CN105017396A

CN105017396A - Rubber tree blooming regulation protein HbTFL1-1, encoding gene thereof, and application of gene

Info

Publication number: CN105017396A
Application number: CN201510366854.6A
Authority: CN
Inventors: 华玉伟; 黄华孙; 毕政鸿; 黄天带; 应佳志; 陈涛
Original assignee: Rubber Research Institute Chinese Academy Tropical Agricultural Sciences
Current assignee: Rubber Research Institute Chinese Academy Tropical Agricultural Sciences
Priority date: 2015-06-29
Filing date: 2015-06-29
Publication date: 2015-11-04
Anticipated expiration: 2035-06-29
Also published as: CN105017396B

Abstract

The invention provides a rubber tree blooming regulation protein HbTFL1-1, an encoding gene thereof, and an application of the gene. The amino acid sequence of the blooming regulation protein HbTFL1-1 is represented by SEQ ID No.3, and the encoding gene of the protein is used to transform plants in order to obtain transgenic plants with delayed blooming stage.

Description

A kind of rubber tree blooms modulin HbTFL1-1 and encoding gene thereof and application

Technical field

The present invention relates to biological technical field, specifically, relate to a kind of rubber tree and to bloom modulin HbTFL1-1 and encoding gene thereof and application.

Background technology

TFL1/CEN-like gene is extensively present in flowering plant, is the very important suppression person of blooming of a class.They determine Gene A P1 and LFY gene by suppressing the downstream floral organ of FT gene, realize the object suppressing to bloom.

In Arabidopis thaliana tfl1 mutant, Arabidopis thaliana significantly shortens vegetative growth phase, and inflorescence changes terminal inflorescence into from indeterminate inflorescence simultaneously.Therefore prove that Arabidopis thaliana TFL1 gene has function (the Bradley D simultaneously regulating and controlling to nourish and grow with inflorescence development, Ratcliffe O, Vincent C, Carpenter R, Coen E (1997) Inflorescence commitment and architecturein Arabidopsis.Science 275:80 – 83).In pea, two TFL1-like genes are proved to be regulation and control pea two the different etap, and LF gene regulating maintains the uncertainty of apical meristem, and DET gene then regulates and controls the uncertainty of inflorescence meristem.Therefore, in lf/DET plant, flowering period shifts to an earlier date, but the growth of inflorescence is not affected, in LF/det plant, flowering period is not affected, but inflorescence changes terminal inflorescence into by indeterminate inflorescence, in the two mutant plant of lf/det, phenotype is just as Arabidopis thaliana tfl1 mutant, vegetative growth phase and inflorescence development are all had a strong impact on (Foucher F, Morin J, CourtiadeJ, Cadioux S, Ellis N, Banfield M J, Rameau C (2003) DETERMINATE and LATE FLOWERING are two TERMINALFLOWER1/CENTRORADIALIS homologs that control two distinctphases of flowering initiation and development in pea.Plant Cell15:2742 – 2754).And CEN gene, be found in model plant Common Snapdragon the earliest, it has very strong tissue expression specificity, shortly starts to express when inflorescence meristem is formed, and strengthens gradually along with the growth of inflorescence.Common Snapdragon cen mutant plants shows inflorescence and changes terminal inflorescence into from indeterminate inflorescence, but nourish and grow and be not affected, illustrate that CEN regulates and controls inflorescence development and maintains inflorescence meristem uncertainty (BradleyD in Common Snapdragon thus, Carpenter R, Copsey L, Vincent C, Rothstein S, Coen E (1996) Control of inflorescence architecture in Antirrhinum.Nature379:791-797.).And in another model plant tobacco, CET2/CET4 but shows different expression patterns, Amaya etc. (1999) research shows that they are only being in high expression level in the lateral bud of nourishing and growing, and when tobacco enters flowering period, their expression is subject to NFL gene inhibition and reduces gradually.Illustrate that CET2/CET4 has very important effect (Amaya I to the maintenance that vegetative organ is grown, Ratcliffe O J, Bradley D J (1999) Expressionof CENTRORADIALIS (CEN) and CEN-like genes in tobacco reveals aconserved mechanism controlling phase change in diverse species.PlantCell 11:1405 – 1418).

