CN111560077A

CN111560077A - Enzyme and its use in synthesis of pullulan

Info

Publication number: CN111560077A
Application number: CN202010435722.5A
Authority: CN
Inventors: 池振明; 池哲; 刘光磊; 陈铁军; 姜宏
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2020-05-21
Filing date: 2020-05-21
Publication date: 2020-08-21

Abstract

The invention relates to the technical field of biology, in particular to an enzyme and an effect thereof in pullulan synthesis. The different domains of AGS2 can accomplish all the functions of transporting pullulan precursors from the inside to the outside, capturing pullulan precursors (α -1, 4-glucan), cleaving maltotriose, connecting maltotriose into pullulan, and connecting the synthesized pullulan to lipid carriers of cell membranes. This is the first discovery of a key enzyme of AGS2 in pullulan synthesis process, and is also the first discovery of a multifunctional enzyme with these specific domains. The discovery of the enzyme is helpful to deeply understand the specific path and the regulation and control mode of synthesizing the pullulan by the yeast, and has important practical significance for editing the synthesis and the physicochemical properties of the pullulan through metabolic engineering and molecules. Thereby solving the problems of long-term pullulan polysaccharide synthesis path, related key enzyme and gene unsolved problem.

Description

Enzyme and its use in synthesis of pullulan

Technical Field

The invention relates to the technical field of biology, in particular to an enzyme and an effect thereof in pullulan synthesis.

Background

Pullulan is mainly a linear extracellular glucan produced by Aureobasidium spp, and is structurally formed by connecting repeated maltotriose units by alpha- (1 → 6) glycosidic bonds, and the chemical structure of the pullulan is shown in figure 1; the connection mode ensures that the pullulan polysaccharide has the characteristics of better structural flexibility, water solubility, adhesiveness, film-forming property, degradability and the like. Therefore, it has attracted attention for its wide use in the fields of foods, cosmetics, biomedicines, and the like. Currently pullulan, one of the most important commercial exopolysaccharides produced by microorganisms, has been produced in large quantities by the forestry companies in japan since the last 70 th century and sold in large quantities worldwide, and the selling price of Sigma company in the market is $ 2000 per kg. The price of pulullan polysaccharide produced in China is 23 ten thousand RMB/ton, and the import price is 25 ten thousand RMB/ton. Although the structure of pullulan (formula 1) was clearly identified in the last 60 centuries, it was not clear how this chemical structure was synthesized in Aureobasidium spp.

It is now widely accepted that alpha-phosphoglucomutase catalyzes the conversion of glucose-6-phosphate from the glycolytic pathway to glucose-1-phosphate, and that glucose-1-phosphate reacts with UTP under the catalysis of UDP-glucose pyrophosphorylase to form UDP-glucose, which is a common precursor for the synthesis of pullulan, trehalose, glycogen and cell wall glucans.

In 1982 Catley and McDowell believed that D-glucose (G) from UDP-glucose was linked to a lipid molecule (L-P-P) of the membrane via a phosphate linkage to form L-P-P-G, another molecule of D-glucose from UDP-glucose was linked to L-P-P-G in series to form L-P-P-G- α -1,6-G and L-P-P-G- α -1,6-G- α -1,4-G, and finally this isoppanosyl group (isopranosyl) formed the pullulan polysaccharide chain by polymerization.

In 2008, Duan et al considered that during the synthesis of pullulan, 3 key enzymes were required for the conversion of glucose to pullulan: alpha-phosphoglucomutase catalyzes the conversion of 6-phosphate-glucose into 1-phosphate-glucose, 1-phosphate-glucose and UTP react under the catalysis of UDP-glucose pyrophosphorylase to form UDP-glucose, and the formed UDP-glucose forms pullulan under the action of glucose glycosyltransferase.

On this basis, Li et al suggested a possible synthetic route to pullulan in 2015. Firstly, the glucose group on UDP-glucose is transferred to a cell membrane lipid (Lph) acceptor under the catalysis of glucosyltransferase, and Lph-Glu is formed through phospholipid bond; then under the catalysis of second glucose transferase, transferring the glucose group on UDP-glucose to Lph-glucose molecule, and connecting with alpha- (1,6) glycosidic bond to form isomaltose group (Lph-Glu-alpha- (1,6) -Glu); then, the above-mentioned glucose transport process of UDP-glucose is repeated under the catalysis of 3 rd glucosyltransferase to form isoperasyl (Lph-Glu-alpha- (1,6) -Glu-alpha- (1,4) -Glu) by connecting alpha- (1,4) glycosidic bond to isomaltose group; finally, under the action of pullulan synthase, the isoperacyl is polymerized as a structural unit to form the pullulan.

However, the above-hypothesized pullulan synthetic pathway has no genetic or biochemical evidence. Therefore, there is a constant research on the biosynthesis pathway of pullulan.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide an enzyme and its use in pullulan synthesis, wherein the enzyme is named as α -glucan synthase 2(α -glucan synthase2, abbreviated as AGS2), wherein one domain Big-5 specifically binds to α -1, 4-glucan as a pullulan precursor, maltotriose is specifically cleaved from the pullulan precursor under the catalysis of α -amylase as another domain of the α -glucan synthase2, and the cleaved maltotriose links a plurality of maltotriose units into high molecular weight pullulan through α -1, 6-glycosidic bonds under the catalysis of the glycosidase 1-glycogen synthase domain of the α -glucan synthase 2.

The enzyme (AGS2) provided by the invention comprises: an alpha-amylase catalytic domain, an alpha-1, 4-glucan localization domain, a GT 1-glycogen synthase domain, and an exopolysaccharide-transglycosylation domain.

The AGS2 enzyme provided by the invention at least comprises 2 transmembrane structures.

The amino acid sequence of the catalytic structure domain of the alpha-amylase in the AGS2 enzyme comprises an Asp-X-Glu-Asp sequence, wherein X consists of any 2-5 amino acids;

preferably, the alpha-amylase catalytic domain comprises the amino acid sequence shown in SEQ ID NO 1; or an amino acid sequence having at least 90% homology to SEQ ID NO. 1. In some embodiments, the amino acid sequence of the alpha-amylase catalytic domain is set forth in SEQ ID NO 1.

The alpha-amylase catalytic domain (position 16 to 579 of the amino acid sequence shown in SEQ ID NO 7), which contains D-X-E-D catalytic amino acids, is a specific amino acid that hydrolyzes the alpha-1, 4-glycosidic bond of alpha-1, 4-glucan and is responsible for the hydrolysis of the alpha-1, 4-glycosidic bond in the pullulan precursor (alpha-1, 4-glucan) molecule to release maltotriose subunits.

The alpha-1, 4-glucan positioning structure domain in the AGS2 enzyme provided by the invention comprises a Leu-Gln-Ser sequence;

preferably, the alpha-1, 4-glucan localization domain comprises an amino acid sequence shown as SEQ ID NO. 2; or an amino acid sequence having at least 90% homology with SEQ ID NO. 2. In some embodiments, the amino acid sequence of the α -1, 4-glucan localization domain is set forth in SEQ ID NO 2.

The alpha-1, 4-glucan localization domain in AGS2 enzyme is the domain of bacterial immunoglobulins (positions 724 to 828 of the amino acid sequence shown in SEQ ID NO: 7), abbreviated as Big-5 domain, which is responsible for attaching, binding and localizing AGS2 to the molecular chain of the pullulan precursor (alpha-1, 4-glucan).

The GT 1-glycogen synthase domain of the AGS2 enzyme provided by the present invention comprises a Lys-Ile-Gly-Gly sequence;

preferably, the GT 1-glycogen synthase domain comprises the amino acid sequence set forth in SEQ ID NO 3; or an amino acid sequence having at least 90% homology with SEQ ID NO. 3. In some embodiments, the amino acid sequence of the GT 1-glycogen synthase domain is set forth in SEQ ID NO 3.

Conserved GT 1-glycogen synthase domain (positions 1169 to 1625 of the amino acid sequence shown in SEQ ID NO: 7), (containing KIGG catalytic amino acids, plant and algal starch synthases and glycogen synthase catalytic site specific amino acids), catalyzes the release of maltotriose, which is linked by alpha-1, 6-glycosidic linkages into pullulan macromolecules.

The exopolysaccharide-transglycosylation domain in the AGS2 enzyme provided by the invention comprises an amino acid sequence shown in SEQ ID NO. 4; or an amino acid sequence having at least 90% homology with SEQ ID NO. 4. In some embodiments, the exopolysaccharide-transglycosylation domain has an amino acid sequence as set forth in SEQ ID NO 4.

The conserved exopolysaccharide-transglycosylation domain (positions 1965 to 2351 of the amino acid sequence shown in SEQ ID NO: 7) is responsible for linking the synthetic pullulan macromolecule to the lipid carrier molecule of the cell membrane.

Through hydrophobicity analysis, the AGS2 is found to contain 2 transmembrane structures besides the 4 domains, wherein one transmembrane structure (in the middle of AGS2 protein) is transmembrane once, and the other transmembrane structure (at the carboxyl terminal of AGS2 protein) is transmembrane 11 times.

2 of the transmembrane structures are transmembrane structure a and transmembrane structure B:

transmembrane structure A transmembrane 1 time at the position comprising the amino acid sequence shown in SEQ ID NO. 5;

the transmembrane structure B transmembrane 11 times at a position including the amino acid sequence shown in SEQ ID NO 6.

In the AGS2 enzyme obtained by the invention, a Big-5 structural domain, a conserved alpha-amylase catalytic structural domain, a conserved GT 1-glycogen synthase structural domain and a conserved exopolysaccharide-transglycosylation structural domain face to the outside of cells. The 11-time transmembrane structure is responsible for transporting the intracellular pullulan precursor (α -1, 4-glucan) to the outer surface of the cell membrane, so that the extracellular catalytic domains described above catalyze the synthesis of pullulan molecules. The AGS2 enzyme is not limited in the order of the Big-5 domain, the conserved alpha-amylase catalytic domain, the conserved GT 1-glycogen synthase domain, and the conserved exopolysaccharide-transglycosylation domain. In the invention, from the N end to the C end, an alpha-amylase catalytic domain, a Big-5 domain, a GT 1-glycogen synthase domain and an exopolysaccharide-transglycosylation domain are sequentially arranged.

In some embodiments, the AGS2 enzyme provided herein has an amino acid sequence as set forth in SEQ ID NO 7.

The invention also provides a DNA sequence encoding an AGS2 enzyme.

In some embodiments, the nucleotide sequence encoding the AGS2 enzyme is set forth in SEQ ID NO 8.

The present invention also provides an expression vector comprising a DNA sequence encoding an AGS2 enzyme.

The invention also provides host cells expressing the AGS2 enzyme.

The AGS2 enzyme provided by the invention has the function of synthesizing pullulan.

The invention also provides a preparation method of the pullulan, which is used for fermenting and expressing the host cell of the AGS2 enzyme to obtain the pullulan.

According to the other pullulan synthesis method provided by the invention, alpha-1, 4-glucan is used as a substrate, and AGS2 enzyme catalysis is used for obtaining pullulan.

