CN111549039B

CN111549039B - LbKN1 gene derived from Lubao I and application thereof

Info

Publication number: CN111549039B
Application number: CN202010405997.4A
Authority: CN
Inventors: 李健; 李美; 高兴祥; 房锋
Original assignee: Institute of Plant Protection Shandong Academy of Agricultural Sciences
Current assignee: Institute of Plant Protection Shandong Academy of Agricultural Sciences
Priority date: 2020-05-14
Filing date: 2020-05-14
Publication date: 2022-04-08
Anticipated expiration: 2040-05-14
Also published as: CN111549039A

Abstract

The invention provides a method for generating a new code from' Lubao ILbKN1The amino acid sequence of the gene is shown in SEQ ID NO. 1. As described aboveLbKN1The gene can be used for the modified special type of the colletotrichum gloeosporioides semen cuscutae to prevent and treat the semen cuscutae, and the modification is deletion, knock-down or knockout. The invention providesLbKN1Gene capable of regulating and controlling specialization of bacillus anthracis semen cuscutae (B)Colletotrichum acutatum f.sp.cuscuta) The pathogenicity of the dodder is particularly shown in sporulation capacity: absence ofLbKN1The specialization type of the gene colletotrichum oxysporum anthracnose dodder is obviously higher than that of a wild strain in spore yield.LbKN1The gene participates in the pathogenicity related process of the biocontrol bacteria, and can be applied in the field of genetic engineering for improving the pathogenicity of Lubao I and creating a high-efficiency biocontrol bacteria agent.

Description

LbKN1 gene derived from Lubao I and application thereof

Technical Field

The invention belongs to the field of molecular biology and plant protection, and particularly relates to a plant growth regulatorLbKN1A gene and application thereof, in particular to a special type (B) derived from colletotrichum oxysporum anthracnose dodderColletotrichum acutatum f. sp. cuscuta) Of "Lubao oneLbKN1Genes and their use.

Background

According to statistics of national agricultural technology popularization service centers, in 2017, the weed occurrence area in China reaches 13.8 hundred million mu, and the direct economic loss caused by the harm of weeds is close to 1000 hundred million yuan. In 2016, the sales of herbicides in China is 19.72 billion dollars, accounts for 46 percent of the total sales of pesticides in China, and is the top of various pesticides. Herbicides have become one of the important factors that seriously threaten food and environmental safety in our country. Therefore, the development and demand for environmentally friendly bio-herbicides is increasing.

The dodder is a kind of malignant parasitic weed and is widely distributed in a plurality of provinces of Heilongjiang, Gansu, Shandong, Jiangsu, Hunan, Hubei, Jiangxi, Guangdong and the like in China, and the weed seriously threatens the growth of soybeans, peanuts, potatoes, alfalfa, various Chinese herbal medicines and various southern ornamental plants. The dodder has extremely strong vitality and is easy to generate close parasitic relation with a host, and the chemical herbicide is difficult to prevent and kill off the harm of the dodder fundamentally and is easy to cause phytotoxicity to host plants. Therefore, the traditional Chinese medicine preparation for efficiently controlling the semen cuscutae is lacked, and the market demand for biological control of the semen cuscutae is high.

The 'Lubao I' is a microbial agent which is successfully developed in 1963 by Liu Shi Hai of agricultural academy of sciences in Shandong province and has a special control effect on semen cuscutae, and is the first weed biocontrol microbial agent popularized and applied in a large scale in the world. In the middle and later period of the last 60 years, the production and application of the Lubao I microbial inoculum are developed in more than 20 provinces and regions such as Shandong, Jiangsu, Anhui, Ningxia and the like. However, after long-time artificial culture and preservation, the spore multinucleation phenomenon of the strain Lubao I is increased, the pathogenicity of the microbial inoculum to the south dodder seed is seriously reduced, and even the production and application values are lost. The serious degeneration of the strain causes the production and the application of the Lubao I strain to be trapped in a predicament and almost endangered at the edges of extinction. Therefore, the method of molecular biology is a key breakthrough point for researching the pathogenic mechanism and improving the biocontrol effect and the pathogenic stability of the pathogenicity related genes through mutant searching.