Above result of study shows, the regulation and control of TFL1/CEN-like gene pairs vegetation growth of plant and/or reproductive development play very important effect.Para rubber tree has the vegetative growth phase reaching 5-8, studies the mechanism of different TFL1/CEN-like genes in rubber tree and contributes to carrying out Effective Regulation vegetative period to rubber tree.At present, in Para rubber tree, not yet about the report of TFL1/CEN-like gene.

Summary of the invention

In order to solve problems of the prior art, the object of this invention is to provide a kind of rubber tree and to bloom modulin HbTFL1-1 and encoding gene thereof and application.

In order to realize the object of the invention, first the present invention provides a kind of rubber tree to bloom modulin HbTFL1-1, and its aminoacid sequence is as shown in SEQ ID No.3.

Present invention also offers the encoding gene of described albumen.

Further, its nucleotides sequence is classified as shown in the 191bp ~ 712bp in SEQ ID No.1.

Present invention also offers a kind of regulatory gene HbTFL1-1 of blooming from rubber tree, its cDNA sequence is as shown in SEQ ID No.1.

Further, its DNA sequence dna is as shown in SEQ ID No.2.

Present invention also offers the carrier containing afore-mentioned code gene.

Present invention also offers the engineering bacteria containing aforementioned bearer.

Invention further provides afore-mentioned code gene and forementioned gene is postponing the application in plant blossom.

Further, be applied as described in and described engineering bacteria infected plant, the transfer-gen plant of acquisition delay in flowering period.

Principal character shows wheel seat leaf and major branch nodes showed increased, and disappearance appears in floral organ, and cause angle fruit abnormal, setting percentage reduces.There is not flowering phenotype in the most serious caused transfer-gen plant.

Beneficial effect of the present invention is:

The present invention makes public for the first time 5 regulatory genes of blooming, i.e. TFL1/CEN-like homologous gene, and they have different expression patterns in rubber tree vegetative organ:

1) for TFL1-like homologous gene, HbTFL1-1 mainly expresses in root and stabilization vane, and HbTFL1-2 is specifically expressing in root mainly, and HbTFL1-3 then expresses in stem and apical meristem.They have a common expression characteristic in addition, are exactly in flowering period (annual March), and 3 genes are starkly lower than and are in the plant that the virgin phase nourishes and grows being in the expression in the respective vegetative organ in generative growth phase plant.In inflorescence development process, the expression of 3 genes all raises gradually along with the growth of inflorescence, but in the male flower of blooming and female flower, show different relative expression quantities, wherein, HbTFL1-1 expresses almost in male flower and female flower, and HbTFL1-2 expresses apparently higher than the expression in male flower in female flower; The expression highly significant of HbTFL1-3 then in male flower higher than the expression in female flower.

2) for CEN-like homologous gene, they have similar expression pattern in rubber tree vegetative organ, but incomplete same.In 3 months large seedlings, the two mainly expresses in root, stem and bud.In growth and development process, the expression trend that the two shows is divided into three kinds.The first, in root, the two all reduces gradually along with the age increases to express, and is reduced to 1 in 2 years in tree.The second, in stem, the two shows the trend first raising and reduce afterwards; In bud, HbCEN1 shows the expression trend first raising and reduce afterwards, and HbCEN2 then shows along with the age increases the trend reduced gradually.In inflorescence development process, the two shows similar expression pattern, and namely along with their expression of growth of inflorescence reduces gradually, especially HbCEN1, expresses trend clearly.

In addition, proceeded to respectively in wildtype Arabidopsis thaliana by 5 genes respectively, transfer-gen plant has obvious prolongation than WT lines in vegetative growth phase and florescence.Principal character shows as wheel seat leaf and major branch nodes showed increased, and disappearance appears in floral organ, and cause angle fruit abnormal, setting percentage reduces.There is not flowering phenotype in the most serious caused transfer-gen plant.Again 5 genes are proceeded in tfl1-1 mutant respectively, result, tfl1-1 mutant phenotype all can be reverted to wild type phenotype by 5 genes effectively, and some have also appeared serious delay vegetative growth phase and the phenotype at florescence, and What is more has occurred not Flowering Phenomenon.

Therefore, these 5 genes can be used as Para rubber tree bloom regulation and control important candidate gene, by the genetic transformation of Para rubber tree is expected to realize to Para rubber tree florescence control.Equally, also can apply in other farm crop, the florescence sterile series of problems brought when solution sibling species or different varieties hybridization, also can regulate and control breeding time in addition.