AGS2 can perform all functions of transporting pullulan precursor from inside to outside, capturing pullulan precursor (alpha-1, 4-glucan), cleaving maltotriose, linking maltotriose into pullulan, and linking the synthesized pullulan to a lipid carrier of cell membrane. This is the first discovery of the key role of AGS2 in pullulan synthesis and the first discovery of multifunctional enzymes with these specific domains. The discovery of the enzyme is helpful to deeply understand the specific path and the regulation and control mode of synthesizing the pullulan by the yeast, and has important practical significance for editing the synthesis and the physicochemical properties of the pullulan through metabolic engineering and molecules. Thereby solving the problems of long-term pullulan polysaccharide synthesis path, related key enzyme and gene unsolved problem.

Drawings

FIG. 1 shows a novel synthesis route for pullulan;

FIG. 2 shows the AGS2 catalytic domain;

FIG. 3 shows the transmembrane structure of AGS 2;

FIG. 4 shows the construction of a knockout vector for the AGS2 gene;

FIG. 5 shows the amplification of 5 'arm and 3' arm fragments of the AGS2 gene; the Marker is D2000 DNA ladder which is sequentially 2Kb, 1Kb, 750bp, 500bp, 250bp and 100bp from top to bottom;

FIG. 6 shows the growth of the positive recombinant strain (B) on a nourseothricin resistant double-layered HCS plate, whereas the untransformed P16 strain (A) did not grow on the plate;

figure 7 shows exopolysaccharide production, dry cell weight and dry cell weight sugar production per dry cell of P16 and different knockout strains, P <0.05,. P <0.01, compared to P16;

FIG. 8 shows a PCR-verified electropherogram; the Marker is 1Kb DNA ladder, and is 10Kb, 8Kb, 6Kb, 5Kb, 4Kb, 3Kb, 2Kb and 1Kb from top to bottom in sequence; lane 1 represents the template of the original strain P16 genome, and lane 2 represents the template of the knock-out strain AGS2-13 genome;

FIG. 9 shows colony morphology of P16 and knock-out strain Δ AGS 2-13;

FIG. 10 shows the cell morphology of wild type strain P16 and knockout strain Δ AGS2-13 strain;

FIG. 11 shows purification of exopolysaccharides;

FIG. 12 shows enzymatic hydrolysis products of exopolysaccharides; wherein, 1, glucose; 2. maltotriose; exopolysaccharide hydrolysates from strain P16; 4. exopolysaccharide hydrolysates produced by the Δ AGS2-1 strain; 5. exopolysaccharide hydrolysates produced by the Δ AGS2-3 strain; 6. exopolysaccharide hydrolysates produced by the Δ AGS2-7 strain; 7. exopolysaccharide hydrolysates from the Δ AGS2-13 strain; 8. inactivating pullulanase liquid;

FIG. 13 shows NMR carbon spectrum analysis of exopolysaccharide produced by strain Δ AGS2-13, 13-A is:¹³c spectrum; 13-B is:¹and (4) H spectrum.

Detailed Description

The invention provides an enzyme and an effect thereof in pullulan synthesis, and a person skilled in the art can appropriately modify process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The test materials adopted by the invention are all common commercial products and can be purchased in the market. Wherein the P16 strain is from the university of China sea.

The pramipexole polysaccharide belongs to extracellular polysaccharide synthesized and secreted by saccharomycetes, and structurally relates to a high-molecular-weight linear polysaccharide molecule formed by connecting maltotriose through alpha-1, 6 glycosidic bonds.

The alpha-glucan synthase provided by the invention is an enzyme for catalyzing maltotriose to form alpha-1, 6 glycosidic bond, and is called AGS2 for short.

In the present invention, the domain refers to a region having a specific structure and an independent function in a biological macromolecule, and particularly refers to such a region in a protein. In the AGS2 enzyme provided by the invention, amino acid sequences are connected among domains.

The invention is further illustrated by the following examples:

example (b):

1. AGS2 Gene cloning and analysis

Culturing aureobasidium melanogenesis P16 strain (Aureobasidium pullulans var. melanogenesis P16 from China oceanic university) with YPD culture medium to obtain high yield of pullulan, extracting genome DNA, and designing a primer for specifically amplifying AGS2 gene:

AGS2-F:ATGGCTTGCAAAATGATCAAACTGGCCGC；

AGS2-R:TCAAGGCTTGAACAACTGTTCGTTGCGG。

the base sequence of the amplified AGS2 gene is shown in SEQ ID NO. 8. The deduced amino acid sequence is shown in SEQ ID NO. 7 according to the base sequence of the gene. The AGS2 gene is 7629bp in full length, and is subjected to online BLAST alignment on NCBI (http:// BLAST. NCBI. nlm. nih. gov/BLAST. cgi), contains 5 segments of introns, and encodes 2389 amino acids. The deduced amino acid sequence alignment result of the AGS2 enzyme is alpha-glucan synthetase, which has the highest similarity with the alpha-glucan synthetase of the A.melanogenin CBS110374 strain, and the similarity is 88%. Promoter prediction of AGS2 gene upstream sequence (240bp) is carried out on website http:// www.fruitfly.org/cgi-bin/seq _ tools/promoter. pl, and the result shows that a 50bp promoter exists between-115 bp and-164 bp and a transcription initiation site C exists at-124 bp. No CAAT box and TATA box were found in the regulatory region upstream of the ORF box. The 5 '-HGATAR-3' sequence is a GATA type transcription repressing factor binding site, 1 segment of the 5 '-HGATAR-3' sequence exists at the upstream-203 bp of the AGS2 gene, which indicates that the transcription of the gene can be repressed by a nitrogen source, and a great deal of evidence indicates that the synthesis of the pullulan can be repressed by nitrogen. No 5 '-SYGGRG-3' sequence exists in the upstream sequence of the ORF frame of the AGS2 gene, and the sequence is Mig1 or CreA repressor protein binding site, which indicates that the transcription of the AGS2 gene is not repressed by glucose, and the result is consistent with the research result that the P16 strain can synthesize a large amount of pullulan in a culture medium with high carbon-nitrogen ratio.

The amino acid sequence of the protein encoded by the AGS2 gene was subjected to conserved domain prediction on the https:// www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb. cgi website, and the prediction results are shown in FIG. 2 above. From the results in fig. 2, it can be seen that the AGS2 protein contains 4 key domains:

1. a domain of a bacterial immunoglobulin, the amino acid sequence characteristic of the domain being Leu-Gln-Ser; the structural domain is called Big-5 for short, and the structural domain is responsible for attaching, combining and positioning AGS2 on a molecular chain of a pullulan precursor (alpha-1, 4-glucan) (the amino acid sequence is shown as SEQ ID NO: 2);

2. the conserved alpha-amylase catalytic domain (shown in SEQ ID NO:1, containing Asp-X-Glu-Asp catalytic amino acids, which is a specific amino acid for hydrolyzing alpha-1, 4-glycosidic bond) is responsible for the hydrolysis of alpha-1, 4-glycosidic bond in the pullulan precursor (alpha-1, 4-glucan) molecule to release maltotriose subunit. The alpha-amylase family is the largest family of Glycoside Hydrolases (GH), most enzymes act on starch, glycogen and related oligosaccharides and polysaccharides. These enzymes catalyze the hydrolysis of α -1,4 and α -1, 6-glucosidic bonds, and members of this family are quite broad, including: alpha-amylase, maltosyltransferase, cyclodextrin glycosyltransferase, maltogenic amylase, neopullulanase, isoamylase, 1, 4-alpha-D-glucan maltotetrazyme, 4-alpha-glucosyltransferase, oligosaccharide-1, 6-glucosidase, amylosucrase, sucrose phosphorylase, maltosyltransferase, and the like. This family of enzymes can hydrolyze alpha-1, 4 or alpha-1, 6 glycosidic linkages and form alpha-1, 4 or alpha-1, 6 glycosidic linkages by transglycosylation (Hochstenbachet, 1998);

3. conserved GT 1-glycogen synthase domain (shown in SEQ ID NO:3, containing Lys-Ile-Gly-Gly catalytic amino acid, which is a catalytic site specific amino acid of plant and algae starch synthase and glycogen synthase) catalyzes and releases maltotriose to be connected into a pullulan macromolecule through alpha-1, 6-glycosidic bond. This family includes starch synthases from plants and glycogen synthases from various organisms.

4. The conserved exopolysaccharide-transglycosylation domain (SEQ ID NO: 4) is responsible for linking the synthetic pullulan macromolecule to the lipid carrier molecule of the cell membrane. Such proteins consist of two fusion domains, an N-terminal hydrophobic domain, which is generally low conserved, and a C-terminal glycosyltransferase domain, which is highly conserved.

The AGS2 protein sequence was predicted using the http:// genome. cbs.dtu.dk/sevices/TMHMM-2.0 website and it was found that AGS2 also contains two transmembrane structures, one of which is transmembrane 1 time (transmembrane domain sequence shown in SEQ ID NO: 5) and the other is transmembrane 11 times at the position including the amino acid sequence shown in SEQ ID NO:6 (FIG. 3).

In the structure of 11 times of transmembrane, the sequences of transmembrane regions are respectively as follows:

1：TrpProLeuTyrAlaTyrLeuLeuAlaPheGlyGlnIleIleAlaValAsnSerHisGlnIle ThrIle；

2：LeuTyrValValAlaSerIleTyrLeuAlaGlySerLeuPheTrpTrpPheMetVal；

3:SerLeuProPheMetPheTyrGlyLeuSerPhePhePheValGlyLeuAlaProTyrGlyMetThrIle；

4:PheTyrAlaPheAlaSerSerSerGlySerLeuTyrPheAlaLeuAsnPheAla；

5:MetIleTyrArgAlaThrValValGlnGlyIleGlnGlnLeuTrpValAlaAlaLeuTrpAlaTrpGly；

6:ValIleLeuAlaIleMetAlaProIleAlaValLeuPheValIleValGlyLeuLeuLeuLeuPheGly；

7:LeuValIleTrpPhePheIleAlaValIleValGlnAsnTyrTrpLeuSerSerLeuValGlyArgAsn；

8:TrpAlaIleValLeuLeuLeuLeuPhePhePheIleValValTrpCysThrAlaLeuTyrIleLeuAla；

9:LeuProTrpGlySerValValGlyGlyAlaIleAlaGlyArgCysLeuTrpLeuTrpLeuGlyValLeu；

10:ValAlaValThrLeuThrAlaAlaGlnValIleGlySerValAlaThrIleAlaAlaArgAlaSerAla；

11:LeuGlyAlaTrpGluPheTrpValAlaLeuLeuPheGlnMetValLeuProCysGlyPheLeuMetPhe。

meanwhile, from the results of FIG. 3, it can be seen that the Big-5 domain, the conserved alpha-amylase catalytic domain, the conserved GT 1-glycogen synthase domain and the conserved exopolysaccharide-transglycosylation domain are all oriented towards the outside of the cell. The 11-time transmembrane structure is responsible for transporting the intracellular pullulan precursor (α -1, 4-glucan) to the outer surface of the cell membrane, so that the extracellular catalytic domains described above catalyze the synthesis of pullulan molecules. Thus, AGS2 can perform all functions of transporting pullulan precursors from inside to outside, capturing pullulan precursors (α -1, 4-glucan), cleaving maltotriose, linking maltotriose into pullulan, and linking synthetic pullulan to a membrane lipid carrier.