Disclosure of Invention

Aiming at the problem of reduced pathogenicity of the dodder seeds by the Lubao I, the invention provides a special Lubao I-derived dodder seeds from the colletotrichum oxysporumLbKN1The gene can improve the pathogenicity of Lubao I and improve the prevention and treatment effect of the Lubao I on the dodder.

In order to achieve the purpose, the invention adopts the following technical scheme.

A kind ofLbKN1The amino acid sequence of the gene is shown in SEQ ID NO. 1.

Preferably, the aboveLbKN1The nucleic acid sequence of the gene is shown as SEQ ID NO. 2.

As described aboveLbKN1The gene is derived from 'Lubao I'.

As described aboveLbKN1The application of the gene in preventing and treating the dodder. In particularThe special type of the LbKN1 gene modified Cuscuta chinensis for preventing and treating Cuscuta chinensis; the genetic modification is an indel, knockout or knock-down at the gene level.

The semen Cuscutae is a plant of the genus Cuscuta (semen Cuscutae)CuscutaLinn.); preferably from dodder seed (A)Cuscuta chinensisLam., south dodder seed, (Lam.), (south dodder seed)Cuscuta australisR, Br.) or dodder seed of Japan (Cuscuta japonica Choisy）。

Non-expression or low expressionLbKN1A genetic mutant strain specialized in Bacillus thuringiensis, anthrax and semen Cuscutae. The mutant strain is used for treating semen Cuscutae (semen Cuscutae) compared with wild typeCuscutaLinn.) has high pathogenicity.

The invention has the following advantages:

the invention providesLbKN1Gene capable of regulating and controlling specialization of bacillus anthracis semen cuscutae (B)Colletotrichum acutatum f. sp. cuscuta) The pathogenicity of the dodder is particularly shown in sporulation capacity: absence ofLbKN1The specialization type of the gene colletotrichum oxysporum anthracnose dodder is obviously higher than that of a wild strain in spore yield.LbKN1The gene participates in the pathogenicity related process of the biocontrol bacteria, and can be applied in the field of genetic engineering for improving the pathogenicity of Lubao I and creating a high-efficiency biocontrol bacteria agent.

Drawings

FIG. 1 shows how different Lubao-TB 182 strains and Lubao I strains prevent and treat the difference of the dodder;

fig. 2 is a hygromycin amplification validation after continuous transfer of lubao-TB 182 for 5 generations, where M: marker 2000; CK: a wild-type control; 182: lubao-TB 182;

FIG. 3 shows the flanking sequences at the insertion site of the Tail-PCR amplification, wherein 1, 2 and 3 are the results of 3 PCR amplification rounds, and the left side is Marker 2000.

Detailed Description

The present invention will be further described with reference to the following examples and drawings, but the present invention is not limited to the following examples.

EXAMPLE 1 cloning of pathogenicity-related genes

1.1 obtaining of Positive mutants

The "Lubao I" strain can be obtained commercially, such as China center for culture Collection of Microorganisms (CMCC), with platform number Bio-17420. Activating the above strain, culturing on 9cm PDA culture plate, washing with 6 mL/dish sterile water for 10 days to remove conidia on colony surface, filtering, observing spore concentration in the filtrate under microscope via hemocytometer, and diluting to spore concentration of 1 × 10⁵one/mL for use.

A single colony of freshly activated Agrobacterium AGL-1 containing the binary vector pBHt2 was picked, inoculated into 2 mL of LB liquid medium (kanamycin 50. mu.g/mL), and cultured at 28 ℃ for 1 day at 220 rpm. Taking 250 mu L of the shaken agrobacterium solution, placing the solution into 50 mL of MM medium (containing 50 mu g/mL kanamycin), culturing the solution in a shaker flask at 220 rpm and 28 ℃ for 2 d, and measuring the OD of the bacterium solution₆₀₀Then, the cell concentration was adjusted to OD by using MM liquid medium₆₀₀And reaching 0.3 for standby.