Accompanying drawing explanation

Fig. 1 is 3 TFL1-like Tissue-specific expressions and spatial and temporal expression analysis.Wherein A is the pattern analysis of HbTFL1-1 gene spatial and temporal expression; B is the pattern analysis of HbTFL1-2 gene spatial and temporal expression; C is the pattern analysis of HbTFL1-3 gene spatial and temporal expression.

Fig. 2 is 2 CEN-like Tissue-specific expressions and spatial and temporal expression analysis.Wherein A is the pattern analysis of HbCEN1 gene spatial and temporal expression; B is the pattern analysis of HbCEN2 gene spatial and temporal expression.

Fig. 3 is the expression analysis of 3 TFL1-like genes in inflorescence 5 different developmental phases.I, the inflorescence of the first etap; II, the inflorescence of the second etap; III, the inflorescence of the 3rd etap; IV, the inflorescence of the 4th etap; V, the inflorescence of the 5th etap; A is HbTFL1-1 gene expression analysis; B is HbTFL1-2 gene expression analysis; C is HbTFL1-3 gene expression analysis.

Fig. 4 is the expression analysis of 2 CEN-like genes in inflorescence 5 different developmental phases.I, the inflorescence of the first etap; II, the inflorescence of the second etap; III, the inflorescence of the 3rd etap; IV, the inflorescence of the 4th etap; V, the inflorescence of the 5th etap; A is HbCEN1 gene expression analysis; B is HbCEN2 gene expression analysis.

Fig. 5 is that wildtype Arabidopsis thaliana compares with turn 3 TFL1-like gene plant flowering phenotype respectively.Wherein A is that wildtype Arabidopsis thaliana turns HbTFL1-1 gene flowering phenotype with it and compares; B is that wildtype Arabidopsis thaliana turns HbTFL1-2 gene plant flowering phenotype with it and compares; C is that wildtype Arabidopsis thaliana turns HbTFL1-3 gene plant flowering phenotype with it and compares.

Fig. 6 is that wildtype Arabidopsis thaliana compares with turn 2 CEN-like gene plant flowering phenotype respectively.Wherein A is that wildtype Arabidopsis thaliana turns HbCEN1 gene flowering phenotype with it and compares; B is that wildtype Arabidopsis thaliana turns HbCEN2 gene plant flowering phenotype with it and compares.

Fig. 7 is the recovery confirmatory experiment that Arabidopis thaliana tfl1-1 mutant transforms 3 TFL1-like genes.

Fig. 8 is the recovery confirmatory experiment that Arabidopis thaliana tfl1-1 mutant transforms 2 CEN-like genes.

Embodiment

Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.

The acquisition of embodiment 1 Para rubber tree 5 target genes

According to rubber tree genome database and the blade transcript profile database of Rubber Institute, Chinese Academy of Agricultural Science, by the contig that the mode of homology comparison obtains, then splice, then design special primer and obtain by the online software prediction open reading of NCBI and include DNA sequence dna and the cDNA sequence of entire open reading frame.

Concrete grammar is as follows:

The acquisition of 5 gene open reading frames

5 gene specific primers are as follows:

HbTFL1-1OF(EcoRI):G ATGTCAAGGATCATGGAGCC

HbTFL1-1OR(XbaI):GC TCATCTTCTTCTTGCAGCAGTTT

HbTFL1-2OF(EcoRI):G ATGGCAAGAATAATAGAACCTCT

HbTFL1-2OR(XbaI):GC TTAGCGCCTTCTTGCAGCAGTT

HbTFL1-3OF(EcoRI):G ATGGCAAGAATAATAGAACCTCT

HbTFL1-3OR(XbaI):GC TTAGCGTCTTCTTGCAGCAGTT

HbCEN1OF(EcoRI):G ATGGCGAAGACAACAGATCCTC

HbCEN1OR(XbaI):GC TCAGCGCCTCCTTGCAGC

HbCEN2OF(EcoRI):G ATGGCCAAGACTTCAGACCCTC

HbCEN2OR(XbaI):GC TCAGCGTCTCCTTGCTGCT

Respectively with HbTFL1-1OF (EcoRI) and HbTFL1-1OR (XbaI), HbTFL1-2OF (EcoRI) and HbTFL1-2OR (XbaI), HbTFL1-3OF (EcoRI) and HbTFL1-3OR (XbaI), HbCEN1OF (EcoRI) and HbCEN1OR (XbaI), HbCEN2OF (EcoRI) and HbCEN2OR (XbaI) consists of primer pair, each primer pair is more respectively with rubber tree root, blade, the cDNA of bud and inflorescence is masterplate, and increase 5 target genes respectively.

