CN111560382B - Gene BnGF14a for regulating vernalization process of rape and application thereof - Google Patents

Abstract

The invention belongs to the field of plant genetic engineering, and particularly discloses a gene for regulating and controlling a vernalization process of rapeBnGF14aThe nucleotide sequence is shown in SEQ ID No. 1, and the transgenic result by using winter rape 93275 as a receptor is proved,BnGF14athe overexpression of the gene leads the winter rape seedling stage to directly enter a reproductive growth stage (bolting and flowering) from a vegetative growth stage without low-temperature vernalization treatment. Therefore, the gene breaks through the low-temperature vernalization treatment required by the conversion of the winter rape from the vegetative growth stage to the reproductive growth stage, so that the high-yield and high-oil winter rape is suitable for the spring rape production area, and the yield and the oil content of the spring rape production area can be greatly improved by applying the gene to crop breeding.

Description

Gene BnGF14a for regulating vernalization process of rape and application thereof

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a gene BnGF14a for regulating and controlling a vernalization process of rape, wherein the restriction that low-temperature vernalization treatment is needed before bolting winter rape can be broken through increasing the expression level of the BnGF14a gene by a genetic engineering technology, and bolting and flowering are directly carried out after the seedling stage.

Background

Along with the continuous improvement of the living standard of people, the demand of Chinese oil is rapidly increased (Liu becomes, Feng Zhongzhu, Xiao Tang Hua, and the like, China rape industry development status, potential and countermeasure [ J ]. Chinese oil crop academic newspaper, 2019,41(4):485.), and the consumption of vegetable oil eaten by everyone is less than 8kg every year in 1996 and is increased to 24.8kg every year in 2016 (Wang Jiayou, He Xiu Rong, Wang Yin, Chinese oil and oil import substitution relation metering economic research [ J ]. statistics and information forum, 2017, 32 (5): 69-75.). Under the condition of limited domestic oil yield, increasing oil import becomes a main way to meet domestic needs (how much is the supply and consumption of edible vegetable oil in china. The total consumption amount of the national vegetable oil in 2017 is 3565 ten thousand tons, wherein the self-produced vegetable oil in China is 1100 ten thousand tons, the self-supply rate is only 30.8 percent, the consumption demand of the domestic oil is difficult to meet, and the supply and demand gaps are increased day by day (Wang Han Zhong. the history review and prospect of the development of the rape industry in China [ J ]. the Chinese oil crop academy, 2010,32(2): 300-. Especially, under the background that the current game in the middle and the united states is intensified and prolonged, the uncertainty of Chinese soybean import exists for a long time. Therefore, the domestic oil production is stabilized and even increased to cope with international market fluctuation (Wangwngbao, Weilongbao, Wangqian, influence of intervention of soybean market policy on the international price of soybean [ J ] China rural economy, 2018 (9): 47-61.), thereby ensuring effective supply of edible vegetable oil and feed protein in China and having important strategic significance for effectively coping with trade friction in China and America.

The annual planting area of rape in China is about 1.1 hundred million acres (Zhangbei, Maying, Gunn Wei, etc.. the utilization potential of biomass energy of rape straw resources in China is evaluated by [ J ] renewable energy, 2017, 35 (1): 126-.

The rape planting method has the advantages that the width of the spontoon is wide in China, the north-south span is large, the difference of natural conditions in various regions is large, the climate difference is obvious, and the regional difference is formed in the rape planting, so that the sowing period and the harvesting period of the rape are greatly different in the nationwide range, and the diversity of rape varieties, cultivation systems and cultivation techniques in China is formed. On the national scale, rape grows in the field all the year round, and rape is sowed and harvested from 3 months to 10 months. Generally, according to different growing seasons of rape, rape in China can be divided into two large-yield areas of winter rape and spring rape.