Co-IM (pH 5.5) medium containing 200. mu.M Acetosyringa (AS) and 1.0 mg/mL 2-morpholinoethanesulfonic acid (MES) was poured onto a plate (9 cm), and 100. mu.L of spore was concentrated at 1X 10⁶Conidia per mL and OD 100. mu.L₆₀₀And = 0.3, slightly coating the mixed agrobacterium liquid on glass paper by using a coater, paving the glass paper on a flat plate, culturing for 36 hours at 25 ℃, removing the glass paper, attaching the bacteria-carrying surface to a PDA solid culture medium (containing hygromycin B250 mug/mL), removing the glass paper after culturing for 3 days at 25 ℃, continuously culturing for 4-7 days until transformants grow out in the PDA culture medium, and picking the transformants to a new PDA culture medium (containing hygromycin B250 mug/mL).

And (3) cutting a filter paper of a part of transformants, carrying out continuous subculture on the PDA culture medium, continuously culturing for 5 generations, and then inoculating the transformants to the PDA culture medium containing hygromycin B to verify the genetic stability of the hygromycin B resistance. Meanwhile, selecting a part of transformant bacterial colony to be inoculated into a PDA liquid culture medium, carrying out shaking culture at 26 ℃ and 180 rpm for 3 d, filtering and collecting mycelium, extracting genome DNA by a CTAB method, and carrying out PCR detection on hygromycin gene by the following primers:

Hyg-F：TCGATGTAGGAGGGCGTGGA；（SEQ ID NO: 3）

Hyg-R：CGCGTCTGCTGCTCCATACAAG；（SEQ ID NO: 4）

carrying out electrophoresis on the PCR product by using 1% agarose gel to obtain a positive transformant with a 625bp band; and then numbering and storing the strains which are identified as positive.

1.2 screening of pathogenicity-related mutants

Primary screening: selecting semen Cuscutae with vigorous growth and uniform and strong stem growth, needling stem with needle to concentration of 1 × 10⁵And (3) inoculating conidium solution of each/mL positive transformant on the wound stem, setting a wild type Lubao I control, and repeating for 3 times. After culturing for 72 h in a constant temperature incubator at 28 ℃, observing the morbidity of the dodder, and primarily obtaining the pathogenicity difference mutant.

Obtaining of highly pathogenic mutants: and (4) re-verifying the strongly pathogenic mutant by adopting a field natural habitat control effect verification mode. And 4, planting soybeans in the middle ten days of the month, sowing semen cuscutae seeds when the soybeans grow to be about 10-15cm in height, and completing the complete infection of the semen cuscutae on the soybeans after 45 days. Uniformly spraying primary screening mutant and wild strain conidium solution at 17:00 in the afternoon, wherein the concentration of the conidium solution is 1 × 10⁵The seed/mL, the water consumption is 45L/mu, and the preparation of conidium refers to the method of example 1.1. After inoculation for 10d, the control effect is observed, as shown in fig. 1: the dodder stem sprayed with the mutant strain is withered and browned, and the dodder stem sprayed with the wild type is green and grows normally; obtaining the mutant strain with high pathogenicity.

After the highly pathogenic mutant strain is continuously transferred to a normal PDA culture medium for 5 generations, PCR detection and pathogenicity determination are carried out again, and both the 625bp hygromycin gene (shown in figure 2) can be amplified without change of the pathogenicity, which indicates that the obtained highly pathogenic strain can be stably inherited, and the Southern blot technology is utilized to confirm that the mutant is a single-copy insertion mutation.

