
12. method claimed in claim 9, wherein said red fluorescence genes encoding has the aminoacid sequence as shown in SEQ ID NO:5.
Method described in 13. claims 1 or 2, the first wherein said plant is rapeseed male sterility mutant plant.
14. 1 kinds of constructs, is characterized in that, comprise: the first expression cassette, and described the first expression cassette contains the first nucleic acid molecule, and described the first nucleic acid molecule encoding plants male sterility recovers gene; And second expression cassette, described the second expression cassette contains the second nucleic acid molecule, described the second nucleic acid molecule encoding screening-gene.
Construct described in 15. claims 14, the first wherein said nucleic acid molecule is operationally connected with trinucleotide sequence, the sequence-directed expression that prefers to male plant cell of described trinucleotide.
Construct described in 16. claims 14 or 15, the second wherein said nucleic acid molecule is operationally connected with tetranucleotide sequence, the sequence-directed expression preferring in callus and/or seed of described tetranucleotide.
17. the construct described in claim 14, the first wherein said nucleic acid molecule is that male sterility of rice recovers gene.
Construct described in 18. claims 14 or 17, wherein said rice male sterility mutant is the male-sterile mutation body of ms26 gene.
Construct described in 19. claims 18, wherein said male sterility of rice recovers gene and has the nucleotide sequence as shown in SEQ ID NO:9.
Construct described in 20. claims 19, wherein said male sterility of rice recovers genes encoding and has the aminoacid sequence as shown in SEQ ID NO:10.
Arbitrary described construct of 21. claim 14-20, the second wherein said nucleic acid molecule is selected from the group that red fluorescence gene, cyan fluorescent protein gene, yellow fluorescence protein gene, luciferase gene, green fluorescence protein gene, cyanin p1 gene and careless fourth phosphinothricin acetyl transferring enzyme encoding gene form.
Construct described in 22. claims 21, wherein said red fluorescence gene has the nucleotide sequence as shown in SEQ ID NO:3.
Construct described in 23. claims 22, wherein said red fluorescence genes encoding has the aminoacid sequence as shown in SEQ ID NO:5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310548284.3A CN103805630A (en) | 2012-11-12 | 2013-11-07 | Novel plant fertility regulation structure and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210449494.2 | 2012-11-12 | ||
| CN201210449494 | 2012-11-12 | ||
| CN201310548284.3A CN103805630A (en) | 2012-11-12 | 2013-11-07 | Novel plant fertility regulation structure and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103805630A true CN103805630A (en) | 2014-05-21 |
Family
ID=50703016
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310548284.3A Pending CN103805630A (en) | 2012-11-12 | 2013-11-07 | Novel plant fertility regulation structure and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103805630A (en) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695477A (en) * | 2014-11-27 | 2016-06-22 | 深圳市作物分子设计育种研究院 | Male sterile mutant oss125 and use thereof |
| WO2018205521A1 (en) * | 2017-05-09 | 2018-11-15 | 未名兴旺系统作物设计前沿实验室（北京）有限公司 | Wheat fertility-related gene tams7 and application method thereof |
| CN108950046A (en) * | 2018-08-02 | 2018-12-07 | 北京科技大学 | The functional label of corn recessive nucleus male sterility mutated gene ms1 and its application |
| CN109810994A (en) * | 2017-11-17 | 2019-05-28 | 华南师范大学 | The Gene A/G 1 and its application of one control rice male and female fertility |