PCR response procedures is: 95 DEG C of 3min denaturations, 95 DEG C of sex change 30s, 55 DEG C of annealing 30s, and 72 DEG C of 1min extend, 35 circulations, and 72 DEG C of 10min extend eventually.

Amplified production is connected with pMD-19 carrier, checks order in transformation of E. coli DH5a.Finally, the entire open reading frame of 5 genes is obtained.

The acquisition of 5 gene 5 ' UTR:

For HbTFL1-3,5 ' UTR is obtained by 5 ' RACE, and adapter-primer used has 3:

QT(CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTT)，

Q1 (GAGGACTCGAGCTCAAGC) and Q0 (CCAGTGAGCAGAGTGACG).

5 ' RACE operating process reference literature (Dieffenbacher C W, moral Vicks VapoRub strangles G R.PCR technology experiment guide. and Huang Peitang translates. Beijing: Science Press, 1998:268-277).

HbTFL1-3 5 ' RACE special primer used is:

HbTFL1-3-GSP5 ^1st:(GGGCCTTGGAATTTCATAGCTC)，

HbTFL1-3-GSP5 ^2nd:(GTGCAGGTGCTCCCTCAAATAAG)。

All the other genes, the positive primer devising some different positionss at upstream from start codon respectively with open reading frame within a downstream primer match and carry out PCR, until obtain 5 ' the longest UTR.

The primer pair that HbTFL1-1 obtains 5 ' the longest UTR used is:

HbTFL1-15UF:(CTCCTCTCACGAGTCCCTTTCTACC)，

HbTFL1-15UR:(ACATCGCCTACAACTCTCCCT)。

The primer pair that HbTFL1-2 obtains 5 ' the longest UTR used is:

HbTFL1-25UF:

(ATTCCAGGACCAGGAGTCTTATTCTTGATG)，

HbTFL1-25UR:(ATGTCCATTGTAGACTTGCCTGTTATTGTA)。

The primer pair that HbCEN1 obtains 5 ' the longest UTR used is:

HbCEN15UF:(TCCACCCCCATTGCCTTACAAGAG)，

HbCEN15UR:(ATCTGTTGTCTTCGCCATTAGAGACTTG)。

The primer pair that HbCEN2 obtains 5 ' the longest UTR used is:

HbCEN25UF:(GGTCTGCTTCCACCCTCATTGCCTTAC)，

HbCEN25UR:(TCTCCAATAACCCCCCCAACCACC)。

Amplification program is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, and 55 DEG C of annealing 30s, 72 DEG C extend 1min, and 35 circulations, 72 DEG C of ends extend 10min.

The acquisition of 5 gene 3 ' UTR:

HbTFL1-1 gene 3 ' UTR is complete in transcript profile.3 ' UTR of all the other genes obtains 3 ' UTR by 3 ' RACE.Adapter-primer used is the same with 3 adapter-primer that 5 ' RACE uses, 3 ' RACE operating process is also reference literature (Dieffenbacher C W simultaneously, moral Vicks VapoRub strangles G R.PCR technology experiment guide. and Huang Peitang translates. Beijing: Science Press, 1998:268-277).First use QT primer as reverse transcription primer, reverse transcription program by reverse transcription as directed book carry out.Afterwards respectively with the GSP3 of HbTFL1-2, HbTFL1-3, HbCEN1 and HbCEN2 gene ^1stbe that primer carries out first round PCR respectively with Q0, take turns the masterplate of PCR afterwards respectively using 50 times of dilution PCR primer as second.Carry out second when taking turns PCR, more respectively with the GSP3 of these 4 genes ^2ndbe combined as primer pair with Q1 to carry out second and take turns PCR, product digs glue by electrophoresis and obtains.Amplification program is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, and 55 DEG C of annealing 30s, 72 DEG C extend 1min, and 35 circulations, 72 DEG C of ends extend 10min.