The amino acid sequence encoded by the AGS2 gene is analyzed by using an http:// www.cbs.dtu.dk/services/SignalP/signal peptide analysis website, and the result shows that the protein encoded by the gene contains a section of signal peptide with 16 amino acids, which indicates that the AGS2 protein is a secretory protein and needs to pass through a transmembrane transport or a transport process of a secretory pathway. In addition, the AGS2 protein sequence does not contain the endoplasmic reticulum retention signal peptide KDEL, and it is presumed that the AGS2 protein is transported from the endoplasmic reticulum to the cytoplasmic membrane via the secretory pathway. The physical and chemical properties of the protein coded by the AGS2 gene are predicted by using an http:// web. expasy. org/protparam/website, the isoelectric point of the AGS2 protein is 6.01, the molecular weight is 266.47968kDa, the AGS2 protein has 225 negative charges and 196 positive charges (the whole is negatively charged), the N-terminal is Met, the half-life period in yeast is more than 20h, the instability coefficient is 38.17, the protein is stable, the fat coefficient is 83.28, the total average hydrophilicity is-0.152, and the protein is hydrophilic protein. Cell localization analysis of the AGS2 protein showed that the protein was 78.3% likely located on the cytoplasmic membrane and 21.7% likely located on the endoplasmic reticulum.

2. Construction of AGS2 Gene knockout vector

In order to verify the function of the AGS2 gene in the pullulan synthesis process, the AGS2 gene in the P16 strain is knocked out by a homologous recombination method, and the specific process of knocking out a vector is shown in figure 4. Using the sequence of AGS2 gene (SEQ ID NO:8) as a template, primers were designed to amplify the homologous arms of the gene, i.e., 5 '-arm and 3' -arm (Table 1). When designing the primer, selecting a proper enzyme cutting site to add to the 5' -end of the primer for subsequent enzyme cutting connection. SphI and SalI cleavage sites were added to the 5 '-arm upstream and downstream primers, and BamHI and EcoRI cleavage sites were added to the 3' -arm upstream and downstream primers (Table 1).

TABLE 1 primers for amplification of knock-out AGS2 genes 5 '-arm and 3' -arm

Primers	Sequences(5′-3′)
		AGS2-5F	GCATGCGAGGGTGATGAATCCAGG(Sph I)
AGS2-5R	GTCGACTCACCCTCGGAGTTCTTC(Sal I)
		AGS2-3F	GGATCCAAGAACTCCGAGGGTGAC(BamH I)
AGS2-3R	GAATTCGCCAAGTAGATCGATGCC(EcoRI)

Note: underlined in the table are restriction sites

The genomic DNA of the P16 strain was used as a template, AGS2-5F, AGS2-5R and AGS2-3F, AGS2-3R of Table 1 were used as primers to amplify to obtain 5 '-arm and 3' -arm of AGS2 gene, the fragment sizes were 347bp and 456bp, respectively, and the results of agarose gel electrophoresis are shown in FIG. 5. The amplified 5 '-arm and 3' -arm were ligated to pFL4A-NAT-LOXP plasmid, respectively, to form pFL4A-NAT-LOXP- Δ AGS2 (FIG. 4).

The constructed vector pFL 4A-NAT-LOXP-delta AGS2 (figure 4) is used as a template, AGS2-5F and AGS2-3R are used as primers, and polymerase chain reaction (OneTaq) DNA polymerase is used for PCR amplification to obtain a fragment 5 '-arm-Loxp-polyA-HPT-TEF-Loxp-3' -arm with the size of 2160bp (figure 5).

3. Results of Yeast transformation

Competent cells of P16 strain were transformed using the fragment 5 '-arm-Loxp-polyA-HPT-TEF-Loxp-3' -arm obtained as described above and protoplast transformation method, and after culturing for 48 hours, a knockout strain was grown on a bilayer HCS plate containing 50. mu.g/mL of nourseothricin resistance, whereas the original P16 strain could not grow on the bilayer HCS plate because it did not have the nourseothricin resistance gene, as shown in FIG. 6.

The positive recombinant strain obtained in FIG. 6 was rescreened by inoculating it on YPD plates containing resistance to nourseothricin at 50. mu.g/mL on double HCS plates containing resistance to nourseothricin at 100. mu.g/mL, and the false positive strain could not grow, while the true transformed strain could grow.

4. Screening of low-yield extracellular polysaccharide recombinant strain and determination of dry weight of strain

True transformants, i.e., the strains Δ AGS2-1, Δ AGS2-3, Δ AGS2-7, Δ AGS2-13 and the wild strain P16 were grown on a medium for producing pullulan and cultured with shaking at constant temperature for 5 days. Heating at 100 deg.C to kill cells and various proteins, centrifuging the culture solution to precipitate yeast cells, precipitating extracellular polysaccharide in the supernatant with cold ethanol, washing the precipitated extracellular polysaccharide with ethanol for multiple times, and oven drying at 80 deg.C to constant weight. The precipitated cells were washed by centrifugation and dried at 80 ℃ to constant weight. The amount of exopolysaccharide per liter of fermentation broth, the dry weight of the cells and the amount of exopolysaccharide produced per gram of cells were then calculated and the results are shown in figure 7. The results in FIG. 7 show that the knockout strain, Δ AGS2-13, produces minimal exopolysaccharide. The concentration of the bacterial strain is reduced from 56.17g/L +/-1.55 g/L (original strain P16) to 1.70g/L +/-0.22 g/L, and the reduction is 96.97%. The mass of the knockout strain delta AGS2-13 for producing the exopolysaccharide per unit dry cell weight also reaches 0.07g/g, and is reduced by 97.11 percent relative to 2.42g/g of the original strain P16.

5. PCR validation of AGS2 Gene knockout

After genome extraction of P16 strain and Δ AGS2-13 strain, PCR verification was performed using primers AGS2-5F and AGS2-3R (Table 1), as shown in FIG. 8. The 1347bp fragment is obtained by amplification with the P16 strain genome DNA as a template, and the knockout fragment 2160bp is obtained by amplification with the delta AGS2-13 strain genome DNA as a template. This result indicates that the AGS2 gene in the genomic DNA of the Δ AGS2-13 strain has been completely knocked out.

6. Colony and cell morphology of wild-type P16 strain and AGS2 knock-out strain

Respectively scribing the P16 strain and the delta AGS2-13 strain on a YPD plate, and observing the colony morphology of the P16 strain after culturing for 3 days, wherein the colony on the YPD plate is light pink, the edge is radial, and the colony is convex, because the surface of the high-yield exopolysaccharide is sticky, smooth, glossy and opaque (figure 9); the colony of the strain delta AGS2-13 is also light pink and radial in edge, but the colony is obviously smaller than the original strain, because the low-yield exopolysaccharide has no obvious stick-slip glossy morphological characteristics, and the colony picked by a bamboo stick has no stringiness phenomenon, and the change is related to the obvious reduction of the exopolysaccharide yield (figure 9).

The P16 strain and the Δ AGS2-13 strain were streaked on YPD plates, and after culturing for 3 days, the cell morphology was observed under a microscope (FIG. 10), and the cells of the P16 strain and the Δ AGS2-13 strain were mainly in the form of 2 types of yeast cells and budding cells, which are typical of those of Saccharomyces brevibacterium (A in FIG. 10). The cell morphology observed after 18h of shaking culture at 180rpm at 28 ℃ in tubes containing YPD liquid, after inoculating the activated strain on YPD plates, the cells of the original strains P16 and Δ AGS2-13 all had 3 forms of yeast-like cells, budding cells and filamentous cells (B in FIG. 10). After the culture of the culture medium for producing pullulan in a shake flask for 5 days, the cell morphology is observed under a microscope, and compared with the original strain P16, the cells of the AGS2 knockout strain delta AGS2-13 are expanded to a certain extent and contain more cells (C in figure 10).

7. Intracellular trehalose, glycogen, intracellular polysaccharide and total sugar contents of original strain P16 and delta AGS2-13 strain

To understand why cells of AGS2 knock-out strain Δ AGS2-13 were enlarged (FIG. 10), the content of trehalose, glycogen, intracellular polysaccharides and total sugars in the cells was determined. Cells of the Δ AGS2-13 strain and P16 strain washed by centrifugation were separately incubated with 0.25M Na₂CO₃The solutions were mixed, the mixture was treated in a water bath at 90-95 ℃ for 30 minutes, and then a commercial amyloglucosidase (1.2U/mL) (Cas: A7420 MSDS, Sigma, USA) was added to carry out enzymolysis on the cell suspension at 57 ℃ for 10 hours, during which time the mixture was mixed uniformly. The amount of glucose released by the enzymatic hydrolysis was quantitatively determined by glycogen using a glucose quantification kit (Nanjing Jiancheng Bioeng Institute, Nanjing, China). And (3) drying the centrifugally washed cells of the P16 strain and the delta AGS2-13 strain at 80 ℃ to constant weight, accurately weighing, and calculating the dry weight of the thalli in each milliliter of bacterial suspension. The amount of glycogen per g of dry cell weight was calculated from the dry cell weight. Simultaneously, the washed cells were mixed with 4.0ml of pre-cooled 0.5M trichloroacetic acid (TCA), and the mixture was treated at 0 ℃ for 20 minutes with shaking and mixing at any time. The treated mixture was centrifuged at 4000g for 5 minutes and the supernatant (containing trehalose) was collected and left to use. Extracting trehalose twice with the same method for the precipitated cells, mixing the three extracted supernatants containing trehalose to obtain 12ml extractAnd (6) taking liquid. Diluting the extractive solution, and measuring OD of the diluted solution by anthrone sulfate method_510nmThe value is obtained. Preparing standard trehalose solutions with different concentrations at the same time, and measuring OD of the trehalose solution by the anthrone sulfate method_510nmValues, a standard trehalose curve is plotted from which the trehalose content per gram of dry weight cells is calculated. Firstly, the yeast cells washed by centrifugation are crushed by a high pressure cell crusher (ConstantSystem ltd., uk), the crushed liquid is centrifuged for 20 minutes at 12,000g, 5ml of supernatant (cell-free extract) is taken and added into the cold ethanol for mixing, the mixture is stored overnight at 4 ℃, precipitated polysaccharide is obtained by centrifugation, the polysaccharide is washed by the cold ethanol and dried to constant weight. And (3) centrifugally washing the cells precipitated in the culture solution, drying the cells to constant weight at 80 ℃, and calculating the polysaccharide amount in each gram of dry cell weight. The total sugar in the supernatant (cell-free extract) was also determined by the anthrone sulfate method. As shown in Table 2, the trehalose, glycogen, intracellular polysaccharide and total sugar contents in cells of the original strain P16 were significantly lower than those of the AGS2-13 strain, indicating that the decrease in extracellular polysaccharide synthesis of the AGS2-13 strain significantly increased its cell volume.

TABLE 2 determination of intracellular trehalose, glycogen, intracellular polysaccharides and Total sugars for the wild type strain P16 and the Δ AGS2-13 strains

8. Purification and purification of exopolysaccharides produced by wild type strain P16 and delta AGS2-13, thin layer chromatography and nuclear magnetic resonance analysis

Washing the precipitated extracellular polysaccharide with ethanol for multiple times, and drying at 80 ℃ to constant weight. The dried exopolysaccharide is dissolved in deionized water. After the pretreatment, the neutral macroporous adsorption resin D101 is filled into a column and then the polysaccharide is purified through the adsorption and desorption processes. The eluent is ultrapure water, the sample injection flow rate is 0.5mL/min, the elution flow rate is 0.5mL/min, and the elution volume is 3 times of the sample injection volume. The polysaccharide content in the eluent is measured in the elution process, and the result is shown in figure 11, the extracellular polysaccharide content in the eluent from 2 pipes to 16 pipes is a single peak, which indicates that the extracellular polysaccharide is purified.