The higher plant flowers are developed through 3 stages of flowering induction, formation of flower primordia and development of flower organs, and the research on a flowering induction regulation network divides the ways of responding to external environment stimulation and starting flowering by endogenous signals into: the photoperiod pathway, vernalization pathway, spontaneous pathway, gibberellin pathway, and age pathway. The vernalization is to adapt to seasonal variation, and after treatment at a certain low temperature (generally at 4 ℃ for 2-8 weeks), the vernalization shows the induction and promotion effects on the flower formation of the overwintering plants. If these plants are not cryogenically treated, the flowering process may be delayed for weeks or even months. The specific effect of vernalization depends on several factors such as the developmental stage of the plant, the length of the low temperature treatment and the temperature (Kim DH, Sung s. genetic and epidemic mechanisms undersizing. arabidopsis book,2014,12: e 0171.). The flowering of winter rape belongs to a vernalization approach, and the rape still needs continuous low-temperature induction after completing vegetative growth to ensure that the rape bolts and flowers and enters a reproductive growth stage.

Winter rape planting in China is mainly concentrated in various provinces of Yangtze river basin and high-altitude areas of Yun Gui, the climate is warm, the rainfall is high, and the winter rape planting is a more mature area in one year. The cabbage type rape is mainly planted, winter rape is generally sown in autumn and matured in summer next year, the whole growth period is longer, the cabbage type rape varieties are all over 200 days, the winter rape is generally winter type and semi-winter type, and the cabbage type rape can enter reproductive growth, flower bud differentiation and flowering period only through a section of lower temperature condition in the growth and development process. For example, the late-maturing and middle-late-maturing varieties of winter rape have strict requirements on low temperature, and the flower bud differentiation can be carried out only after 15-45 days at the low temperature of 0-5 ℃, otherwise, the flower bud can not bloom only when leaves grow. In addition, although the requirement of medium-maturing and early-medium-maturing varieties on low temperature is not as strict as that of late-maturing varieties, a period of low temperature is still needed to complete the phylogenetic process, and the phylogenetic growth is carried out from vegetative growth to reproductive growth.

Spring rape (spring rape) refers to annual rape sowed in spring and harvested in autumn. But in cold spring areas, the sowing can be carried out as late as 5 months, and the early-maturing variety can be harvested in 7 months. Mainly distributed in alpine regions where the rapes cannot safely overwinter, or in places where the plants cannot be planted before the harvest of the previous crops is late in winter. High latitude or high altitude low temperature zones such as the northern part, the west part and the northeast part of China and the northern part of Europe mainly plant spring rape. Canada is almost entirely spring rape, also known as summer rape, because it is generally sown in 5 months. The growth and development of the spring rape are rapid, flower bud differentiation is started when 2-4 true leaves are used, buds appear when 6-8 true leaves are used, the whole growth period is 80-120 days, and the shortest period is only 60-70 days. The plant is short and small, the number of main stems and leaves is small, the plant is generally 80-120 cm high, 3-5 branches are effectively branched at one time, and 50-150 fruits are planted on a single plant, so that the productivity of the single plant is low. The cultivars of spring rape, generally, belong to the spring type. In China, the early-maturing Chinese cabbage type rape is planted in places with higher altitude, short frost-free period and lower temperature. In the frost-free period and at a temperature higher than that of the main dealer, leaf mustard type spring rape and Chinese cabbage type spring rape are planted. Winter rape is higher than spring rape in both yield and oil production quality (Jingshanyou. analysis of main agronomic characters and yield of single plant of cabbage type spring rape.: Heilongjiang agricultural science, 2002).