HbTFL1-2-GSP3 ^1st:GTGAGCGACATCCCTGGAACA

HbTFL1-2-GSP3 ^2nd:CGAAGACAGACAATCAACCCACC

HbTFL1-3-GSP3 ^1st:CGAAGACAGACAATCAACCCACC

HbTFL1-3-GSP3 ^2nd:GAAACTGCTGCAAGAAGACGCTAAC

HbCEN1-GSP3 ^1st:GCACTTGCACTGGATAGTTACGGAC

HbCEN1-GSP3 ^2nd:TCCATAGGTTTGTTTTCCTTCTGTTCA

HbCEN2-GSP3 ^1st:ATAGTGACAGACATCCCGGGCA

HbCEN2-GSP3 ^2nd:TCCATAGGTTTGTGTTCCTTCTGTT

The acquisition of 5 gene cDNA sequences:

According to 5 ' and 3 ' acquisition of UTR, again devise special primer.

Wherein:

HbTFL1-1 primer pair is:

HbTFL1-1F:CTCCTCTCACGAGTCCCTTTCTACCCTTG，

HbTFL1-1R:GAGAGAAACAATTTCATACTTACATTAC；

HbTFL1-2 primer pair is:

HbTFL1-2F：ATTCCAGGACCAGGAGTCTTATTCTTG，

HbTFL1-2R：GACAGATATATATGTTTCTGCAAGCTTA；

HbTFL1-3 primer pair is:

HbTFL1-3F：AGAGAGAGAGAGAGAGATGACAGATTCC，

HbTFL1-3R：GACAGATGAAACAGATTATATAGAGAGC；

HbCEN1 primer pair is:

HbCEN1F：TCCACCCCCATTGCCTTACA，

HbCEN1R：ACTTTTGGCTAATACCCATTTTTATTCA；

HbCEN2 primer pair is:

HbCEN2F：GGTCTGCTTCCACCCTCATTGC，

HbCEN2R：ACGAGGAAGAAGTCCATTGTTAGGACAC。

The amplification program of 5 goal gene cDNA sequence is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, and 55 DEG C of annealing 30s, 72 DEG C extend 90s, and 35 circulations, 72 DEG C of ends extend 10min.The PCR primer obtained is connected with pMD19 and checks order.5 gene fragments that sequencing result obtains as being numbered Isosorbide-5-Nitrae in sequence table, 7,10, the sequence of 13.

The amplification program of 5 goal gene DNA sequence dnas is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, and 55 DEG C of annealing 30s, 72 DEG C extend 2min, and 35 circulations, 72 DEG C of ends extend 10min.The PCR primer obtained is connected with pMD19 and checks order.5 gene fragments that sequencing result obtains are sequence table 2,5,8,11, the sequence of 14.

Embodiment 25 target gene tissue specific expressions are analyzed

It is experiment material that 3 months large rubber tissue cultured seedling are chosen in this research.Gather root, stem, bud, bronze leaf, variable color leaf, pale green leaf and stabilization vane respectively, the RNA extracting them is respectively for subsequent use.

Reverse transcription was carried out according to Reverse Transcription box after DnaseI digestion is entered to above-mentioned obtained RNA.The analysis of 5 target gene tissue specific expressions is carried out by fluorescent quantitation technology.

5 gene by fluorescence quantitative primers are respectively:

HbTFL1-1QF:CCTCCTTAATCCCTGGCTACG，

HbTFL1-1QR:ACATCGCCTACAACTCTCCCT，

HbTFL1-2QF:GCCACATTTGGAAGGGAGATAG，

HbTFL1-2QR:TAACACTTATTATTGAAGGCCACTTG，

HbTFL1-3QF:ATACACCTCTTAGCCAGACGCTC，

HbTFL1-3QR:TGTCGCCTCCTTGGACCTCA，

HbCEN1QF:CTAATGGCGAAGACAACAGAT，

HbCEN1QR:CACCTCCCTGGACCTCAAC，

HbCEN2QF:GAAACAGCAGCAAGGAGACG，

HbCEN2QR:ATTGGTGCGACTGATACGAC。

Result shows: for TFL1-like gene, and HbTFL1-1 mainly expresses in root and stabilization vane, and HbTFL1-2 is specifically expressing in root mainly, and HbTFL1-3 then expresses in stem and apical meristem, as shown in Figure 1.For CEN-like gene, HbCEN1 and HbCEN2 is main to express in root, stem and bud.As shown in Figure 2.