The purified exopolysaccharide is hydrolyzed by pullulanase (a-1, 6 glycosidic bond of the pullulan is specifically hydrolyzed), and the hydrolysate is analyzed by Thin Layer Chromatography (TLC), so that only the exopolysaccharide hydrolysate produced by the P16 strain contains maltotriose, and the exopolysaccharide hydrolysate produced by all AGS2 gene knockout delta AGS2-13 does not contain maltotriose (FIG. 12). According to TLC result analysis, extracellular polysaccharide produced by the knockout strain is not subjected to enzymolysis by pullulanase, and a hydrolysate has no maltotriose, so that extracellular polysaccharide produced by an AGS2 gene knockout transformant delta AGS2-13 is presumed not to be pullulan.

After overnight dialysis, the polysaccharide purified by macroporous adsorbent resin was freeze-dried, dissolved in heavy water, and subjected to chemical shift correction with DSS as an internal standard, followed by nuclear magnetic resonance DEPTQ-C spectroscopy, and the results are shown in fig. 13.

Standard pullulan anomeric carbons generally have 3 chemical shift values in the carbon spectrum, α - (1 → 6) (-99 ppm) and α - (1 → 4) (-100.8,101.3 ppm), respectively, and standard pullulan molecules have 2 signals at C-6 chemical shift values (61.8 and 62.1ppm) due to the 2 α -1,4 linked D-glucose species, and 68.0ppm of α -1, 6-linked α -D-glucose species in C-6 (Lazaridou et al, 2002). However, the trace extracellular polysaccharide C spectrum produced by the strain delta AGS2-13 does not have the chemical shift value (figure 13-A), the H spectrum of figure 13-B is not the H spectrogram of the standard pullulan, which indicates that the trace extracellular polysaccharide produced by the strain delta AGS2-13 is not the pullulan, and that the knockout of AGS2 gene leads the knockout strain to lose a large amount of pullulan, and the synthesized small amount of extracellular polysaccharide does not contain the specific alpha-1, 6-glycosidic bond of the pullulan. Thus, AGS2 is proved to catalyze the formation of alpha-1, 6-glycosidic bond in pullulan molecules.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Sequence listing

<110> China oceanic university

<120> enzyme and application thereof in synthesis of pullulan

<130>MP1827173

<160>14

<170>SIPOSequenceListing 1.0

<210>1

<211>563

<212>PRT

<213> Aureobasidium pullulans produces a melanin variant P16(Aureobasidium pullulans var. melanogenumP16)