In general, winter rape is superior to spring rape in yield and oil production quality, but the current spring rape planting area is not suitable for winter rape growth. To this end, in the present invention, the applicant has provided a gene BnGF14a which regulates the vernalization process of rape by stably expressing and inheriting BnGF14 a: 1) under the condition of not influencing the yield and the oil content, the requirement of winter rape on low temperature is broken, the rape can directly enter the reproductive growth, flower bud differentiation and flowering period after the seedling stage, and the rape can be applied to crop breeding, so that the yield and the oil content of the spring rape in a production area can be greatly improved; 2) the vernalization process is not needed, the flowering is advanced, the growth cycle of the rape is greatly shortened, the important agronomic characters such as the yield of the rape and the like are not influenced, and more abundant growth time can be provided for the planting of other crop rotation important grain crops; 3) the characteristic of early flowering and short growth period has extremely important significance in the aspects of the breeding and popularization of the colorful rape, can greatly drive the tourism of the village, improve the income of farmers and realize the vogue of the village.

Disclosure of Invention

The invention provides a gene BnGF14a for regulating and controlling the vernalization process of rape and application thereof, under the condition of not influencing yield and oil content, the gene breaks the requirement of winter rape on low temperature, and can directly enter reproductive growth, flower bud differentiation and flowering stage after the seedling stage.

In order to achieve the purpose, the invention adopts the following technical scheme:

1. origin of Gene

The analysis of different tissue transcriptome of two rape lines YN171(63.8 +/-2.4) and 51070(35.9 +/-1.6) with different oil contents in seeds obtains a differential expression gene BnaA07g34180D, and the transcription level of the gene shows that the expression level in the high-oil-quality seed YN171 is obviously higher than that in the low-oil-quality seed 51070 (see a specific figure 1). The nucleotide and amino acid sequence alignment shows that the gene belongs to a 14-3-3 family gene member and is named as BnGF14 a.

2. Full Length cloning of Gene

A full-length gene primer is designed by using a Brassica napus ZS11 reference sequence, BnGF14a-F ATGAAATACAAGTTTTGTTT, BnGF14a-R CTACTGTTCCTCAGTCGGCT, cDNA of Brassica napus YN171 is used as a template for PCR amplification, and a full-length product of the gene is obtained through sequencing verification, wherein the nucleotide sequence of the full-length gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.

3. Plant overexpression vector construction

Carrying nucleotide sequences recombined with two ends of the used enzyme cutting site of the skeleton vector, designing recombinant primers 35S, BnGF14a-F ggacagcccagatcaactagtATGAAATACAAGTTTTGTTT, 35S, BnGF14a-R gcccttgctcaccatggatccCTACTGTTCCTCAGTCGGCT, purifying and recovering the PCR product obtained by amplification, and storing for later use. The plant expression vector pcambia1305.1-GFP is subjected to double enzyme digestion by SpeI and BamH I, and is detected and recovered by 1% agarose gel electrophoresis; PCR purification of BnGF14a gene and recovery of product and recovered enzyme cutting plasmid, and one-step cloning kit (

Entry One Step Cloning Kit), transforming E.coli competent DH5 alpha after 30min water bath at 37 ℃; the single clone that grew out was primed with the vector upstream primer 35S: GACGCACAATCCCACTAAnd (3) carrying out positive clone sequencing detection on TCC and a downstream primer NOS: GATAATCATCGCAAGACCGG, and extracting a positively cloned expression vector plasmid, wherein the plasmid is a recombinant vector 35S: BnGF14 a.

4. Genetic transformation and phenotypic analysis of oilseed rape

The winter rape strain 93275 is transformed by agrobacterium-mediated rape hypocotyl genetic transformation method, and the homozygous transgenic strain is obtained by third generation screening. The provided rape growing environment is a plant cultivation greenhouse, and the basic conditions are that the illumination is 16 h/dark 8h at 24 ℃. According to the investigation, the non-transgenic control group rape keeps not bolting under the greenhouse condition, and can gradually enter the reproductive growth stage only by carrying out low-temperature treatment at 0-4 ℃ for about 15 days. The transgenic strain grows and develops rapidly, the flower bud differentiation is started when 10-15 true leaves come, then the buds emerge and bloom, and the whole growth period is 100-120 days. Experiments prove that compared with a receptor control (non-transgenic plant), the transgenic rape 93275 strain containing the BnGF14a breaks the low-temperature vernalization treatment required for the conversion of winter rape from a vegetative growth stage to a reproductive growth stage, and does not influence the oil content and the yield of single plants of rape seeds.