| CN110268973A (en) * | 2019-04-19 | 2019-09-24 | 湖南杂交水稻研究中心 | The production method of hybrid rice seed |
| CN111575284A (en) * | 2020-05-07 | 2020-08-25 | 海南波莲水稻基因科技有限公司 | Vector containing oryza sativa promoter and capable of restoring male fertility of rice OsCYP704B2 mutant and application |
| CN111575305A (en) * | 2020-05-14 | 2020-08-25 | 安徽农业大学 | Allene oxide synthetase, coding gene CsAOS and application thereof |
| CN112219714A (en) * | 2020-08-27 | 2021-01-15 | 云南大学 | Method for breeding sporophyte recessive male nuclear sterility |
| CN112314429A (en) * | 2020-10-29 | 2021-02-05 | 海南波莲水稻基因科技有限公司 | Breeding method of rice nuclear male sterility maintainer line |
| CN113549629A (en) * | 2020-04-16 | 2021-10-26 | 深圳市作物分子设计育种研究院 | Rice transgenic event FG2-55 |
| CN116724886A (en) * | 2023-08-08 | 2023-09-12 | 四川天能璟秀生物科技有限公司 | Method for propagating corn cell nucleus male sterile line by color marking |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101248183A (en) * | 2005-06-24 | 2008-08-20 | 先锋高级育种国际公司 | Nucleotide sequences mediating plant male fertility and method of using same |
| CN102229976A (en) * | 2010-11-30 | 2011-11-02 | 北京未名凯拓作物设计中心有限公司 | Method for simply and rapidly identifying transgenic seeds and estimating copy numbers |
| CN102876711A (en) * | 2012-10-31 | 2013-01-16 | 湖南杂交水稻研究中心 | Cultivation method of rice engineering maintainer line and application thereof to breeding of rice genic male sterile line |
-
2013
- 2013-11-07 CN CN201310548284.3A patent/CN103805630A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101248183A (en) * | 2005-06-24 | 2008-08-20 | 先锋高级育种国际公司 | Nucleotide sequences mediating plant male fertility and method of using same |
| CN102229976A (en) * | 2010-11-30 | 2011-11-02 | 北京未名凯拓作物设计中心有限公司 | Method for simply and rapidly identifying transgenic seeds and estimating copy numbers |
| CN102876711A (en) * | 2012-10-31 | 2013-01-16 | 湖南杂交水稻研究中心 | Cultivation method of rice engineering maintainer line and application thereof to breeding of rice genic male sterile line |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695477A (en) * | 2014-11-27 | 2016-06-22 | 深圳市作物分子设计育种研究院 | Male sterile mutant oss125 and use thereof |
| WO2018205521A1 (en) * | 2017-05-09 | 2018-11-15 | 未名兴旺系统作物设计前沿实验室（北京）有限公司 | Wheat fertility-related gene tams7 and application method thereof |
| CN109810994A (en) * | 2017-11-17 | 2019-05-28 | 华南师范大学 | The Gene A/G 1 and its application of one control rice male and female fertility |
| CN108950046A (en) * | 2018-08-02 | 2018-12-07 | 北京科技大学 | The functional label of corn recessive nucleus male sterility mutated gene ms1 and its application |
| CN110268973B (en) * | 2019-04-19 | 2022-05-20 | 湖南杂交水稻研究中心 | Production method of rice hybrid |
| CN110268973A (en) * | 2019-04-19 | 2019-09-24 | 湖南杂交水稻研究中心 | The production method of hybrid rice seed |
| CN113549629A (en) * | 2020-04-16 | 2021-10-26 | 深圳市作物分子设计育种研究院 | Rice transgenic event FG2-55 |
| CN111575284A (en) * | 2020-05-07 | 2020-08-25 | 海南波莲水稻基因科技有限公司 | Vector containing oryza sativa promoter and capable of restoring male fertility of rice OsCYP704B2 mutant and application |
| CN111575305A (en) * | 2020-05-14 | 2020-08-25 | 安徽农业大学 | Allene oxide synthetase, coding gene CsAOS and application thereof |
| CN111575305B (en) * | 2020-05-14 | 2022-03-15 | 安徽农业大学 | Allene oxide synthetase, coding gene CsAOS and application thereof |
| CN112219714A (en) * | 2020-08-27 | 2021-01-15 | 云南大学 | Method for breeding sporophyte recessive male nuclear sterility |
| CN112219714B (en) * | 2020-08-27 | 2022-04-29 | 云南大学 | Method for breeding sporophyte recessive male nuclear sterility |