2. Cloning of pathogenicity-related genes

Extracting genome DNA of a high-pathogenicity strain by adopting a CTAB method, and cloning flanks of a pathogenicity related mutant insertion site by utilizing a staggered thermal asymmetric PCR (TAIL-PCR) methodAnd (4) sequencing. Wherein the random primer comprises AD1, AD2, AD3 and AD 4; the specific nested primers RB1/RB2/RB3 amplify the RB flanking sequences at the end of the inserted T-DNA fragment, and LB1/LB2/LB3 amplify the LB flanking sequences at the end of the inserted T-DNA fragment. TAIL-PCR reaction systems and procedures were referenced to the method of Mullins (Mullins E D, Chen P X, Romaine P, et al, Agrobacterium-mediated transformation of Fusarium oxysporum: An effective reagent for inducing mutagenesis and gene transfer. Phytopathology, 2001, 91: 173. sup. 180.) and Haoqie et al (Haojie, Wuwei, Hechuiping, et al. Colletotrichum pathogenic attenuation mutant strain H800T-DNA insertion site flanking gene cloning. Reptical Redto Rep. Redto. 2015, 36(5): 949. sup. 955.). Sending the PCR product to the company Limited in Biotechnology engineering (Shanghai), sequencing, performing BLAST analysis on the sequence, confirming the gene at the insertion site, amplifying the full-length sequence of the gene by using the Rapid Amplification of CDNA Ends (RACE) and conventional PCR technology, wherein the sequence is shown as SEQ ID NO: 2, the translated amino acid sequence is shown as SEQ ID NO:1, and the gene is named asLbKN1. The mutant strain with high pathogenicity is obtained by screeningLbKN1A gene deletion mutant strain.

TABLE 1 primer sequences

Note: v is A + C + G; d is A + T + G; b is T + C + G; h is A + T + C; w is A + T; s is C + G; k is T + G; m is A + C; y is C + T; r is A + G; n is A + G + C + T.

EXAMPLE 3 phenotypic function of the mutant strains

Wild type strain of Lubao I and the strain obtained in example 1LbKN1Activating the deletion mutant strain on a PDA culture medium, culturing at 28 ℃ for 6 days, selecting the edge of a colony, culturing on a new PDA culture medium, and culturing for 7 days to finish the analysis and determination of the biological properties, sporulation yield and pathogenicity of the mutant.

The strain control effect verification is carried out by referring to the method for obtaining the high-pathogenicity mutant in example 1.2. And after 10 days of inoculation, picking the mutant and the residual dodder seed after wild type prevention and treatment in the same area, weighing, and comparing with a clean water prevention and treatment group. Control effect (%) = (weight of control group dodder-weight of inoculation group dodder)/weight of control group dodder. Wherein the inoculation groups are respectively mutant and wild type.

Activating the Lubao I strain and the mutant strain on a PDA (potato dextrose agar) culture medium, culturing at 28 ℃ for 6 days, picking the edge of a colony, culturing on a new PDA plate (9 cm), measuring the diameter of the colony after culturing for 7 days, and calculating the average growth rate; spore production was then determined by rinsing the surface spores with 6mL of sterile water per dish.

TABLE 2 differences between mutant strains and "Lubao I" strains in control efficacy and other traits

As shown in Table 2, the mutant strain has no significant difference in growth rate compared with the wild type Lubao I strain, but has higher sporulation yield and better prevention and control effect. .

Sequence listing

<110> institute of plant protection of academy of agricultural sciences of Shandong province