Compared with the prior art, the invention has the following advantages and beneficial effects:

the invention discloses the function of the BnGF14a gene in the process of regulating and controlling vernalization of rape for the first time in China, and experimental results show that compared with receptor control (non-transgenic plant 93275), bolting and flowering of transgenic rape are not limited by the low-temperature vernalization, the transgenic plant grows and develops rapidly, flower bud differentiation is started when 10-15 true leaves are available, and then buds and flowers appear, and the whole growth period is 100-120 days. The gene provides a new gene source for rape molecular breeding, so that the high-yield and high-oil-content winter rape is suitable for the spring rape production area, and the yield and the oil content of the spring rape production area can be greatly improved.

Drawings

FIG. 1: transcriptome data analysis of candidate genes in different rape lines. High oil content rape variety YN171 (oil content 63.8 + -2.4); low oil content rape variety 51070(35.9 ± 1.6); DAy After Polling days DAy After Pollination.

FIG. 2: schematic diagram of plant overexpression vector construction.

FIG. 3: phenotypic profile of non-transgenic and transgenic BnGF14a overexpressing oilseed rape lines. The flower bud differentiation is normal when the rape is not treated by spring flowers at low temperature under the greenhouse condition, the left graph is a phenotypic graph of non-transgenic rape and does not bolt continuously, and the right graph is a phenotypic graph of BnGF14a transgenic rape.

Detailed Description

The methods used in the following examples are all conventional biological experiments unless otherwise specified, the primers used were all synthesized by Wuhan Optimalaceae Biotech Co., Ltd, and the sequencing was performed by Wuhan Optimalaceae Biotech Co., Ltd,

the Entry One Step Cloning Kit is purchased from Nanjing Novophilia Biotechnology Co., Ltd, the rapid endonuclease is purchased from Thermo Fisher Scientific, the DNA gel recovery Kit, the DNA Marker and the like are purchased from Dalibao biological, and different tissue transcriptome data of Brassica napus varieties YN171 and 51070 used in the experiment are sequencing results of the subject group; the winter rape strain 93275, the escherichia coli sensitive strain DH5 alpha, the agrobacterium sensitive strain GV3101, the plant genetic expression vector pcambia1305.1-GFP and the like are all preserved in the laboratory.

Example 1: acquisition of seed oil content related gene BnGF14a

By using the transcriptome data of different tissues of the existing rape varieties with different oil contents, the differential expression gene BnaA07g34180D (shown in a specific figure 1) is obtained in the transcriptome analysis of two rape lines YN171(63.8 +/-2.4) and 51070(35.9 +/-1.6) with different oil contents of seeds. The nucleotide and amino acid sequence alignment shows that the gene belongs to a 14-3-3 family gene member, and the gene is named as BnGF14 a. Designing a full-length gene primer by using a Brassica napus ZS11 reference sequence, carrying out PCR amplification by using a cDNA of Brassica napus YN171 as a template, wherein the BnGF14a-F: ATGAAATACAAGTTTTGTTT, BnGF14a-R: CTACTGTTCCTCAGTCGGCT is a PCR system: 2 XMix buffer25 μ L, BnGF14 a-F1 μ L, BnGF14 a-R1 μ L, DNA 1 μ L, ddH₂O22. mu.L. The PCR procedure was: 5min at 94 ℃; 30s at 94 ℃, 30s at 56 ℃, 30s at 72 ℃ and 35Circulating; 10min at 72 ℃; infinity at 4 ℃. The PCR product is sequenced and verified to obtain the full-length product of the gene BnGF14a, the nucleotide sequence of the full-length product is shown as SEQ ID NO. 1, and the coded amino acid sequence is shown as SEQ ID NO. 2.