| CN112314429A (en) * | 2020-10-29 | 2021-02-05 | 海南波莲水稻基因科技有限公司 | Breeding method of rice nuclear male sterility maintainer line |
| CN112314429B (en) * | 2020-10-29 | 2023-03-28 | 海南波莲水稻基因科技有限公司 | Breeding method of rice nuclear male sterility maintainer line |
| CN116724886A (en) * | 2023-08-08 | 2023-09-12 | 四川天能璟秀生物科技有限公司 | Method for propagating corn cell nucleus male sterile line by color marking |
| CN116724886B (en) * | 2023-08-08 | 2023-11-10 | 四川天能璟秀生物科技有限公司 | Method for propagating corn cell nucleus male sterile line by color marking |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103805630A (en) | Novel plant fertility regulation structure and application thereof | |
| CN103796508B (en) | Plants With Useful Traits and Related Methods | |
| KR101268896B1 (en) | Corn Event MIR604 | |
| CN105746362B (en) | A kind of fertile gene and its application | |
| EP1532247A2 (en) | Corn event pv-zmir13 (mon863) plants and compositions and methods for detection thereof | |
| CN101495635A (en) | Corn plant and seed corresponding to transgenic event MON89034 and methods for detection and use thereof | |
| CN102316720A (en) | Corn event 5307 | |
| AU2019460919B2 (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method therefor | |
| CN108291234A (en) | Multiple sporinite forms gene | |
| US10876129B2 (en) | Methods and materials for high throughput testing of mutagenized allele combinations | |
| CN105830912A (en) | Breeding method for rice with high yield and durable neck blast resistance | |
| US20040045054A1 (en) | Cotton event pv-ghbk04(531) and compositions and methods for detection thereof | |
| CA3129544C (en) | Methods of determining sensitivity to photoperiod in cannabis | |
| CN110881367A (en) | Corn event Ttrans-4 and methods of use thereof | |
| CN105907865A (en) | Method for identifying corn male fertility gene functions | |
| CN104004775B (en) | One sterility changing gene and its application | |
| CN109971763A (en) | Florescence control gene C MP1 and relevant carrier and its application | |
| US10266840B2 (en) | Sorghum yield enhancement gene | |
| CN109504703A (en) | Corn M8-P type rice system and its breeding production of hybrid seeds application method are formulated using p5126-ZmMs1D construct | |
| CN110129471A (en) | It is a kind of for detecting the nucleic acid sequence and its detection method of rice plants ZUPM01 | |
| CN104341494A (en) | Protein ZmWAK with high resistance of sporisorium reilianum, as well as coding gene and application of protein ZmWAK | |
| US12002546B2 (en) | Methods of determining sensitivity to photoperiod in cannabis | |
| CN109082436A (en) | Utilize the method for BCS1L gene and guide RNA/CAS endonuclease enzyme system improvement plant agronomic character | |
| EP4199703A1 (en) | Methods of increasing outcrossing rates in gramineae | |
| CN115725571A (en) | Nucleic acid sequence of corn transformation event LG11 and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20170620 Address after: 102206, Changping District, Zhongguancun Beijing Life Science Park medical industry park, No. 9, building 4, 405 Applicant after: WEIMING XINGWANG SYSTEM CROP DESIGN FRONTIER LABORATORY (BEIJING) CO., LTD Address before: 100085 Haidian District West Road, No. 39, north of the biological city of Beijing Applicant before: WEIMING XINGWANG SYSTEM CROP DESIGN FRONTIER LABORATORY (BEIJING) CO., LTD Applicant before: Xingwang Investment Pty Ltd. |
|
| TA01 | Transfer of patent application right | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140521 |
|
| WD01 | Invention patent application deemed withdrawn after publication |