<120> LbKN1 gene derived from Lubao I and application thereof

<130> 2020051301

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 697

<212> PRT

<213> Colletotrichum acutatum

<400> 1

Met Asn Ser Glu Arg Val Pro Ser Leu Pro Leu Pro Asn Leu His Gln

1 5 10 15

Ala Tyr Ser Ser Gly Thr Ser Ser Pro Arg Val Ser Ser Ile Gly Ser

20 25 30

Ala Ser Ser Ser His Ala Gly Ser Gln Ser Ser Phe Thr Ser Ala Ala

35 40 45

Ser Ser His Gly Pro Lys Thr Pro Ser Pro Thr Leu Pro Ile Asn Ala

50 55 60

Ala Ile Pro Gly Ser Ser Gly Gln Pro Ile Ala Gly Tyr Glu His Tyr

65 70 75 80

Pro Ala Met Asn Gln Pro Ala Ala Asp Met Tyr Tyr Gln Gln His Ile

85 90 95

Ser Ala Gly Gln Ala Pro Pro Pro Gln Thr Val Thr Ser Gly Ala Met

100 105 110

Ser Tyr His Ser Gln Pro Pro Pro Leu Gln Pro Ser His Leu Pro Gln

115 120 125

Tyr Gln Gln Gln Thr Gln Tyr Gly Gln Pro Tyr Gly Tyr Ala Asn Gly

130 135 140

Leu Thr Ser Pro Gln Ser Ala Pro Val Asn Asn Gly Met Gly Gly Gln

145 150 155 160

Asn Val Leu Pro Leu Pro Gly Val Asn Pro Gly Gly Phe Gln Gly Phe

165 170 175

Asp Thr Thr Gly Gln Val Ala Pro Pro Gly Met Lys Pro Arg Val Thr

180 185 190

Ala Thr Leu Trp Glu Asp Glu Gly Ser Leu Cys Phe Gln Val Glu Ala

195 200 205

Arg Gly Ile Cys Val Ala Arg Arg Glu Asp Asn His Met Ile Asn Gly

210 215 220

Thr Lys Leu Leu Asn Val Ala Gly Met Thr Arg Gly Arg Arg Asp Gly

225 230 235 240

Ile Leu Lys Ser Glu Lys Val Arg His Val Val Lys Ile Gly Pro Met

245 250 255

His Leu Lys Gly Val Trp Ile Pro Phe Glu Arg Ala Leu Asp Phe Ala

260 265 270

Asn Lys Glu Lys Ile Thr Glu Leu Leu Tyr Pro Leu Phe Val His Asn

275 280 285

Ile Gly Ala Leu Leu Tyr His Pro Thr Asn Gln Thr Arg Thr Asn Gln

290 295 300

Val Met Ala Ala Ala Glu Arg Arg Lys Ala Glu Gln Ser Gln Met Arg

305 310 315 320

Gly Ala Pro Gln Asn Gly Ala Pro Gly Leu Pro Ser Leu Gln Gln His

325 330 335

His His His Ser Met Gly Leu Pro Gly Pro Gln Gln Pro Leu Pro Ser

340 345 350

His Ala Asn Met Gly Arg Pro Thr Leu Asp Arg Ala His Thr Phe Pro

355 360 365

Thr Pro Pro Thr Ser Ala Ser Ser Val Met Gly Gly Ser Met Gly Ala

370 375 380

Ser Asp Asn Gly Phe Gln Trp Ala Gln Ser Gln Gly Met Ala Asn Ala

385 390 395 400

Gln Pro Gln Asn Pro Met Ser Ile Asp Thr Gly Leu Ser Asn Ala Arg

405 410 415

Ser Met Pro Ala Thr Pro Ala Ser Thr Pro Pro Gly Ser Thr Ile Gln

420 425 430

Asn Met Gln Pro Tyr Gln Thr Gly Thr Gln Gln Tyr Asp Ser Ser Arg

435 440 445

Ala Met Tyr Asn Gln Ser Ser Gln Gln Ser Pro Tyr Gln Thr Ser Gln

450 455 460

Gly Ser Gln Asp Arg Ser Val Tyr Gly Gln Asn Asp Pro Tyr Ala Lys

465 470 475 480

Ser Asp Met Gly Pro Pro Ser Ala Arg Pro Ala Ala Thr Ser Ala Ser

485 490 495

Gln Asp Gln Lys Pro Ser Asn Gly Ile Met His Pro Asp Ser Asn Ala

500 505 510

Pro Gln Pro Ala Gly Glu Glu Glu Ala Asp His Glu His Asp Ala Glu

515 520 525

Tyr Thr His Asp Ser Ser Ala Tyr Asp Ala Asn Arg Gly Ser Tyr Asn

530 535 540

Tyr Ser Ala Pro Pro Val Gly Ser Leu Ser Asn Glu His Gln His Leu

545 550 555 560

Ser Pro Glu Met Thr Gly Ser Pro Ser His Pro Pro Ala Ser Gly Arg

565 570 575

Ala Thr Pro Arg Thr Ala Ala Ala Pro Gln Pro Tyr Tyr Ser Gln Gln

580 585 590

Ala Gly Tyr Ser Thr Pro Pro Arg Val Ala Gln Gln Ser Ser Ser Asn

595 600 605