Example 2: construction of BnGF14a overexpression vector

Carrying nucleotide sequences recombined with two ends of the enzyme cutting site of the used skeleton vector, designing a recombination primer 35S, wherein the nucleotide sequences comprise BnGF14a-F, ggacagcccagatcaactagtATGAAATACAAGTTTTGTTT, and the nucleotide sequences comprise BnGF14a-R, gcccttgctcaccatggatccCTACTGTTCCTCAGTCGGCT, (wherein the sequence ggacagcccagatcaactagt is an upstream sequence of the enzyme cutting site of the vector pcambia1305.1-GFP, and the sequence gcccttgctcaccatggatcc is a downstream sequence of the enzyme cutting site of the vector pcambia 1305.1-GFP), purifying and recycling a PCR product obtained by amplification, and storing for later use. The plant expression vector pcambia1305.1-GFP is subjected to double enzyme digestion by SpeI and BamH I, and is detected and recovered by 1% agarose gel electrophoresis; PCR purification of BnGF14a gene and recovery of product and recovered enzyme cutting plasmid, and one-step cloning kit (

Entry One Step Cloning Kit) instructions (5 × CE II Buffer 4. mu.L, linearized Cloning vector 50-200 ng, insert amplification product 20-200 ng,

II 2μL，ddH₂o is supplemented to 20 mu L), water bath is carried out at 37 ℃ for 30min, and then escherichia coli competence DH5 alpha is transformed; the grown single clone is subjected to positive clone PCR detection by a vector upstream primer 35S: GACGCACAATCCCACTATCC and a downstream primer NOS: GATAATCATCGCAAGACCGG, the single clone which is detected to be positive by PCR is sent to Wuhan engine department biotechnology limited company for sequencing, and expression vector plasmid of the positive single colony with correct sequencing is extracted, wherein the plasmid is the recombinant vector 35S: BnGF14a (a T-DNA schematic diagram is shown in figure 2).

Example 3: rape genetic transformation and homozygous transformation strain screening

The constructed plant over-expression vector 35S is transformed into agrobacterium-competent cells GV3101 by a freeze-thaw method, and the steps are as follows: 1) thawing Agrobacterium-infected competent cell GV3101 stored at-80 deg.C on ice; 2) taking 3 μ L (100ng) of expression vector plasmid with a pipette, immersing the pipette tip, adding into competent cells, standing on ice for 30min, rapidly freezing in liquid nitrogen for 1min, and water-bathing in a constant-temperature water bath kettle at 37 deg.C for 5 min; 3) 600 μ L of LB liquid medium (tryptone 10 g; 5g of yeast extract; NaCl 10g), at 28 ℃ and 200rpm, and carrying out shake culture for 4 h; 4) spread on a solid LB medium ((tryptone 10 g; yeast extract 5 g; NaCl 10 g; Agar 1.5%)) supplemented with 50. mu.g/mL kanamycin, 50. mu.g/mL gentamicin and 50. mu.g/mL rifampicin, and subjected to inverted culture at 28 ℃ for 36-48 hours; 5) the grown monoclone is subjected to positive clone detection by an upstream primer 35S: GACGCACAATCCCACTATCC and a downstream primer NOS: GATAATCATCGCAAGACCGG of a plant expression vector, the monoclone which is detected to be positive by PCR is shaken until OD600 is 1.8-2.0 (detected by an ultraviolet spectrophotometer), and the monoclone is preserved by using equal volume of 50% glycerol at-80 ℃ in an ultra-low temperature refrigerator for subsequent research.