The spatial and temporal expression pattern analysis of embodiment 35 target genes

Respectively with 3 months, within 2 years and 10 years, set as research object, save the root, stem, bud, bronze leaf, variable color leaf, pale green leaf and the stabilization vane that gather age bracket respectively in (March) during the blossom season, and male flower when tree bloomed in 10 years and female flower, extraction RNA is for subsequent use respectively.

Reverse transcription was carried out according to Reverse Transcription box after DnaseI digestion is entered to above-mentioned obtained RNA.Respectively spatial and temporal expression pattern analysis is carried out to 5 target genes by fluorescent quantitation technology.

Result shows: save during the blossom season, and for TFL1-like gene, HbTFL1-1, HbTFL1-2 and HbTFL1-33 gene expression in 10 years trees separately in vegetative organ is starkly lower than sets for 3 months and 2 years.In the inflorescence just broken up, the expression of 3 genes is almost 0, and in the male flower of blooming and female flower, the expression of 3 genes is all obviously risen and shows different expression levels.HbTFL1-1 expresses almost in male flower and female flower, and HbTFL1-2 expresses apparently higher than the expression in male flower in female flower; The expression highly significant of HbTFL1-3 then in male flower higher than the expression in female flower, as shown in Figure 3.And for CEN-like gene, the expression trend that HbCEN1 and HbCEN2 shows is divided into three kinds.The first, in root, the two all reduces gradually along with the age increases to express, and is reduced to 1 in 2 years in tree.The second, in stem, the two shows the trend first raising and reduce afterwards; In bud, HbCEN1 shows the expression trend first raising and reduce afterwards, and HbCEN2 then shows along with the age increases the trend reduced gradually.As shown in Figure 4.

The expression analysis of embodiment 45 target genes in inflorescence development process

With just at the inflorescence of growth course for research object.Inflorescence development is divided into 5 periods, the criteria for classifying is first period: inflorescence length is about 0.5cm, second period: inflorescence length is about 2.0cm, 3rd period: inflorescence length is about 4.0cm, 4th period: inflorescence length is about 8.0cm, 5th period is flowering period, inflorescence length >8.0cm.Gather the inflorescence in 5 periods respectively and to extract RNA for subsequent use.

Reverse transcription was carried out according to Reverse Transcription box after DnaseI digestion is entered to above-mentioned obtained RNA.Respectively 5 target genes are carried out to the expression analysis in different inflorescence development stage by fluorescent quantitation technology.

Result shows: 3 growths of TFL1-like gene all along with inflorescence in inflorescence development process constantly raise, as shown in Figure 5.And 2 growths of CEN-like gene all along with inflorescence in inflorescence development process constantly reduce, as shown in Figure 6.

The functional verification of embodiment 55 target gene transformed wild type Arabidopis thalianas

Utilize pXCS plant expression vector (being preserved by Rubber Institute, Chinese Academy of Agricultural Science) to be connected with 5 target genes respectively, build arabidopsis thaliana transformation wild-type conversion carrier.Specific embodiments is as follows:

The primer of 5 target genes of design construction plant expression vector respectively.The used special primer being 5 genes described in embodiment 1 for the primer building plant expression vector, wherein the positive primer 5 ' end of 5 genes is added with EcoRI restriction enzyme site respectively, and anti-primer 5 ' end is added with XbaI enzyme cutting site respectively.The PCR primer of acquisition is connected with pMD19 carrier and checks order.Then, extract the plasmid that order-checking is correct, with EcoRI and the XbaI plasmid that double digestion pXCS and 5 order-checking is correct respectively, and respectively pXCS carrier is connected with 5 goal gene with T4DNA ligase enzyme, and called after pXCS-HbTFL1-1/WT, pXCS-HbTFL1-2/WT, pXCS-HbTFL1-3/WT, pXCS-HbCEN1/WT, pXCS-HbCEN2/WT.

Afterwards, the plant expression vector containing 5 target genes is imported in agrobacterium tumefaciens GV3101 (PMP90RK) (being preserved by Rubber Institute, Chinese Academy of Agricultural Science) respectively.