Leu Phe Asn Val Ile Thr Asp Arg Asn Ser Ala Ala Ala Gly Gly Asn

610 615 620

Asn Val Tyr Gln Pro Gln Ser Asp Met Asn Ser Met Pro Asn Gly Tyr

625 630 635 640

Pro Ser Gln Met Asn Gly Ala Ser Ser Gly Ile Lys Arg Gly Arg Asp

645 650 655

Asp Asp Asp Asp Leu Gln Arg Pro Leu Ser Gly Gly Gly Met Asp Met

660 665 670

Lys Arg Arg Lys Thr Leu Met Asn Ser Ala Val Pro Thr Tyr Asp Thr

675 680 685

Met Ala Arg Pro Phe Leu Ser Arg Asp

690 695

<210> 2

<211> 2214

<212> DNA

<213> Colletotrichum acutatum

<400> 2

atgaacagcg agagagtgcc gtctcttcca ttgcccaacc tgcatcaggc gtactcatcg 60

ggtacctcgt caccccgggt cagctccatt ggctccgctt caagctctca cgcaggttcg 120

cagtcgtcct tcacgtcggc cgcatcctcc cacggaccca agacaccttc tcctactctg 180

cccatcaacg cggcgattcc tggatcttcc ggtcagccaa ttgctggtta cgagcattac 240

cccgccatga atcaacctgc agcagacatg tactatcagc aacatatttc tgccggtcaa 300

gcgccaccgc cccagaccgt gacctccggc gcaatgtctt accactccca gccaccgccg 360

ttacagccaa gccatctgcc tcaatatcag cagcagactc aatacggcca gccgtacggt 420

tatgccaatg gcttgacttc gccccaaagc gctcccgtga acaacggaat gggtggacaa 480

aacgtgctgc ctctcccagg tgtcaaccct ggaggtttcc agggttttga caccactggc 540

caagtcgctc ctcccggtat gaagcccaga gtcacagcca ctttgtggga ggacgaaggc 600

agcctgtgct tccaggttga ggcacgaggc atctgtgttg cgcgtcgcga gggtaagttc 660

gattggcata ttcaatggtc gccgaagcat tgctaacatg cacactagat aatcacatga 720

ttaatggaac caagctattg aacgtcgcgg gtatgacccg tggtcgccgc gatggaattc 780

tcaagagcga gaaagtgaga cacgtcgtca agattggccc tatgcacctg aagggtgtct 840

ggtgagtttc atgtgcccca agacaaatcc ggccgggcta ggtctaacgc gaagaaaaat 900

aacaggatcc cttttgagag agctttggac tttgcaaaca aggagaagat caccgaactg 960

ctctatcccc tcttcgtcca caacattggc gctttgctct accaccccac gaaccagact 1020

cgcaccaacc aagtcatggc tgctgctgaa cgccgcaagg cagaacagag ccagatgcgc 1080

ggtgctcctc agaacggcgc acctgggctg ccgtctcttc aacagcacca ccaccactct 1140

atgggattgc ctggacctca gcaacctctg ccgtcccatg ctaacatggg ccgtcccact 1200

ctcgaccgcg cccacacgtt tcctactccc ccgactagcg cttctagcgt aatgggtggc 1260

agcatgggtg cctcagacaa cggattccaa tgggctcaat ctcaaggaat ggccaacgcg 1320

cagccccaga accccatgtc tattgacact ggtctcagca atgcccgttc catgccggca 1380

actcctgcct ccacaccgcc tggctccacc attcagaaca tgcagcccta tcagaccggc 1440

acacagcaat acgacagctc gagggccatg tataaccagt cttctcagca gtccccttac 1500

caaaccagcc agggctcgca agatcgctcc gtatacggcc agaacgaccc gtacgctaag 1560

agcgatatgg gtcctccgtc agcacggccc gctgcaacga gcgcctccca ggatcagaag 1620

ccctcaaacg gcatcatgca tcctgattcc aatgctcctc agcctgcggg tgaggaagag 1680

gcagaccacg agcatgacgc cgagtacacc cacgacagca gcgcctacga tgccaatcgc 1740

ggatcgtaca actactccgc tcctcccgtt ggatccctct ccaacgaaca ccagcatctc 1800

tctcctgaga tgacaggctc acccagccac cctcctgcat ccggccgtgc tactccccgt 1860

accgccgctg cacctcagcc ttactactcc cagcaggccg gctacagcac gcctccgcgt 1920

gtcgcccagc aatcttcaag caacctcttt aatgtaatca ccgaccgcaa ttctgcagct 1980

gctggtggta acaatgttta ccagcctcag tccgacatga actccatgcc caacgggtac 2040

ccctcacaga tgaacggtgc ttcgagtggc atcaagcgtg gtcgtgatga tgacgacgac 2100

ctgcagcgtc cgctgagcgg tggcggcatg gacatgaagc gcagaaagac gctcatgaac 2160

tcggctgttc ccacatatga caccatggcc cggcccttcc tctcccgaga ttga 2214

