CN111548953A - Microbial fermentation inoculant for accelerating fermentation of wheat straws and preparation method thereof - Google Patents
Microbial fermentation inoculant for accelerating fermentation of wheat straws and preparation method thereof Download PDFInfo
- Publication number
- CN111548953A CN111548953A CN202010323193.XA CN202010323193A CN111548953A CN 111548953 A CN111548953 A CN 111548953A CN 202010323193 A CN202010323193 A CN 202010323193A CN 111548953 A CN111548953 A CN 111548953A
- Authority
- CN
- China
- Prior art keywords
- fermentation
- microbial
- straws
- wheat
- inoculant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
- C05F11/00—Other organic fertilisers
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
- C05F17/00—Preparation of fertilisers characterised by biological or biochemical treatment steps, e.g. composting or fermentation
- C05F17/20—Preparation of fertilisers characterised by biological or biochemical treatment steps, e.g. composting or fermentation using specific microorganisms or substances, e.g. enzymes, for activating or stimulating the treatment
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
- C05F17/00—Preparation of fertilisers characterised by biological or biochemical treatment steps, e.g. composting or fermentation
- C05F17/80—Separation, elimination or disposal of harmful substances during the treatment
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W30/00—Technologies for solid waste management
- Y02W30/40—Bio-organic fraction processing; Production of fertilisers from the organic fraction of waste or refuse
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Toxicology (AREA)
- Virology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Fertilizers (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a microbial fermentation inoculant for accelerating fermentation of wheat straws and a preparation method thereof, wherein the microbial inoculant is obtained by carrying out amplification culture on a microbial flora separated from infected straws, the microbial flora mainly comprises two major components of bacteria and actinomycetes, and the identified bacterial components of the wheat straws also comprise bacillus, pseudomonas, pantoea, bifidobacterium, acetobacter, lactobacillus, stenotrophomonas, klebsiella, citrobacter and flavobacterium. The microbial agent prepared by the invention has high prevention effect on wheat scab and gibberellin, can inhibit the growth of pathogenic bacteria in the fermentation process of wheat straw raw materials for preparing organic fertilizer, can accelerate the fermentation and decomposition speed of straw, and has obvious effect and strong universality.
Description
Technical Field
The invention belongs to the technical field of microbial inoculants, and particularly relates to a microbial fermentation inoculant for accelerating fermentation of wheat straws and a preparation method thereof.
Background
The straws are rich in organic matters and various nutrient elements required by crop growth, and are important raw materials for preparing organic fertilizers by fermentation. The principle of straw fermentation is that organic matters in the straw are subjected to a complex conversion process under the action of microorganisms in the fermentation process, firstly, the complex organic matters are decomposed into simple substances, and finally, carbon dioxide, water, mineral nutrients and the like are generated; and organic matters are synthesized again to generate more complex special organic matter humus which is more beneficial to absorption and utilization of crops. The straw is fermented into the organic fertilizer, so that on one hand, the straw can be stopped from being burnt, and the green and pollution-free straw treatment is realized; on the other hand, the waste straws are recycled, so that the cost is reduced, and the recycling of the straws is an important means for developing green agriculture.
Wheat is used as a main grain crop, the yield of straws is huge every year, and the wheat has great development potential in the field of organic fertilizer preparation. However, wheat scab is a common soil-borne disease in wheat fields and is caused by one or more fungi, fusarium graminearum is a main pathogenic bacterium of the wheat, the infection stage of the fusarium graminearum mainly occurs in the flowering period of wheat which is more suitable for the growth of the pathogenic bacterium, and the infection bacteria are transmitted to the ear from the root of the plant through strong wind or rain water, and finally the ear is rotted. Meanwhile, when the pathogenic bacteria infect and grow on the wheat head, various harmful secondary metabolites are generated, typically mycotoxins such as Deoxynivalenol (DON), Zearalenone (ZEN), Nivalenol (Nivalenol, NIV) and the like, and the toxins can remain on wheat grains for a long time, so that food and feed safety is seriously harmed, wherein the harm of the DON toxin is particularly serious. According to research of relevant scholars, DON toxin can remain on diseased wheat grains after the wheat is stored for four years. Meanwhile, the toxicity of DON toxin to cells is huge, and the DON toxin can play a certain role in inhibiting the translation of ribosome. The human body can have symptoms of vomiting, diarrhea, nausea and the like after being ingested. If the intake amount is excessive, massive hemorrhage and decreased immunity will occur. After eating the poisonous feed, the livestock mainly shows symptoms of inappetence, vomit, body slimming and the like, and can die in severe cases. In addition, certain toxin residues exist in meat, eggs and milk products, so that the diffusible harm is caused to eaters.