<400>1

Ile Leu His Pro Ser Pro Thr Gln Ala Leu Ser Trp Ser Ala Asp Tyr

1 5 10 15

Val Asp Trp Asn Leu Asn Gln Asn Glu Thr Ala Asp Ser Pro Leu Gln

20 25 30

Tyr Trp Gly Glu Trp Thr Glu His Pro Lys Thr Pro Ser Pro Ser Asn

35 40 45

Trp Arg Met Pro Phe Tyr Met Leu Thr Leu Asp Arg Phe Val Asp Gly

50 55 60

Gln Pro Ala Asn Asn Asp Ala Asn Lys Thr Val Phe Glu Asn Asp Trp

65 70 75 80

Thr Thr Asn Gln Phe Arg Phe Gly Gly Asp Thr Lys Gly Leu Met Glu

85 90 95

Asn Leu Asp Trp Ile Gln Asp Leu Gly Ile Lys Ala Ile Tyr Phe Ser

100 105 110

Gly Ser Pro Phe Ile Asn Gln Pro Trp Ala Ser Asp Gly Phe Gly Pro

115 120 125

Leu Asp Phe Thr Leu Leu Asp Ala His His Gly Thr Ile Thr Glu Trp

130 135 140

Arg Glu Leu Ile Glu Glu Leu His Arg Arg Gly Met Tyr Ala Ile Met

145 150 155 160

Glu Asn Thr Ile Gly Thr Met Gly Asp Leu Leu Ala Phe Glu Gly Trp

165 170 175

Glu Asn Glu Thr Thr Pro Phe Asn Pro Leu Glu Tyr Asp Val Leu Trp

180 185 190

Lys Thr Ser Arg Gln Tyr Leu Asp Phe Glu Val Asp Asn Asp Ile Leu

195 200 205

Glu Asp Cys Ser Tyr Pro Ile Phe Tyr Gly Asp Asp Gly Tyr Pro Val

210 215 220

Asn Gln Ser Ile Met Ala Thr Phe Glu Asn Gln Cys Arg Lys Ser Asp

225 230 235 240

Phe Asp Gln Tyr Gly Asp Met Lys Gly Val Gly Tyr Val Pro Pro Tyr

245 250 255

Gln Ser Gln Leu Ser Lys Phe Ala Ser Val Gln Asp Arg Leu Lys Leu

260 265 270

Trp Lys His Glu Val Leu Glu Lys Val Met His Phe Ser Cys Met Gln

275 280 285

Ile Ala Met Leu Asp Ile Asp Gly Phe Arg Val Asp Lys Ala Leu Gln

290 295 300

Thr Pro Ile Asp Ala Leu Ala Glu Trp Ala Thr Tyr Gln Arg Asn Cys

305 310 315 320

Ala Arg Gln Tyr Gly Lys Glu Asn Phe Leu Ile Thr Gly Glu Val Val

325 330 335

Gly Glu Leu Lys Phe Ser Ser Val Phe Phe Gly Arg Gly Lys Ser Pro

340 345 350

Asp Thr Tyr Phe Glu Asp Gln Leu Asp Gly Gln Asn Ala Thr Gly Lys

355 360 365

Thr Glu Gly Tyr Ile Arg Glu Phe Gly Asn Asn Ala Leu Asp Gly Thr

370 375 380

Asn Phe His Tyr Pro Thr Tyr Gly Ala Leu Thr Arg Phe Leu Gly Leu

385 390 395 400

Asp Gly Ala Ile Gly Phe Glu Gly Val Asp Phe Val Asp His Trp Asn

405 410 415

Ala Tyr Leu Leu Ser Asp Asp Met Val Asn Ala Asn Thr Gly Val Phe

420 425 430

Asp Pro Arg His Met Phe Gly Thr Thr Asn Gln Asp Val Phe Arg Trp

435 440 445

Pro Ser Leu Ile Asp Gly Thr Gln Arg Gln Val Leu Ala Phe Leu Ile

450 455 460

Thr Phe Leu Glu Met Pro Gly Ile Pro Glu Leu Ile Trp Gly Asp Glu

465 470 475 480

Val Glu Tyr Lys Val Leu Glu Asn Leu Ala Ala Asp Tyr Ile Phe Gly

485 490 495

Arg Gln Pro Met Ala Ser Thr Arg Ala Trp Gln Met His Gly Cys Tyr

500 505 510

Lys Val Gly Ala Ala Gly Asn Gly Tyr Phe Asp Met Pro Phe Gly Asp

515 520 525

Ala Leu Thr Ala Cys Glu Asp Asp Thr Val Ser Leu Asp Gln Arg Asn

530 535 540

Ala Ala His Pro Leu Arg Asn Leu Ile Lys Arg Met Phe Glu Leu Arg

545 550 555 560

Thr Val Tyr

<210>2

<211>104

<212>PRT

<400>2

Pro Val Ile Thr Gly Ala Val Pro Arg His Asp Ala Arg Ile Glu Thr

1 5 10 15

Thr Val Asp Leu Asn Glu Thr Val Ser Leu Pro Ile Thr Leu Leu Phe

20 25 30

Ser Arg Glu Met Asn Cys Ser Ser Ile Leu Gln Ser Ile Ser Ile Asn

35 40 45

Ser Thr Thr Gln Thr Gly Val Ile Pro Phe Phe Asp Ala Ser Ser Val

50 55 60

Ser Cys Lys Asn Ile Thr Val Asn Asp Thr Gln Arg Phe Val Gly Glu

65 70 75 80

Thr Leu Ser Thr Phe Ser Trp Ser Ala Asn Leu Val AsnVal Gly His

85 90 95

Gly Val His Thr Tyr Thr Val Val

100

<210>3

<211>456

<212>PRT

<400>3

Pro Ala Gly Ser Ala Gln Arg Gln Val Ala Leu Tyr Ile Leu Leu Ala

1 5 10 15

Leu Leu Pro Val Ile Thr Ala Cys Ala Ala Val Ala Ile Tyr Leu Gly

20 25 30

Ser Phe Tyr Arg Leu Lys Tyr Asn Ala Val Gly Leu Thr Lys Arg Ser

35 40 45

Tyr Pro Phe His Gln Phe Glu Lys Lys Lys Thr Ile Ala Asp Ile Leu

50 55 60

Pro Leu Ser Phe Lys Lys Leu Ser Glu Lys Gln Ser Ser Val Ala Asp

65 70 75 80

Asn Val Glu Ala Ser Gln Gly Ala Met Val Thr Thr Asn Ala Pro Gly

85 90 95

Ala Arg Thr Ile Leu Ile Ala Thr Met Glu Tyr Asn Ile Ser Asp Glu

100 105 110

Trp Asn Ile Ser Ile Lys Ile Gly Gly Leu Gly Val Met Ser Gly Leu

115 120 125

Met Ala Lys His Leu Thr Asn His Asn Leu Ile Trp Val Val Pro Cys

130 135 140

Val Gly Asp Val Val Tyr Pro Ile Asp Lys Val Val Glu Pro Ile Lys

145 150 155 160

Ile Thr Ile Met Gly Lys Gln Tyr Leu Ile Asp Cys Gln Leu His Val

165 170 175

Val Gly Arg Ile Thr Tyr Val Leu Leu Asp Ala Pro Leu Phe Arg Gln

180 185 190

Gln Thr Lys Lys Asp Pro Tyr Pro Ala Arg Met Asp Asp Met Asp Ser

195 200 205

Ala Ile Tyr Tyr Ser Ala Trp Asn Ser Cys Ile Ala Glu Val Met Arg

210 215 220

Arg Asn Pro Gln Ile Asp Ile Tyr His Ile Asn Asp Tyr His Gly Ala

225 230 235 240

Val Ala Pro Leu His Leu Leu Pro Arg Val Ile Pro Val Cys Leu Ser

245 250 255

Leu His Asn Ala Glu Phe Gln Gly Leu Trp Ser Ile Ser Thr Pro Lys

260 265 270

Arg Leu Gln Glu Met Ser Asp Val Phe Asn Leu Asp Lys Asp Leu Ile

275 280 285

Arg Lys Tyr Val Gln Trp Gly Asp Ser Phe Asn Leu Leu His Ala Gly

290 295 300

Ala Ser Tyr Leu Arg Val His Gln Lys Gly Phe Gly Ala Val Gly Val

305 310 315 320

Ser Lys Lys Tyr Gly Ser Arg Ser Phe Ser Arg Tyr Pro Ile Phe Trp

325 330 335

Gly Leu Pro Lys Val Gly Met Leu Pro Asn Pro Asp Pro Ala Asp Val

340 345 350

Glu His Phe Asp Lys Cys Leu Pro Asn Pro Asp Val Thr Ile Asp Gln

355 360 365

Glu Tyr Glu Ala Ser Arg Gly Pro Thr Arg Val Glu Ala Gln Lys Trp

370 375 380

Ala Asn Leu Asp Ile Asp Pro Thr Ala Glu Leu Phe Val Phe Val Gly

385 390 395 400

Arg Trp Ser Met Gln Lys Gly Ile Asp Leu Ile Ala Asp Val Phe Pro

405 410 415

Lys Val Leu Glu Glu Asn Pro Lys Ala Gln Leu Ile Cys Val Gly Pro

420 425 430

Val Ile Asp Leu Tyr Gly Lys Phe Ala Ala Leu Lys Leu Asp His Leu

435 440 445

Met Lys Lys Tyr Pro Gly Arg Val

450 455

<210>4

<211>386

<212>PRT

<400>4

Asn Ser Glu Gly Asp Leu Cys Ile Glu Asn Phe Leu Ala Leu Ala Glu

1 5 10 15

Lys Asn Trp Tyr Arg Arg Phe Asn Glu Ala Lys Leu Gly Arg Ala Val

20 25 30

Ile Ser Ala Pro Ser Val Ser Gly Lys Lys Gly Ala Asn Ser Leu Leu

35 40 45

Val Thr Val Arg Glu Gly Ser Ser Ser Glu Ser Asp Arg Ala Gly Ser

50 55 60

Val Gly Gly Thr Ser Gln Asn Ser Ala Glu Gln Phe Phe Thr Asn Ala

65 70 75 80

Asn Tyr Lys Pro Pro Thr Gly Ile Ser Lys Phe Leu Ile Ser Lys Leu

85 90 95

Pro Tyr Ile Ala Pro Asp Trp Pro Leu Tyr Ala Tyr Leu Leu Ala Phe

100 105 110

Gly Gln Ile Ile Ala Val Asn Ser His Gln Ile Thr Ile Ile Thr Gly

115 120 125

Ala Gln Gly Glu Asn Ala Asn Lys Leu Tyr Val Val Ala Ser Ile Tyr

130 135 140

Leu Ala Gly Ser Leu Phe Trp Trp Phe Met Val Arg His Phe Ala Ser

145 150 155 160

Lys Tyr Ala Leu Ser Leu Pro Phe Met Phe Tyr Gly Leu Ser Phe Phe

165 170 175

Phe Val Gly Leu Ala Pro Tyr Gly Met Thr Ile Asp Ser Arg Gly Trp

180 185 190

Ile Gln Asn Val Ala Ser Gly Phe Tyr Ala Phe Ala Ser Ser Ser Gly

195 200 205

Ser Leu Tyr Phe Ala Leu Asn Phe Ala Ser Glu Gly Gly Val Pro Ile

210 215 220

Gly Thr Met Ile Tyr Arg Ala Thr Val Val Gln Gly Ile Gln Gln Leu

225 230 235 240

Trp Val Ala Ala Leu Trp Ala Trp Gly Thr Thr Met Ser Ala His His

245 250 255

Thr Ala Lys Tyr Thr Asn Thr Ile Met Asn Ser Lys Val Ile Leu Ala

260 265 270

Ile Met Ala Pro Ile Ala Val Leu Phe Val Ile Val Gly Leu Leu Leu

275 280 285

Leu Phe Gly Leu Pro Asp Tyr Tyr His Asn Ser Pro Gly Lys Ala Pro

290 295 300

Ser Phe Tyr Thr Ser Leu Leu Lys Arg Lys Leu Val Ile Trp Phe Phe

305 310 315 320

Ile Ala Val Ile Val Gln Asn Tyr Trp Leu Ser Ser Leu Val Gly Arg

325 330 335

Asn Trp Gln Tyr Leu Phe Asn Ser Thr Gln Ala Pro Ile Trp Ala Ile

340 345 350

Val Leu Leu Leu Leu Phe Phe Phe Ile Val Val Trp Cys Thr Ala Leu

355 360 365

Tyr Ile Leu Ala Arg Tyr Ser Glu His His Ser Trp Phe Leu Pro Ile

370 375 380

Phe Gly

385

<210>5

<211>23

<212>PRT

<400>5

Val Ala Leu Tyr Ile Leu Leu Ala Leu Leu Pro Val IleThr Ala Cys

1 5 10 15

Ala Ala Val Ala Ile Tyr Leu

20

<210>6

<211>413

<212>PRT

<400>6

Trp Pro Leu Tyr Ala Tyr Leu Leu Ala Phe Gly Gln Ile Ile Ala Val

1 5 10 15

Asn Ser His Gln Ile Thr Ile Ile Thr Gly Ala Gln Gly Glu Asn Ala

20 25 30

Asn Lys Leu Tyr Val Val Ala Ser Ile Tyr Leu Ala Gly Ser Leu Phe

35 40 45

Trp Trp Phe Met Val Arg His Phe Ala Ser Lys Tyr Ala Leu Ser Leu

50 55 60

Pro Phe Met Phe Tyr Gly Leu Ser Phe Phe Phe Val Gly Leu Ala Pro

65 70 75 80

Tyr Gly Met Thr Ile Asp Ser Arg Gly Trp Ile Gln Asn Val Ala Ser

85 90 95

Gly Phe Tyr Ala Phe Ala Ser Ser Ser Gly Ser Leu Tyr Phe Ala Leu

100 105 110

Asn Phe Ala Ser Glu Gly Gly Val Pro Ile Gly Thr Met Ile Tyr Arg

115 120 125

Ala Thr Val Val Gln Gly Ile Gln Gln Leu Trp Val Ala Ala Leu Trp

130 135 140

Ala Trp Gly Thr Thr Met Ser Ala His His Thr Ala Lys Tyr Thr Asn

145 150 155 160

Thr Ile Met Asn Ser Lys Val Ile Leu Ala Ile Met Ala Pro Ile Ala

165 170 175