Infecting for wildtype Arabidopsis thaliana, reference literature (Clough, S.J.and Bent, A.F. (1998) Floral dip:a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant J.16:735-743.).It, for seed, first soaks with tap water by the T0 obtained, and to be positioned in 4 DEG C of environment darkrooms vernalization 3 days.Sow in 22 DEG C of long day ambient growth (16h/8h) on the vermiculite soaked through 1/2M substratum afterwards, when seedling germinates, spray, to screen resistant plant with the weedicide that concentration is 10g/L.After 10 days, normal for growth seedling is transplanted in Nutrition Soil (Nutrition Soil: vermiculite=2:1) and grows and wait for sowing.The detection of positive plant is by southern method, this method reference literature (Blanc G, Baptiste C, Oliver G, Martin F, Montoro P. (2006) Efficient Agrobacteriumtumefaciens-mediated transformation of embryogenic calli andregeneration of Hevea brasiliensis M ¨ ull Arg.Plants.Plant Cell Rep (2006) 24:724 – 733).

5 gene T3 are cultivated with wild-type respectively for transfer-gen plant in equivalent environment, and relatively flowering phenotype is carried out to them and compare.

Result shows: for TFL1-like gene, when wildtype Arabidopsis thaliana when blooming for about 32 days, 3 TFL1-like gene transgenic plant also do not see bolting, as shown in Figure 5; And for CEN-like gene, wildtype Arabidopsis thaliana has tied a lot of angles fruit after 40 days, but 2 CEN-like gene transgenic plant just start to bloom, as shown in Figure 6.

Embodiment 65 target genes recover confirmatory experiment to tfl1-1 mutation type surface

This recovers the plant expression vector that confirmatory experiment has rebuild 5 target genes, and used primer is as follows:

HbTFL1-1OF(EcoRI):G ATGTCAAGGATCATGGAGCC

HbTFL1-1OR(XmaI):CCC TCTTCTTCTTGCAGCA

HbTFL1-2OF(EcoRI):G ATGGCAAGAATAATAGAACCTCT

HbTFL1-2OR(XmaI):CCC GCGCCTTCTTGCAGCA

HbTFL1-3OF(EcoRI):G ATGGCAAGAATAATAGAACCTCT

HbTFL1-3OR(XmaI):CCC GCGTCTTCTTGCAGCA

HbCEN1OF(EcoRI):G ATGGCGAAGACAACAGATCCTC

HbCEN1OR(XmaI):CCC GCGCCTCCTTGCAGC

HbCEN2OF(EcoRI):G ATGGCCAAGACTTCAGACCCTC

HbCEN2OR(PstI):TGCA GCGTCTCCTTGCTG

The positive primer 5 ' end of 5 genes is added with EcoRI restriction enzyme site respectively.For anti-primer, the 5 ' end of HbTFL1-1, HbTFL1-2, HbTFL1-3 and HbCEN1 is added with XmaI restriction enzyme site all respectively, and the 5 ' end of HbCEN2 is then added with PstI restriction enzyme site.The PCR primer of acquisition is connected with pMD19 carrier and checks order.Finally, extract the plasmid that order-checking is correct, with EcoRI and XmaI double digestion pXCS carrier and correct HbTFL1-1, HbTFL1-2, HbTFL1-3 and HbCEN1 plasmid that checks order respectively, and respectively pXCS carrier is connected with goal gene with T4DNA ligase enzyme, meanwhile, with EcoRI and PstI double digestion pXCS carrier and the correct HbTFL1-2 plasmid that checks order respectively, connect with T4DNA ligase enzyme.Finally construct the plant expression vector of 5 target genes respectively, called after pXCS-HbTFL1-1/tfl1-1, pXCS-HbTFL1-2/tfl1-1, pXCS-HbTFL1-3/tfl1-1, pXCS-HbCEN1/tfl1-1, pXCS-HbCEN2/tfl1-1.

5 the target gene plant expression vectors built are distinguished in arabidopsis thaliana transformation tfl1-1 mutant, reference literature (Clough, S.J.and Bent, A.F. (1998) Floral dip:a simplified method for Agrobacterium-mediated transformation ofArabidopsis thaliana.Plant J.16:735-743.).It, for seed, first soaks with tap water by the T0 obtained, and to be positioned in 4 DEG C of environment darkrooms vernalization 3 days.Sow in 22 DEG C of long day ambient growth (16h/8h) on the vermiculite soaked through 1/2M substratum afterwards, when seedling germinates, spray, to screen resistant plant with the weedicide that concentration is 10g/L.After 10 days, normal for growth seedling is transplanted in Nutrition Soil (Nutrition Soil: vermiculite=2:1) and grows and wait for sowing.