More seriously, the wheat which is infected by fusarium graminearum still has a large amount of pathogenic bacteria remained in the wheat straws after the wheat is mature and harvested, and the pathogenic bacteria are difficult to be thoroughly eliminated in the composting fermentation process, so that the application of the organic fertilizer prepared from the wheat straws is limited.
In the straw fermentation process, in order to accelerate the straw decomposition speed, a fermentation inoculant is usually added into a fermentation material, but the activity of fusarium graminearum in diseased wheat straws cannot be inhibited generally by using wider straw fermentation inoculants in the current market, and the fermentation time of the straws added with the conventional fermentation inoculants still needs 15-30 days, or is relatively longer, so that the overall production efficiency of the organic fertilizer is influenced.
Therefore, the research expects that a novel microbial fermentation inoculum can be obtained to be used as the fermentation inoculum of the wheat infected straws, the decomposition time of the straws can be further shortened, meanwhile, the growth of pathogenic bacteria in the straws can be inhibited, and the use safety of the produced organic fertilizer is ensured.
Disclosure of Invention
The invention aims to solve the defects in the prior art and provides a microbial fermentation inoculant which acts on the fermentation process of wheat straws and can effectively prevent and treat wheat scab.
The specific technical scheme of the invention is as follows:
the invention provides a preparation method of a microbial fermentation inoculant for accelerating fermentation of wheat straws, which comprises the following specific steps:
s1 pretreatment of straw raw materials: taking straws infected by wheat scab, crushing the straws into powder, and naturally drying the straws for later use;
separation of S2 microbial flora: filling 100mL of sterile inorganic salt culture medium into a triangular flask with the specification of 250mL, adding straws into the triangular flask according to the amount of 5% of the liquid volume, carrying out primary culture in a shaker at 30 ℃, transferring flora suspension into a fresh 100mL of sterile inorganic salt culture medium according to the amount of 10% of the liquid volume, continuing to culture for 48h, and carrying out subculture for 5 times according to the method to obtain microbial flora;
s3 preparation of fermentation liquor: placing 400L inorganic salt culture medium in 500L fermentation tank, sterilizing at 121 deg.C and 0.1MPa for 30min, and cooling to room temperature;
expanding culture of S4 flora: adding the treated straw into a fermentation tank according to the amount of 5% of the liquid volume, adding the microbial flora seed liquid for subculture for 5 generations into the fermentation tank according to the amount of 10% of the liquid volume, and culturing for 60-72h under set fermentation conditions to obtain the microbial agent bacterial suspension.
Further, the rotation speed of the shaker during the primary culture in step S2 is 160-180rpm, and the culture time is 45-55 h.
Further, the fermentation conditions in step S4 were a culture temperature of 30-35 ℃, a stirring rate of 200-220rpm, and an aeration rate of 1: 0.4.
Further, the effective viable count in the bacterial suspension obtained in step S4 is 5 × 108one/mL.
Further, the microbial flora obtained in step S2 mainly includes two major groups of bacteria and actinomycetes, and the bacterial groups of the identified genera include bacillus, pseudomonas, pantoea, bifidobacterium, acetobacter, lactobacillus, stenotrophomonas, klebsiella, citrobacter, and flavobacterium.
A microbial fermentation microbial inoculum for accelerating the fermentation of wheat straws is obtained by carrying out expanded culture on a microbial flora separated from infected straws, wherein the microbial flora mainly comprises two major components of bacteria and actinomycetes, and the identified bacterial components of the wheat straws also comprise bacillus, pseudomonas, pantoea, bifidobacterium, acetobacter, lactobacillus, stenotrophomonas, Klebsiella, citrobacter and flavobacterium.
Compared with the prior art, the invention has the following beneficial effects:
1. when the microbial fermentation inoculant disclosed by the invention is used for treating wheat fermented straws, the nutrient components and the enzyme activity in compost are improved, the fermentation and decomposition of the straws can be accelerated, the production period of organic fertilizers is shortened, the production efficiency can be accelerated by implementing industrialization, and the economic benefit of enterprises is improved;
2. the microbial fermentation inoculum disclosed by the invention contains microbial flora with better control effect on wheat scab, and has unique advantages in treatment of infected straws;
3. the microbial flora disclosed by the invention is obtained by separating diseased straws, so that the adaptability to the field complex repairing environment is stronger, and the field application effect of the microbial inoculum is better;
4. the preparation process disclosed by the invention is simple in flow, wide in raw material source, low in separation and fermentation cost, free of environmental pollution and easy to popularize on a large scale;
5. the microbial agent disclosed by the invention has the effect of accelerating straw decomposition, is suitable for the fermentation process of other straws except wheat straws, also has the effect of accelerating fermentation, and has strong universality.