Val Leu Phe Val Ile Val Gly Leu Leu Leu Leu Phe Gly Leu Pro Asp

180 185 190

Tyr Tyr His Asn Ser Pro Gly Lys Ala Pro Ser Phe Tyr Thr Ser Leu

195 200 205

Leu Lys Arg Lys Leu Val Ile Trp Phe Phe Ile Ala Val Ile Val Gln

210 215 220

Asn Tyr Trp Leu Ser Ser Leu Val Gly Arg Asn Trp Gln Tyr Leu Phe

225 230 235 240

Asn Ser Thr Gln Ala Pro Ile Trp Ala Ile Val Leu Leu Leu Leu Phe

245 250 255

Phe Phe Ile Val Val Trp Cys Thr Ala Leu Tyr Ile Leu Ala Arg Tyr

260 265 270

Ser Glu His His Ser Trp Phe Leu Pro Ile Phe Gly Ala Gly Leu Gly

275 280 285

Ala Pro Arg Trp Cys Gln Met Leu Trp Ser Thr Ser Gly Met Gly Ser

290 295 300

His Leu Pro Trp Gly Ser Val Val Gly Gly Ala Ile Ala Gly Arg Cys

305 310 315 320

Leu Trp Leu Trp Leu Gly Val Leu Asp Ala Leu Asn Gly Val Gly Ile

325 330 335

Gly Thr Met Leu Leu Gln Thr Leu Thr Arg His His Val Ala Val Thr

340 345 350

Leu Thr Ala Ala Gln Val Ile Gly Ser Val Ala Thr Ile Ala Ala Arg

355 360 365

Ala Ser Ala Pro Asp Ala Thr Gly Pro Ala Ser Val Phe Pro Asn Leu

370 375 380

Val Leu Asn Leu Ser Gly Leu Gly Ala Trp Glu Phe Trp Val Ala Leu

385 390 395 400

Leu Phe Gln Met Val Leu Pro Cys Gly Phe Leu Met Phe

405 410

<210>7

<211>2389

<212>PRT

<400>7

Met Ala Cys Lys Met Ile Lys Leu Ala Ala Ile Leu Cys Ser Ser Leu

1 5 10 15

Ile Leu His Pro Ser Pro Thr Gln Ala Leu Ser Trp Ser Ala Asp Tyr

20 25 30

Val Asp Trp Asn Leu Asn Gln Asn Glu Thr Ala Asp Ser Pro Leu Gln

35 40 45

Tyr Trp Gly Glu Trp Thr Glu His Pro Lys Thr Pro Ser Pro Ser Asn

50 55 60

Trp Arg Met Pro Phe Tyr Met Leu Thr Leu Asp Arg Phe Val Asp Gly

65 70 75 80

Gln Pro Ala Asn Asn Asp Ala Asn Lys Thr Val Phe Glu Asn Asp Trp

85 90 95

Thr Thr Asn Gln Phe Arg Phe Gly Gly Asp Thr Lys Gly Leu Met Glu

100 105 110

Asn Leu Asp Trp Ile Gln Asp Leu Gly Ile Lys Ala Ile Tyr Phe Ser

115 120 125

Gly Ser Pro Phe Ile Asn Gln Pro Trp Ala Ser Asp Gly Phe Gly Pro

130 135 140

Leu Asp Phe Thr Leu Leu Asp Ala His His Gly Thr Ile Thr Glu Trp

145 150 155 160

Arg Glu Leu Ile Glu Glu Leu His Arg Arg Gly Met Tyr Ala Ile Met

165 170 175

Glu Asn Thr Ile Gly Thr Met Gly Asp Leu Leu Ala Phe Glu Gly Trp

180 185 190

Glu Asn Glu Thr Thr Pro Phe Asn Pro Leu Glu Tyr Asp Val Leu Trp

195 200 205

Lys Thr Ser Arg Gln Tyr Leu Asp Phe Glu Val Asp Asn Asp Ile Leu

210 215 220

Glu Asp Cys Ser Tyr Pro Ile Phe Tyr Gly Asp Asp Gly Tyr Pro Val

225 230 235 240

Asn Gln Ser Ile Met Ala Thr Phe Glu Asn Gln Cys Arg Lys Ser Asp

245 250 255

Phe Asp Gln Tyr Gly Asp Met Lys Gly Val Gly Tyr Val Pro Pro Tyr

260 265 270

Gln Ser Gln Leu Ser Lys Phe Ala Ser Val Gln Asp Arg Leu Lys Leu

275 280 285

Trp Lys His Glu Val Leu Glu Lys Val Met His Phe Ser Cys Met Gln

290 295 300

Ile Ala Met Leu Asp Ile Asp Gly Phe Arg Val Asp Lys Ala Leu Gln

305 310 315 320

Thr Pro Ile Asp Ala Leu Ala Glu Trp Ala Thr Tyr Gln Arg Asn Cys

325 330 335

Ala Arg Gln Tyr Gly Lys Glu Asn Phe Leu Ile Thr Gly Glu Val Val

340 345 350

Gly Glu Leu Lys Phe Ser Ser Val Phe Phe Gly Arg Gly Lys Ser Pro

355 360 365

Asp Thr Tyr Phe Glu Asp Gln Leu Asp Gly Gln Asn Ala Thr Gly Lys

370 375 380

Thr Glu Gly Tyr Ile Arg Glu Phe Gly Asn Asn Ala Leu Asp Gly Thr

385 390 395 400

Asn Phe His Tyr Pro Thr Tyr Gly Ala Leu Thr Arg Phe Leu Gly Leu

405 410 415

Asp Gly Ala Ile Gly Phe Glu Gly Val Asp Phe Val Asp His Trp Asn

420 425 430

Ala Tyr Leu Leu Ser Asp Asp Met Val Asn Ala Asn Thr Gly Val Phe

435 440 445

Asp Pro Arg His Met Phe Gly Thr Thr Asn Gln Asp Val Phe Arg Trp

450 455 460

Pro Ser Leu Ile Asp Gly Thr Gln Arg Gln Val Leu Ala Phe Leu Ile

465 470 475 480

Thr Phe Leu Glu Met Pro Gly Ile Pro Glu Leu Ile Trp Gly Asp Glu

485 490 495

Val Glu Tyr Lys Val Leu Glu Asn Leu Ala Ala Asp Tyr Ile Phe Gly

500 505 510

Arg Gln Pro Met Ala Ser Thr Arg Ala Trp Gln Met His Gly Cys Tyr

515 520 525

Lys Val Gly Ala Ala Gly Asn Gly Tyr Phe Asp Met Pro Phe Gly Asp

530 535 540

Ala Leu Thr Ala Cys Glu Asp Asp Thr Val Ser Leu Asp Gln Arg Asn

545 550 555 560

Ala Ala His Pro Leu Arg Asn Leu Ile Lys Arg Met Phe Glu Leu Arg

565 570 575

Thr Val Tyr Pro Val Leu Asn Asp Gly Phe Ser Leu Gln Thr Leu Phe

580 585 590

Phe Asp Thr Tyr Asp Ile Phe Leu Pro Tyr Ser Gly Gln Leu Pro Thr

595 600 605

Pro Leu Gly Ile Trp Ser Val Tyr Arg Gly Arg Thr Pro Glu Val Gln

610 615 620

Asp Leu Ser Gly Glu Gly Met Gly Asn Gln Gly Val Trp Ile Ile Tyr

625 630 635 640

Ser Asn Gln Asn Lys Ser Val Glu Tyr Ser Tyr Asp Cys Ser Asn Ser

645 650 655

Ser His Ser Leu Val Ala Pro Phe Pro Glu Gly Thr Thr Val Lys Asn

660 665 670

Leu Phe Tyr Pro Tyr Gln Glu Tyr Thr Leu Asn Ser Ser Thr Ala Lys

675 680 685

Leu Gly Ile Glu Gly Ser Glu Glu Asn Asn Gly Cys Leu Pro Ser Ile

690 695 700

Glu Leu Glu Ala Trp Gly Trp Arg Ala Phe Val Pro Ile Asp Lys Phe

705 710 715 720

Val Ala Pro Ala Pro Val Ile Thr Gly Ala Val Pro Arg His Asp Ala

725 730 735

Arg Ile Glu Thr Thr Val Asp Leu Asn Glu Thr Val Ser Leu Pro Ile

740 745 750

Thr Leu Leu Phe Ser Arg Glu Met Asn Cys Ser Ser Ile Leu Gln Ser

755 760 765

Ile Ser Ile Asn Ser Thr Thr Gln Thr Gly Val Ile Pro Phe Phe Asp

770 775 780

Ala Ser Ser Val Ser Cys Lys Asn Ile Thr Val Asn Asp Thr Gln Arg

785 790 795 800

Phe Val Gly Glu Thr Leu Ser Thr Phe Ser Trp Ser Ala Asn Leu Val

805 810 815

Asn Val Gly His Gly Val His Thr Tyr Thr Val Val Asn Ala Thr Ser

820 825 830

Val Asp Gly Thr Ala Phe Thr Asn Thr Lys Ala Arg Phe Met Leu Arg

835 840 845

Val Gly Arg Asn Asp Asn Pro Val Val Phe Ser Ser Ala Asn Tyr Thr

850 855 860

Thr Gly Leu Ile Ser Arg Asp Ser Thr Thr Gly Gln Leu Gln Leu Thr

865 870 875 880

Pro Lys Ala Ala Gly Ala Ser Leu Trp Arg Tyr Ser Thr Asn Tyr Gly

885 890 895

Ser Asn Trp Ser Asn Trp Thr Asp Tyr Ser Tyr Ser Gly Gly Pro Val

900 905 910

Leu Ile Glu Glu Gln Ala Trp Ser Gly Thr Lys Ala Gln Arg Trp Glu

915 920 925

Gly Val His Val Val Thr Gln Tyr Trp Ser Pro Gln Ile Gly Ser Thr

930 935 940

Asp His Ile Gln His Ser Asp Leu Gly Ala Asp Val Pro Arg Arg Trp

945950 955 960

Pro His Val His Val Gln Gly Pro Trp Asn Gln Tyr Gly Tyr Asp Gly

965 970 975

Gly Leu Asp Asp Lys Met His Gln Asp Ser Asn Gly Thr Trp Asn Phe

980 985 990

Asp Leu Tyr Ser Glu Phe Pro Thr Ser Val Leu Val Asn Val Trp Gly

995 1000 1005

Met Asn Glu Asp Gly Arg Pro Asp Lys Ser Ala Ala Tyr Gly Asp Val

1010 1015 1020

Asp Gly Asp Asn Val Leu Asp Trp Val Pro Pro Asp Ser Leu Ser Phe

1025 1030 1035 1040

Asn Gln Ile Asn Ile Thr Ala Pro His Trp Pro His Thr Gly Tyr Arg

1045 1050 1055

Leu Ala Val Asn Asp Gly Ser Leu Arg Tyr Thr Leu Thr Pro Ala Gly

1060 1065 1070

Ser Ala Gln Arg Gln Val Ala Leu Tyr Ile Leu Leu Ala Leu Leu Pro

1075 1080 1085

Val Ile Thr Ala Cys Ala Ala Val Ala Ile Tyr Leu Gly Ser Phe Tyr

1090 1095 1100

Arg Leu Lys Tyr Asn Ala Val Gly Leu Thr Lys Arg Ser Tyr Pro Phe

11051110 1115 1120

His Gln Phe Glu Lys Lys Lys Thr Ile Ala Asp Ile Leu Pro Leu Ser

1125 1130 1135

Phe Lys Lys Leu Ser Glu Lys Gln Ser Ser Val Ala Asp Asn Val Glu

1140 1145 1150

Ala Ser Gln Gly Ala Met Val Thr Thr Asn Ala Pro Gly Ala Arg Thr

1155 1160 1165

Ile Leu Ile Ala Thr Met Glu Tyr Asn Ile Ser Asp Glu Trp Asn Ile

1170 1175 1180

Ser Ile Lys Ile Gly Gly Leu Gly Val Met Ser Gly Leu Met Ala Lys

1185 1190 1195 1200

His Leu Thr Asn His Asn Leu Ile Trp Val Val Pro Cys Val Gly Asp

1205 1210 1215

Val Val Tyr Pro Ile Asp Lys Val Val Glu Pro Ile Lys Ile Thr Ile

1220 1225 1230

Met Gly Lys Gln Tyr Leu Ile Asp Cys Gln Leu His Val Val Gly Arg

1235 1240 1245

Ile Thr Tyr Val Leu Leu Asp Ala Pro Leu Phe Arg Gln Gln Thr Lys

1250 1255 1260

Lys Asp Pro Tyr Pro Ala Arg Met Asp Asp Met Asp Ser Ala Ile Tyr

12651270 1275 1280

Tyr Ser Ala Trp Asn Ser Cys Ile Ala Glu Val Met Arg Arg Asn Pro

1285 1290 1295

Gln Ile Asp Ile Tyr His Ile Asn Asp Tyr His Gly Ala Val Ala Pro

1300 1305 1310

Leu His Leu Leu Pro Arg Val Ile Pro Val Cys Leu Ser Leu His Asn

1315 1320 1325

Ala Glu Phe Gln Gly Leu Trp Ser Ile Ser Thr Pro Lys Arg Leu Gln

1330 1335 1340

Glu Met Ser Asp Val Phe Asn Leu Asp Lys Asp Leu Ile Arg Lys Tyr

1345 1350 1355 1360

Val Gln Trp Gly Asp Ser Phe Asn Leu Leu His Ala Gly Ala Ser Tyr

1365 1370 1375

Leu Arg Val His Gln Lys Gly Phe Gly Ala Val Gly Val Ser Lys Lys

1380 1385 1390

Tyr Gly Ser Arg Ser Phe Ser Arg Tyr Pro Ile Phe Trp Gly Leu Pro

1395 1400 1405

Lys Val Gly Met Leu Pro Asn Pro Asp Pro Ala Asp Val Glu His Phe

1410 1415 1420

Asp Lys Cys Leu Pro Asn Pro Asp Val Thr Ile Asp Gln Glu Tyr Glu

1425 1430 1435 1440

Ala Ser Arg Gly Pro Thr Arg Val Glu Ala Gln Lys Trp Ala Asn Leu

1445 1450 1455

Asp Ile Asp Pro Thr Ala Glu Leu Phe Val Phe Val Gly Arg Trp Ser