5 tfl1-1 mutant transfer-gen plants are cultivated in equivalent environment with wild-type, tfl1-1 mutant plants respectively, and compare they and wild-type respectively, the flowering phenotype of tfl1-1 mutant plants.

Result shows: tfl1-1 mutant plants flowering time is about 27 days, and WT lines flowering time is about 32 days, and 5 tfl1-1 mutant transfer-gen plants can late blooming time effectively, and is longer than 32 days, as shown in FIG. 7 and 8.

Conclusion:

The present invention obtains 5 TFL1-like genes first in Para rubber tree.3 TFL1-like genes have different tissue expression specificities; Save (March) during the blossom season, the expression in 10 years trees separately in vegetative organ of 3 genes is starkly lower than 3 months large trees and 2 years trees; 3 growths of gene all along with inflorescence in inflorescence development process simultaneously constantly raise.In the male flower of blooming and female flower, the expression of 3 genes is all apparently higher than the inflorescence just broken up but each comfortable male flower is not identical with the expression level in female flower.HbTFL1-1 expresses almost in male flower and female flower, and HbTFL1-2 expresses apparently higher than the expression in male flower in female flower; The expression highly significant of HbTFL1-3 then in male flower higher than the expression in female flower.These 3 genes of these results presumptions may take part in maintenance and the inflorescence development of rubber tree virgin phase simultaneously, and meanwhile, HbTFL1-2 and HbTFL1-3 may play a different role respectively to the growth of Male and female flowers.For 2 CEN-like genes, they have similar expression pattern in rubber tree vegetative organ, but incomplete same.In 3 months large seedlings, the two mainly expresses in root, stem and bud.Along with along with growing, the expression trend that the two shows is divided into three kinds.The first, in root, the two all reduces gradually along with the age increases to express, and is reduced to 1 in 2 years in tree.The second, in stem, the two shows the trend first raising and reduce afterwards; In bud, HbCEN1 shows the expression trend first raising and reduce afterwards, and HbCEN2 then shows along with the age increases the trend reduced gradually.In inflorescence development process, the two shows similar expression pattern, and namely along with their expression of growth of inflorescence reduces gradually, especially HbCEN1, expresses trend clearly.These results presumptions, these two genes probably participate in maintaining rubber tree and nourish and grow.By showing Arabidopis thaliana wild-type genetic transformation, 5 genes obviously can affect Arabidopis thaliana and nourish and grow and the growth of inflorescence.Meanwhile, 5 genes process LAN in tfl1-1 mutant plants, tfl1-1 mutant phenotype all can be reverted to wild type phenotype effectively, even occurs late blooming or not flowering phenotype.In a word, no matter to nourish and grow from rubber tree or from the inflorescence development stage entering reproductive growth, the high expression level of 5 genes is to the maintenance of rubber tree virgin phase and/or have very important effect to inflorescence development.And these act in transgenic arabidopsis and are all embodied.Therefore these 5 can be used as the very useful regulation and control candidate gene of blooming of Para rubber tree, realize the Effective Regulation of blooming to rubber tree by gain-of-function mutation or afunction mutation research.

Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.

Claims

1. rubber tree blooms a modulin HbTFL1-1, and it is characterized in that, its aminoacid sequence is as shown in SEQ ID No.3.

2. the encoding gene of albumen described in claim 1.

3. encoding gene according to claim 2, is characterized in that, its nucleotides sequence is classified as shown in the 191bp ~ 712bp in SEQ ID No.1.

4. from a regulatory gene HbTFL1-1 of blooming for rubber tree, it is characterized in that, its cDNA sequence is as shown in SEQ ID No.1.

5. gene HbTFL1-1 according to claim 4, is characterized in that, its DNA sequence dna is as shown in SEQ ID No.2.

6. the carrier containing encoding gene described in Claims 2 or 3.

7. the engineering bacteria containing carrier described in claim 6.

8. gene described in encoding gene described in Claims 2 or 3 and claim 4 or 5 is postponing the application in plant blossom.

9. application according to claim 8, is characterized in that, engineering bacteria according to claim 7 is infected plant, obtains the transfer-gen plant postponed flowering period.