Drawings
FIG. 1 is a pie chart of the proportion distribution of different microorganisms among the flora obtained in the first embodiment of the present invention;
FIG. 2 is a statistical graph of comparative data of nutrient content and enzyme activity in fermented compost from three treatment groups obtained in example two of the present invention;
FIG. 3 is a specificity verification map of Fusarium graminearum detection primers obtained in example two of the present invention;
FIG. 4 is a statistical chart of data comparing the amount of Fusarium graminearum and the content of DON toxin in three treatments obtained in example two of the present invention;
FIG. 5A is an HPLC detection profile of DON toxin in control compost obtained in example two of the present invention;
fig. 5B is an HPLC detection profile of DON toxin in the experimental group compost to which the bejia organic fertilizer fermentation inoculum is added, obtained in example two of the present invention;
fig. 5C is an HPLC detection profile of DON toxin in experimental group compost to which the microbial fermentation agent prepared by the present invention was added, obtained in example two of the present invention.
Detailed Description
The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications and substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit of the invention.
The culture medium and the buffer solution required by the invention are as follows:
basal salt medium (g/L): NH (NH)4NO31.0，KH2PO40.5，K2HPO4·3H2O 1.5，NaCl 1.0，MgSO4·7H2O0.2, adjusting the pH value to 7.0, sterilizing at 121 ℃ for 30 min;
PDA medium (potato dextrose agar medium): cleaning and peeling 200g potato, cutting into 1cm small pieces, boiling in water for 30min, filtering with four layers of gauze, adding 10g glucose (solid and agar 15 g), dissolving completely, adding distilled water to 1L, sterilizing at 115 deg.C for 25 min;
mung bean culture medium: 30g of mung bean, washing the mung bean, adding water, boiling until the mung bean blooms, filtering with gauze, naturally adjusting the pH value, supplementing the filtrate to 1L with distilled water, sterilizing at 121 ℃ for 15 min.
Phosphate buffer: 45.23g of disodium hydrogen phosphate and 8.07g of citric acid were weighed, dissolved in water and brought to a volume of 1L, and the pH was adjusted to 6.0.
The first embodiment is as follows: extended culture of microbial flora
1. Pretreatment of straw raw materials: the infected straws are collected from wheat fields in Nanjing city of Jiangsu province, crushed into powder and naturally dried for later use;
2. and (3) separating microbial flora: filling 100mL of sterile inorganic salt culture medium into a triangular flask with the specification of 250mL, adding straws into the triangular flask according to the amount of 5% of the liquid volume, culturing for 48h by using a shaker at 30 ℃ and at 180rpm, transferring flora suspension into fresh 100mL of sterile inorganic salt culture medium according to the amount of 10% of the liquid volume, continuously culturing for 48h, and subculturing for 5 times according to the method;
3. preparing a fermentation liquid: placing 400L inorganic salt culture medium in 500L fermentation tank, sterilizing at 121 deg.C and 0.1MPa for 30min, and cooling to room temperature;
4. and (3) expanding culture of flora: adding the treated straw into a fermentation tank according to the amount of 5% of the liquid volume, adding the microbial flora seed solution subjected to subculture for 5 generations into the fermentation tank according to the amount of 10% of the liquid volume, and culturing for 65 hours at the conditions of 30 ℃, the stirring speed of 220rpm and the ventilation rate of 1:0.4 to obtain the microbial fermentation inoculum suspension.
Using strong water DNA extraction kit (
DNA Isolation Kit, MOBIO) to extract total DNA of the water sample of the flora suspension obtained in step 2, and determine the composition structure of the flora in the sample (entrusted to beijing nova monogenic science and technology ltd), with the detection results shown in fig. 1. It can be seen from FIG. 1 that the main components of the microbial flora obtained in the present invention are bacteria and actinomycetes, and the bacterial components of the identified genera mainly include Bacillus, Pseudomonas, Pantoea, Bifidobacterium, Acetobacter, Lactobacillus, stenotrophomonas, Klebsiella, Citrobacter and Flavobacterium.
Example II determination of relevant parameters in fermented compost from diseased stalks
1. Preparation of fusarium graminearum spore liquid
Transferring activated Fusarium graminearum to PDA plate, culturing at 25 deg.C for 5 days, selecting mycelium, inoculating to semen Phaseoli Radiati culture medium, culturing at 25 deg.C and 180rpm for 5 days, filtering with gauze, centrifuging at 7000rpm for 10min, resuspending the precipitate with sterile water to obtain a precipitate with concentration of 10%5And (4) putting the rice in a refrigerator for standby.