1460 1465 1470

Met Gln Lys Gly Ile Asp Leu Ile Ala Asp Val Phe Pro Lys Val Leu

1475 1480 1485

Glu Glu Asn Pro Lys Ala Gln Leu Ile Cys Val Gly Pro Val Ile Asp

1490 1495 1500

Leu Tyr Gly Lys Phe Ala Ala Leu Lys Leu Asp His Leu Met Lys Lys

1505 1510 1515 1520

Tyr Pro Gly Arg Val Tyr Ser Lys Pro Gln Phe Val Tyr Ile Pro Pro

1525 1530 1535

Phe Val His Glu Gly Ala Glu Trp Ala Leu Ile Pro Ser Arg Asp Glu

1540 1545 1550

Pro Phe Gly Leu Val Ser Val Glu Phe Gly Arg Lys Gly Ala Leu Gly

1555 1560 1565

Ile Gly Ala Arg Val Gly Gly Leu Gly Gln Met Pro Gly Trp Trp Phe

1570 1575 1580

Ser Val Glu Ser Ser Thr Thr Lys His Leu Leu Thr Gln Phe Lys Lys

1585 1590 1595 1600

Cys Ile Asn Gly Ala Leu Ala Ser Asp His Gln Thr Arg Ala Leu Leu

1605 1610 1615

Arg Ala Arg Ser Lys Val Gln Arg Phe Pro Val Gln Gln Trp Val Glu

1620 1625 1630

Asp Leu Glu Thr Leu Gln Thr Lys Ala Ile Lys Leu Asn His Lys Val

1635 1640 1645

Gln Asp Gly Ser Thr Ser Ala Leu Asn Ser Pro Ile Asn Ser Leu Pro

1650 1655 1660

Asn Ser Arg Asn Pro Ser Arg Val Thr Ser Pro Ala Val Ser Arg Pro

1665 1670 1675 1680

Ser Ser Pro Ser Arg Ala Ala Ser Arg Pro Ser Ser Pro Thr Pro Ala

1685 1690 1695

Ala Ser Arg Ser Gln Ser Pro Ser Pro Glu Thr Pro Arg Pro Gln Met

1700 1705 1710

Arg Arg Arg Leu Ser Ser Leu Leu Tyr Pro Ala His Pro Ser Leu Glu

1715 1720 1725

Gln Tyr Met Pro Phe Arg Arg Arg Leu Ser Ser Leu Phe Pro Ser Ser

1730 1735 1740

Arg Arg Thr Pro Phe Ala Asp Leu Asn Pro Ser Thr Thr Glu Glu Gly

1745 1750 1755 1760

Asp Glu Ser Arg Asp Ser Leu Gly Glu Leu Gln Pro Ser Pro Pro Lys

1765 1770 1775

Ser Arg Pro Gly Thr Ala Gly Ser Leu Asn Gly Ala Ser Gln Asn Leu

1780 1785 1790

Phe Thr Pro Gly Phe Gly Phe Ser Glu Glu Pro Ala Leu Pro Gly Glu

1795 1800 1805

Val Ala Arg Pro Thr Ile Ala His Tyr Arg Arg Ser Ser Thr Leu Ser

1810 1815 1820

Val Asp Glu Val Val Gly Glu Lys Thr Asp Tyr Asn Leu Gln Lys Val

1825 1830 1835 1840

Asp Gln Ser Phe Thr Asp Ser Lys Leu Asp Tyr Tyr Arg Ile Tyr Glu

1845 1850 1855

Gly Met Leu Gly Ser Leu Thr Ala Lys Asn Ser Glu Gly Asp Leu Cys

1860 1865 1870

Ile Glu Asn Phe Leu Ala Leu Ala Glu Lys Asn Trp Tyr Arg Arg Phe

1875 1880 1885

Asn Glu Ala Lys Leu Gly Arg Ala Val Ile Ser Ala Pro Ser Val Ser

1890 1895 1900

Gly Lys Lys Gly Ala Asn Ser Leu Leu Val Thr Val Arg Glu Gly Ser

1905 1910 1915 1920

Ser Ser Glu Ser Asp Arg Ala Gly Ser Val Gly Gly Thr Ser Gln Asn

1925 1930 1935

Ser Ala Glu Gln Phe Phe Thr Asn Ala Asn Tyr Lys Pro Pro Thr Gly

1940 1945 1950

Ile Ser Lys Phe Leu Ile Ser Lys Leu Pro Tyr Ile Ala Pro Asp Trp

1955 1960 1965

Pro Leu Tyr Ala Tyr Leu Leu Ala Phe Gly Gln Ile Ile Ala Val Asn

1970 1975 1980

Ser His Gln Ile Thr Ile Ile Thr Gly Ala Gln Gly Glu Asn Ala Asn

1985 1990 1995 2000

Lys Leu Tyr Val Val Ala Ser Ile Tyr Leu Ala Gly Ser Leu Phe Trp

2005 2010 2015

Trp Phe Met Val Arg His Phe Ala Ser Lys Tyr Ala Leu Ser Leu Pro

2020 2025 2030

Phe Met Phe Tyr Gly Leu Ser Phe Phe Phe Val Gly Leu Ala Pro Tyr

2035 2040 2045

Gly Met Thr Ile Asp Ser Arg Gly Trp Ile Gln Asn Val Ala Ser Gly

2050 2055 2060

Phe Tyr Ala Phe Ala Ser Ser Ser Gly Ser Leu Tyr Phe Ala Leu Asn

2065 2070 2075 2080

Phe Ala Ser Glu Gly Gly Val Pro Ile Gly Thr Met Ile Tyr Arg Ala

2085 2090 2095

Thr Val Val Gln Gly Ile Gln Gln Leu Trp Val Ala Ala Leu Trp Ala

2100 2105 2110

Trp Gly Thr Thr Met Ser Ala His His Thr Ala Lys Tyr Thr Asn Thr

2115 2120 2125

Ile Met Asn Ser Lys Val Ile Leu Ala Ile Met Ala Pro Ile Ala Val

2130 2135 2140

Leu Phe Val Ile Val Gly Leu Leu Leu Leu Phe Gly Leu Pro Asp Tyr

2145 2150 2155 2160

Tyr His Asn Ser Pro Gly Lys Ala Pro Ser Phe Tyr Thr Ser Leu Leu

2165 2170 2175

Lys Arg Lys Leu Val Ile Trp Phe Phe Ile Ala Val Ile Val Gln Asn

2180 2185 2190

Tyr Trp Leu Ser Ser Leu Val Gly Arg Asn Trp Gln Tyr Leu Phe Asn

2195 2200 2205

Ser Thr Gln Ala Pro Ile Trp Ala Ile Val Leu Leu Leu Leu Phe Phe

2210 2215 2220

Phe Ile Val Val Trp Cys Thr Ala Leu Tyr Ile Leu Ala Arg Tyr Ser

2225 2230 2235 2240

Glu His His Ser Trp Phe Leu Pro Ile Phe Gly Ala Gly Leu Gly Ala

2245 2250 2255

Pro Arg Trp Cys Gln Met Leu Trp Ser Thr Ser Gly Met Gly Ser His

2260 2265 2270

Leu Pro Trp Gly Ser Val Val Gly Gly Ala Ile Ala Gly Arg Cys Leu

2275 2280 2285

Trp Leu Trp Leu Gly Val Leu Asp Ala Leu Asn Gly Val Gly Ile Gly

2290 2295 2300

Thr Met Leu Leu Gln Thr Leu Thr Arg His His Val Ala Val Thr Leu

2305 2310 2315 2320

Thr Ala Ala Gln Val Ile Gly Ser Val Ala Thr Ile Ala Ala Arg Ala

2325 2330 2335

Ser Ala Pro Asp Ala Thr Gly Pro Ala Ser Val Phe Pro Asn Leu Val

2340 2345 2350

Leu Asn Leu Ser Gly Leu Gly Ala Trp Glu Phe Trp Val Ala Leu Leu

2355 2360 2365

Phe Gln Met Val Leu Pro Cys Gly Phe Leu Met Phe Phe Arg Asn Glu

2370 2375 2380

Gln Leu Phe Lys Pro

2385

<210>8

<211>7629

<212>DNA

<400>8

atggcttgca aaatgatcaa actggccgca atcctttgtt cttctctcat actccaccct 60

tccccaacac aagcacttag ctggtctgct gactatgttg attggaacct taaccagaat 120

gagactgcgg acagccctct ccagtactgg ggtgaatgga cagaacatcc aaaaacacct 180

tcaccttcca actggagaat gcccttctac atgctaacgc tggatcgttt tgtagatgga 240

caacctgcca acaacgatgc taacaaaact gtctttgaga atgattggac caccaatcag 300

ttccgattcg gtggagatac caaaggcctg atggaaaact tggactggat ccaggatctc 360

ggtatcaagg taagcacgat gtttacccgc tccttccctt cttcaagttt cccttcttgt 420

ccgtcccttt gcccctatct agtgtctgac cagatttgta ggccatctac ttctcgggtt 480

ctccttttat caaccagccg tgggcttccg acgggttcgg accacttgac tttacactgc 540

ttgatgcaca ccacggaacg atcaccgaat ggcgcgaact catcgaagag ctgcaccgcc 600

gtggtatgta cgccatcatg gagaacacaa tcggtaccat gggagatctg ctcgccttcg 660

agggctggga gaacgaaacc acacccttca atccgctcga atacgacgta ctctggaaga 720

ccagccgaca atatctcgat ttcgaggtcg acaatgacat tcttgaagac tgttcttacc 780

caattttcta tggcgacgat ggctaccctg taaaccaatc tatcatggca accttcgaga 840

accagtgccg taagtccgac ttcgatcagt atggcgacat gaagggagtc ggttacgtac 900

ctccctacca gagtcagctt tcgaagttcg ccagcgttca agatcgtctc aaactttgga 960

aacatgaagt tctcgagaag gtcatgcatt tcagctgtat gcagatcgcc atgctggaca 1020

tcgacggctt ccgagtggac aaagcgctac agactcctat tgatgctttg gccgaatggg 1080

caacatatca gcgtaactgc gctcgccagt acggaaaaga gaacttcctc attaccggtg 1140

aagtcgtagg agagctcaaa ttctcctctg tcttcttcgg ccgtggcaag tctcccgata 1200

cctacttcga agatcagctt gatggacaga atgctactgg aaagactgaa ggctatatcc 1260

gcgagtttgg caataatgcg ctcgacggca caaacttcca ttaccccaca tacgtgagtc 1320

aagcgtcgtg agccttggca gtgcttcgtg actgccaagg ctcacgtatc aagatttctg 1380

gccattcctg ctgacaagca tcatgatata gggtgccctc accagatttt tgggtctcga 1440

cggcgctatt ggcttcgaag gcgtagattt tgtggaccac tggaatgctt atctacttag 1500

cgatgacatg gtgaatgcca ataccggagt ctttgatccc aggcacatgt tcgggactac 1560

taatcaaggt aaggaaaaaa aaaagaaaaa gaaaaagaaa aaaaaagaaa aagaaaaaaa 1620

agaaaaagga aaaaaaagaa aaagaaccct cctctctctg tagctgagca tttgactgac 1680

tgttcggaaa acagacgtct tcagatggcc atcactcatt gatggaaccc aaagacaggt 1740

gctggcgttt ctcatcacct tcttggagat gcccggtatc ccagagttga tttggggaga 1800

cgaagtcgaa tacaaggtct tggagaactt ggccgctgat tacatcttcg gcagacagcc 1860

tatggcctca accagagctt ggcaaatgca cggttgctac aaggttggcg ctgctggcaa 1920

tggttatttc gatatgcctt tcggagacgc gctcacagct tgcgaagacg atacagtcag 1980

tctcgatcag aggaatgccg ctcatccttt gcgaaacctg atcaaacgca tgtttgagct 2040

gcgtaccgtc taccccgtgc tcaacgatgg tttctccctc caaacactct tcttcgatac 2100

ctacgacatt ttcctcccgt atagtggaca attgcccact ccattgggta tctggtcagt 2160

gtatcgcgga cgtactcccg aggttcaaga tctatctggc gagggaatgg gtaaccaggg 2220

cgtctggatc atctactcga accagaacaa gtctgttgag tactcgtacg actgcagcaa 2280

ttcttctcac tctctcgttg cgccattccc ggagggaacg accgtcaaaa acttgttcta 2340

tccttatcaa gaatacacct tgaattcttc tacggctaag ctcggcatcg aaggatcaga 2400

ggagaacaac ggctgtctgc ccagcatcga gctcgaggca tggggatggc gcgcgtttgt 2460

tccgatcgac aagttcgtcg cgcctgctcc agtcatcact ggcgccgtgc ctcgtcatga 2520

cgccagaatt gaaaccactg tggacctcaa tgagaccgtc tcgcttccga tcacattact 2580

gttcagcaga gaaatgaatt gcagctcgat cttgcagagt attagcatca actcgaccac 2640

acagacaggc gtcatcccat tcttcgatgc gtccagtgtg tcatgcaaga acatcacggt 2700

gaatgacaca caacgctttg tcggagaaac actttcgact ttctcgtggt ctgcaaatct 2760

cgtgaacgtt ggtcatggtg tgcacactta cacagtggtc aacgcaacta gtgtcgacgg 2820

aaccgccttc accaacacca aagctcgatt catgctccgc gtgggtcgta acgacaatcc 2880

cgtcgtcttc tccagtgcca actacacgac tggactcatt agtcgcgaca gcactactgg 2940

ccaactgcag ctgacgccaa aagctgctgg tgcgagtcta tggcgttact caaccaacta 3000

tggatcgaac tggtcaaact ggactgacta ctcctactct ggtgggccag ttctcatcga 3060

agagcaagct tggtctggta cgaaagctca acggtgggaa ggagtccatg ttgtcacaca 3120