Genetic transformation of rape hypocotyls: 1) seed Sterilization of rape seeds at 0.1% HgCl₂Treating in the solution for 10min, and washing the seeds with sterile water for 3-5 times; 2) sowing the sterilized seeds into an M0 culture medium, wherein about 40 seeds are sowed in each bottle, and culturing for 5-6 days at 24 ℃ in dark light; 3) before infection and transformation of the shake bacteria, culturing agrobacterium to be transformed by using an LB liquid culture medium, and carrying out 200rpm at 28 ℃; 4) cutting hypocotyl of the cultured rape aseptic seedling to about 5-7mm, centrifuging the prepared agrobacterium liquid (OD600 is about 0.5) to remove supernatant, adding an equal volume of suspension culture medium for heavy suspension, and infecting the hypocotyl therein for 10 min; 5) absorbing the redundant bacteria liquid outside the hypocotyl by using sterile filter paper, placing on an M1 culture medium, and performing dark culture at 24 ℃ for 2 d; 6) transferring into M2 culture medium, and culturing under illumination for four weeks (24 deg.C illumination for 16 h/darkness for 8 h); 7) transferring to M3 culture medium, and changing fresh culture medium every two weeks; 8) when the differentiated bud grows to about 2cm, the bud is cut and transferred to an M4 culture medium; 9) when the plant grows to a more developed root system in the M4 culture medium, the plant can grow in the replanting soil.

Purifying and screening the transgenic rape: extracting genome DNA from leaves of the survived rape, screening positive transgenic plants by using a plant expression vector upstream primer 35S: GACGCACAATCCCACTATCC and a target sequence specific primer NOS: GATAATCATCGCAAGACCGG, detecting that a transgenic material which is positive by PCR is T1 generation, harvesting single plants, and sequentially numbering and storing. The T1 generation transgenic material is identified as T2 generation by hygromycin resistant screening and PCR, and the individual plants are harvested, numbered and stored in turn. And then screening the T2 generation again to obtain a homozygous transgenic line.

Example 4: phenotypic identification of BnGF14a transgenic rape

The provided rape growing environment is a plant cultivation greenhouse, the basic conditions are 24 ℃, and the illumination is 16 h/darkness is 8 h. According to the observation and the discovery (see figure 3), the non-transgenic control group rape does not bolting continuously under the greenhouse condition, and can gradually enter the reproductive growth stage only by carrying out low-temperature treatment at 0-4 ℃ for about 15 days. The transgenic strain grows and develops rapidly, the flower bud differentiation is started when 10-15 true leaves come, then the buds emerge and bloom, and the whole growth period is 100-120 days. Experiments prove that compared with a receptor control (non-transgenic plant), the transgenic rape 93275 strain containing the BnGF14a breaks the low-temperature vernalization treatment required for the conversion of winter rape from a vegetative growth stage to a reproductive growth stage. Further comparing the individual yield and oil content of the receptor control 93275 (non-transgenic plants) with the transgenic rape 93275 line containing BnGF14a, it was found that overexpression of the gene BnGF14a did not affect the individual yield and oil content of winter rape.

TABLE 1 comparison of Individual yield and oil content of the receptor control with transgenic BnGF14a overexpressing oilseed rape lines

Sequence listing

<110> institute of oil crop of academy of agricultural sciences of China

<120> gene BnGF14a for regulating vernalization process of rape and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 900

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaaataca agttttgttt agcagaaacg aatccaacgg cccacattca atctcggttc 60