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Hyg-F

<400> 3

tcgatgtagg agggcgtgga 20

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Hyg-R

<400> 4

cgcgtctgct gctccataca ag 22

<210> 5

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> AD1

<220>

<221> misc_feature

<222> (5)..(5)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (10)..(10)

<223> n is a, c, g, or t

<400> 5

agwgnagwan cawagg 16

<210> 6

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223> AD2

<220>

<221> misc_feature

<222> (6)..(6)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (11)..(11)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (14)..(14)

<223> n is a, c, g, or t

<400> 6

wagtgnagwa ncanaga 17

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223> AD3

<220>

<221> misc_feature

<222> (6)..(6)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (11)..(11)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (14)..(14)

<223> n is a, c, g, or t

<400> 7

wagtgnagwa ncangtt 17

<210> 8

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> AD4

<220>

<221> misc_feature

<222> (5)..(5)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (10)..(10)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (13)..(13)

<223> n is a, c, g, or t

<400> 8

wcagntgwtn gtnctg 16

<210> 9

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> RB1

<400> 9

ggcactggcc gtcgttttac aac 23

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> RB2

<400> 10

aacgtcgtga ctgggaaaac cct 23

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> RB3

<400> 11

cccttcccaa cagttgcgca 20

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> LB1

<400> 12

gggttcctat agggtttcgc tcatg 25

<210> 13

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> LB2

<400> 13

catgtgttga gcatataaga aaccct 26

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> GAATTAATTCGGCGTTAATTCAGT

<400> 14

gaattaattc ggcgttaatt cagt 24

Claims

1. An LbKN1 gene is characterized in that the coded amino acid sequence is shown as SEQ ID NO. 1.

2. The LbKN1 gene according to claim 1, wherein the nucleic acid sequence is set forth in SEQ ID NO. 2.

3. The LbKN1 gene as claimed in claim 1 or 2 for preventing and treating dodder seed (dodder seed: (dodder seed) (dodder seed))CuscutaLinn), characterized in that the LbKN1 gene modified special type of the colletotrichum oxysporum anthracnose dodder seed is used for preventing and treating dodder seed (dodder seed: (L.)CuscutaLinn.); the genetic alteration is an indel, a knockout or a knock-down.

4. The use of claim 3, wherein the genetic modification is a knockout or a knockdown.

5. The use as claimed in claim 3, wherein the dodder seed is selected from dodder seed (dodder seed), (dodder seedCuscuta chinensisLam., south dodder seed, (Lam.), (south dodder seed)Cuscuta australisR, Br.) or dodder seed of Japan (Cuscuta japonica Choisy）。

6. The specialization mutant strain of the colletotrichum oxysporum, anthracnose and south dodder seed, which does not express or expresses LbKN1 gene at low level, is characterized in that the amino acid sequence coded by the LbKN1 gene is shown in SEQ ID NO. 1.