atattggtct ccacagattg gatcgacaga tcacattcaa cactctgacc tcggagccga 3180

cgtccctcgt cgttggcctc atgttcatgt tcaagggccc tggaatcaat acggctacga 3240

cggtggtctt gacgataaga tgcatcaaga ttcgaatggt acctggaact ttgaccttta 3300

ttccgagttc ccgacatcag ttctggtcaa cgtctggggc atgaatgaag atggtcgtcc 3360

agataagtcg gctgcatacg gcgatgtcga tggcgacaat gtgctcgatt gggtgccgcc 3420

agacagtctg tccttcaacc agatcaacat cactgcaccc cactggcccc ataccggata 3480

cagactcgca gtgaatgatg gttctctgcg ctatactctt actccagccg gctctgcaca 3540

aagacaagtc gcactgtaca ttttgctggc tcttctccca gtcatcactg catgtgctgc 3600

tgtcgccatc tacctcggct cattctatcg cctgaaatac aatgccgtcg ggctcacgaa 3660

gcgcagctat cctttccatc aatttgaaaa gaagaagact atcgcagata tccttcctct 3720

gtctttcaaa aagctgtcgg agaagcagag ctccgtcgca gacaacgtcg aagccagcca 3780

gggtgccatg gtcaccacca atgctcccgg ggccagaaca attcttatcg ctacgatgga 3840

gtataacatc agcgatgaat ggaacatctc cattaagatt ggaggtcttg gagtgatgtc 3900

aggcttaatg gcgaaacatc tcacgaacca taatctcatc tgggttgtgc cctgcgtcgg 3960

ggatgttgtg tatcccatcg ataaagttgt ggagcccatc aaaattacca tcatgggtaa 4020

gcaatatttg atcgactgtc aactccatgt cgtgggacgc atcacatacg tcctgcttga 4080

tgcgccattg ttccgacagc agacgaagaa ggacccttac cccgctcgta tggatgacat 4140

ggacagcgcc atctactactcagcttggaa ttcttgtatc gccgaagtga tgagacgcaa 4200

tcctcagatt gacatctatc acatcaacga ttaccatgga gccgttgcgc cactgcacct 4260

cctgccaaga gtcatccctg tctgtctttc acttcacaac gctgaattcc agggcctctg 4320

gtcaatcagc actccaaaaa ggcttcaaga gatgagcgat gtttttaacc tggataaaga 4380

tctcatccga aagtaagtca gatcgaagcc ttaagtttgt ccggcgaaag ccgtggtgtt 4440

cctacgttgc atctttgttc catcatgcta attttcggaa aggtacgttc agtggggaga 4500

ctcgtttaat ctcttacacg ccggcgcgag ttacctgcgt gtacatcaaa agggttttgg 4560

tgccgtaggt gtctcaaaga aatatggcag tcgaagcttt tcgagatacc caatcttctg 4620

ggggcttccc aaggtgggta tgttgccgaa ccctgatcct gccgatgtag agcacttcga 4680

taagtgtctt ccgaacccgg acgttaccat cgaccaagag tacgaggcct ctcgcggacc 4740

aactcgagtt gaagcacaaa agtgggccaa cctggatatc gatccaacgg ccgagctctt 4800

cgtcttcgtc ggaagatgga gcatgcaaaa aggcattgat ctcatcgcag atgtcttccc 4860

caaggtcctg gaagaaaatc ccaaagcaca gttgatctgt gtgggtcctg ttatcgacct 4920

gtacggtaaa ttcgctgctc tgaagctcga ccacctcatg aagaagtacc cgggtcgtgt 4980

ctactcaaag ccacagttcg tatacatccc acccttcgtc catgaggggg ccgaatgggc 5040

actgatccct tcgcgggacg agcccttcgg tttagtttca gtcgaattcg gccgcaaggg 5100

agcacttggt attggtgcga gggttggcgg tcttgtaagt taacccgaac gttcaacttt 5160

gtaacgttat gctgattgaa aaaaaaggga caaatgcccg gctggtggtt ctccgttgaa 5220

tcttccacga caaaacatct cttgactcag ttcaagaaat gtattaacgg cgctttggct 5280

tcggaccatc agactcgagc ccttctacgc gcaagaagca aggtgcaaag gttcccagtt 5340

cagcagtggg tggaagatct tgagactctt cagaccaagg ctatcaagct caaccacaag 5400

gtgcaggacg gttcgacatc tgctttgaac tctccgatca actcgcttcc caactcacgc 5460

aatccatccc gcgtgacatc tccagcagtc tcgagaccat cttcgccttc tcgggcggcc 5520

tcaagaccgt cttcacctac tccagcagcc tcaagatcgc aatcacccag tccggaaaca 5580

ccgagacctc agatgagacg ccgactttcc agtctcttgt atcctgctca tccctctctg 5640

gaacagtata tgccatttcg tcgtcgtttg tcatctctct tcccttcatc acgccgaacc 5700

ccattcgcgg atcttaaccc gagtacaact gaagagggtg atgaatccag ggacagtctc 5760

ggcgaactcc aaccatcacc accaaaatcg cgccccggta cagctggaag tctgaacgga 5820

gcctcacaaa acttgttcac ccctggcttc ggcttttctg aagaacccgc tctaccaggc 5880

gaggttgcga gacccacaat tgctcactat agacgttcct cgacgcttag cgttgatgag 5940

gttgtaggcg agaagaccga ctacaaccta cagaaggttg atcaatcctt cacagattct 6000

aagctcgact actaccgcat ctatgagggt atgcttggat ctctgaccgc gaagaactcc 6060

gagggtgacc tatgcatcga aaacttcttg gccttggcag aaaagaactg gtaccgcaga 6120

ttcaacgagg ccaagctcgg tcgagctgtt atctctgcac cgagtgtgag tggcaagaaa 6180

ggagcaaaca gtttgcttgt cacggtccgc gaaggatctt ccagtgagag cgaccgcgcg 6240

ggcagtgttg gaggcacctc gcaaaacagc gcagaacagt tcttcacaaa cgccaactac 6300

aagcccccca ctggcatctc gaagttcttg atttcgaagc tgccctacat cgcacctgac 6360

tggccattgt atgcctacct tctcgccttc ggacagatca tcgctgtcaa cagtcatcaa 6420

atcacgatca tcactggagc tcagggtgaa aatgctaaca agctttatgt tgtggcatcg 6480

atctacttgg ctgggtctct attctggtgg ttcatggtcc gtcatttcgc atccaaatat 6540

gcgttgtccc ttccgttcat gttctacggt ctgtcgttct tcttcgttgg tctcgcacca 6600

tacggcatga ctatcgatag taggggatgg attcaaaacg tggcttcagg cttctacgca 6660

tttgcttctt cgtccggatc cctgtacttt gccttgaatt tcgcaagcga aggtggcgta 6720

cctattggca ccatgatcta cagagccacc gttgttcagg gcatccagca gttgtgggtg 6780

gctgcactgt gggcctgggg aacaaccatg agcgctcacc acaccgctaa gtacaccaac 6840

actatcatga actccaaagt gattttggct atcatggccc cgatcgcagt tctgtttgtg 6900

attgttggtc tgcttctcct tttcggtctg cctgattact accacaactc gccaggaaag 6960

gctccatcat tctacaccag tttgttgaag cgcaagttgg tgatctggtt cttcattgcc 7020

gtcatcgttc agaactactg gctttcttca cttgtcggtc gcaactggca atacctcttc 7080

aacagcaccc aggctccaat ctgggctatt gttcttctac ttctgttttt cttcatcgtt 7140

gtttggtgta ctgcactcta cattcttgca cgctactctg aacaccactc ctggttcttg 7200

cccatcttcg gtgctggcct cggtgctccg cgctggtgtc aaatgctctg gagcacatcg 7260

ggcatgggca gccatctacc atggggctcg gtcgttggtg gtgcaattgc tggaaggtgc 7320

ctgtggctct ggctcggcgt tctcgatgct ctgaacggtg tcggtatcgg caccatgctt 7380

cttcagactc ttactcgcca ccacgtcgct gtcactctga ccgctgcaca agttatcggt 7440

tccgtcgcta ccatcgccgc tcgtgcatcg gcacctgatg caactggacc tgcatctgtg 7500

ttccctaatc tggttctcaa tttgagcggg ctcggtgcct gggagttttg ggtcgctctg 7560

ttgttccaga tggtcttgcc ttgtggcttc cttatgttct tccgcaacga acagttgttc 7620

aagccttga 7629

<210>9

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

atggcttgca aaatgatcaa actggccgc 29

<210>10

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

tcaaggcttg aacaactgtt cgttgcgg 28

<210>11

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gcatgcgagg gtgatgaatc cagg 24

<210>12

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gtcgactcac cctcggagtt cttc 24

<210>13

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ggatccaaga actccgaggg tgac 24

<210>14

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gaattcgcca agtagatcga tgcc 24

Claims

1. An enzyme, comprising: an alpha-amylase catalytic domain, an alpha-1, 4-glucan localization domain, a GT 1-glycogen synthase domain, and an exopolysaccharide-transglycosylation domain.

2. The enzyme according to claim 1, characterized in that it comprises at least 2 transmembrane structures.

3. The enzyme according to claim 1 or 2, wherein the amino acid sequence of the alpha-amylase catalytic domain comprises an Asp-X-Glu-Asp sequence, wherein X consists of any 2 to 5 amino acids;

preferably, the alpha-amylase catalytic domain comprises the amino acid sequence shown in SEQ ID NO 1; or an amino acid sequence having at least 90% homology to SEQ ID NO. 1.

4. The enzyme according to claim 1 or 2, characterized in that the α -1, 4-glucan localization domain comprises the Leu-Gln-Ser sequence;

preferably, the alpha-1, 4-glucan localization domain comprises an amino acid sequence shown as SEQ ID NO. 2; or an amino acid sequence having at least 90% homology with SEQ ID NO. 2.

5. The enzyme according to claim 1 or 2, characterized in that the GT 1-glycogen synthase domain comprises a Lys-Ile-Gly sequence;

preferably, the GT 1-glycogen synthase domain comprises the amino acid sequence set forth in SEQ ID NO 3; or an amino acid sequence having at least 90% homology with SEQ ID NO. 3.

6. The enzyme according to claim 1 or 2, characterized in that the exopolysaccharide-transglycosylation domain comprises the amino acid sequence shown in SEQ id No. 4; or an amino acid sequence having at least 90% homology with SEQ ID NO. 4.

7. The enzyme according to claim 1 or 2, characterized in that 2 of said transmembrane structures are transmembrane structure a and transmembrane structure B:

8. The enzyme according to any one of claims 1 to 7, characterized in that the amino acid sequence thereof is represented by SEQ ID NO. 7.

9. A DNA sequence encoding an enzyme according to any one of claims 1 to 8.

10. The DNA sequence of claim 9, wherein the nucleotide sequence is set forth in SEQ ID NO 8.

11. An expression vector comprising a DNA sequence according to any one of claims 9 to 10.

12. A host cell expressing an enzyme according to any one of claims 1 to 8.

13. Use of an enzyme according to any one of claims 1 to 8 in the synthesis of pullulan.

14. A method for producing pullulan by fermenting the host cell of claim 12 to obtain pullulan.

15. A method for synthesizing pullulan, which takes alpha-1, 4-glucan as a substrate and uses the enzyme catalysis of any one of claims 1 to 8 to obtain the pullulan.