cagatttcac tctcgtcctc taaaaacgca tttatcgcat ctcagatctc taaaaaaatg 120

gcggtttcgg cgcgtgagga gtacgtgtac atggccaagc tcgcggagca agccgagcgc 180

tacgaggaga tggtggagtt catggagaaa gtctccgcag ccatcgacgg cgacgagctc 240

accgtcgagg agcgaaacct cctctccgtc gcgtacaaaa acgtgatcgg cgcgcgccgc 300

gcatcgtggc gaatcatctc ctcgatcgag cagaaggagg agagccgcgg caacgacgac 360

cacgtcaagg cgatccgaga ctacagggcg aagatcgaga cggagctctc cgggatctgc 420

gacgggatcc tcaagctgct tgacgatagg ctcgtccccg cggctggttc gggtgattcg 480

aaggtgtttt atctgaagat gaaaggggat taccataggt acttggctga gtttaagact 540

ggtcaggaga ggaaggatgc tgctgagaat actctctctg cttacaaggc tgctcaggat 600

attgcaaatg cagagctagc tccaactcac ccgatccgtc ttggtctggc attgaacttc 660

tctgtgttct actacgagat ccttaactct cctgatcgtg cctgcagcct cgccaaacag 720

gcttttgatg aagcgatagc agagttggac actctaggtg aagagtcgta caaagacagc 780

accttgatca tgcagcttct ccgtgacaac ctcactctct ggacatccga catgcaggat 840

gatgatgctg gggaggagat caaagaatca tcagctccaa agccgactga ggaacagtag 900

<210> 2

<211> 299

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Lys Tyr Lys Phe Cys Leu Ala Glu Thr Asn Pro Thr Ala His Ile

1 5 10 15

Gln Ser Arg Phe Gln Ile Ser Leu Ser Ser Ser Lys Asn Ala Phe Ile

20 25 30

Ala Ser Gln Ile Ser Lys Lys Met Ala Val Ser Ala Arg Glu Glu Tyr

35 40 45

Val Tyr Met Ala Lys Leu Ala Glu Gln Ala Glu Arg Tyr Glu Glu Met

50 55 60

Val Glu Phe Met Glu Lys Val Ser Ala Ala Ile Asp Gly Asp Glu Leu

65 70 75 80

Thr Val Glu Glu Arg Asn Leu Leu Ser Val Ala Tyr Lys Asn Val Ile

85 90 95

Gly Ala Arg Arg Ala Ser Trp Arg Ile Ile Ser Ser Ile Glu Gln Lys

100 105 110

Glu Glu Ser Arg Gly Asn Asp Asp His Val Lys Ala Ile Arg Asp Tyr

115 120 125

Arg Ala Lys Ile Glu Thr Glu Leu Ser Gly Ile Cys Asp Gly Ile Leu

130 135 140

Lys Leu Leu Asp Asp Arg Leu Val Pro Ala Ala Gly Ser Gly Asp Ser

145 150 155 160

Lys Val Phe Tyr Leu Lys Met Lys Gly Asp Tyr His Arg Tyr Leu Ala

165 170 175

Glu Phe Lys Thr Gly Gln Glu Arg Lys Asp Ala Ala Glu Asn Thr Leu

180 185 190

Ser Ala Tyr Lys Ala Ala Gln Asp Ile Ala Asn Ala Glu Leu Ala Pro

195 200 205

Thr His Pro Ile Arg Leu Gly Leu Ala Leu Asn Phe Ser Val Phe Tyr

210 215 220

Tyr Glu Ile Leu Asn Ser Pro Asp Arg Ala Cys Ser Leu Ala Lys Gln

225 230 235 240

Ala Phe Asp Glu Ala Ile Ala Glu Leu Asp Thr Leu Gly Glu Glu Ser

245 250 255

Tyr Lys Asp Ser Thr Leu Ile Met Gln Leu Leu Arg Asp Asn Leu Thr

260 265 270

Leu Trp Thr Ser Asp Met Gln Asp Asp Asp Ala Gly Glu Glu Ile Lys

275 280 285

Glu Ser Ser Ala Pro Lys Pro Thr Glu Glu Gln

290 295

Claims (2)

1. The application of the gene BnGF14a in the process of regulating and controlling spring flowers of winter rape is characterized in that the nucleotide sequence of the gene BnGF14a is shown as SEQ ID NO. 1.

2. The protein coded by the gene BnGF14a is applied to the regulation and control of the spring flowering process of winter rape.

Images