2. Wheat infected straw fermentation
1) Experimental setup: three groups of treatments are set in total, wherein the three groups of treatments comprise a control group (natural fermentation of straws) and two experimental groups (the infected straws are treated by respectively using the microbial fermentation inoculant prepared by the invention and a Beijia organic fertilizer fermentation inoculant), the fermentation and decomposition degrees of the straws in the same fermentation time are compared, indexes such as crude protein, crude fiber, crude fat, crude ash, calcium content, phosphorus content, alpha-amylase, protease and cellulase activity in the fermented compost are compared, and the quantity of fusarium graminearum in the fermented compost and the content of DON toxin are determined after the fermentation is finished, so that the effect of the microbial fermentation inoculant in the process of fermenting the infected straws is determined.
2) The specific experimental operations were as follows:
activating Bajia organic fertilizer fermentation bacteria agent, namely adding 1kg of strain and 1kg of brown sugar into 18kg of well water, uniformly stirring, standing for 72 hours without a sealed container, and obtaining bacterial suspension with effective viable count of 5 × 108one/mL.
i. Drying the wheat infected straws in the sun, crushing the wheat infected straws into crushed slag with the particle size of about 5 mm, and adding urea to adjust the carbon-nitrogen ratio to be 25: 1;
ii, uniformly spraying activated fermentation microbial inoculum or bacterial suspension of the expanded microbial fermentation microbial inoculum into the straws layer by layer, spraying tap water to a control group, controlling the humidity within the range of 50-60% (grasping the control group into a ball by hand, slightly throwing the control group to the ground to scatter), piling the control group into a square pile with the side length of 1.5 meters, covering a plastic film, and keeping good air permeability, wherein the plastic film is not sealable;
turning the pile once when the temperature rises to 50 ℃ and the hand feels slightly hot, and turning the pile once again when the temperature rises to 50 ℃ again;
iv, controlling the later fermentation temperature at 60 ℃, fermenting for 3 days, and curing for 10 days.
3) Comparison of degree of maturity: the straws of different treatment groups are fermented for 3 days and aged for 10 days, the hand feeling of the straws of a control group (natural fermentation) is hard and has no obvious change, the color of the fermented material of the experiment group added with the Beijia organic fertilizer fermentation fungicide is dark, the hand feeling is slightly soft, and slight sour taste can be heard, after the straws are treated by adding the microbial fermentation fungicide, the color of the straws is changed into black brown, the hand feeling is soft and elastic, the straws are easy to be held into powder and have fragrance but no odor, which indicates that the straws of the experiment group are fully fermented, and the microbial fermentation fungicide prepared by the invention can accelerate the fermentation of the straws under the same condition.
Because the components in the straws of different gramineous crops are relatively close, the research tries to make the microbial inoculum act on the fermentation process of other straws such as corn straws and rice straws, and the fermentation and decomposition degrees are compared under the same fermentation condition, so that the fermentation and decomposition degrees of different straws are accelerated to a certain degree.
3. Determination of nutrient content and enzyme activity in compost
1) The determination method of the nutrient components comprises the following steps:
the crude protein is determined by adopting a method for determining the crude protein in the feed of GB/T6432-1994 of the national standard method of the people's republic of China.
The crude fiber is measured by adopting a method for measuring the crude fiber in the feed by the national standard method GB/T6434-2006 of the people's republic of China.
The crude fat is measured by adopting a method for measuring the crude fat in the feed by the national standard method GB/T6433-2006 of the people's republic of China.
The measurement of the crude ash is carried out by adopting a method for measuring the crude ash in the feed of the national standard method GB/T6438-2007 of the people's republic of China.
The determination of the calcium content is carried out by adopting a method for determining the calcium content in the feed of the national standard method GB/T6436-2002 of the people's republic of China.
The determination of the phosphorus content is carried out by adopting a method for determining the phosphorus content in the feed of the national standard method GB/T6437-2002 of the people's republic of China.
2) Method for measuring enzyme activity:
5.0g of compost is weighed from each treatment group, 3 compost are arranged in parallel, 50mL of phosphate buffer is added, centrifugation is carried out at 5000rpm for 30min, and the supernatant is the liquid to be detected.
The determination of the alpha-amylase activity is carried out by adopting a method for determining the alpha-amylase activity in the feed of the national standard method GB/T6437-2002 of the people's republic of China.
The determination of the protease activity is carried out by adopting a method for determining the protease activity in the feed of the national standard method GB/T6437-2002 of the people's republic of China.
The determination of the cellulase activity is carried out by adopting a method for determining the cellulase activity in the feed of the national standard method GB/T6437-2002 of the people's republic of China.
FIG. 2 is a statistical graph of the comparison data of the nutrient content and the enzyme activity in the fermented compost of the three treatment groups, and it can be seen that the difference of the nutrient content is large under different treatments. Compared with the treatment of a control group and the treatment of adding a conventional straw fermentation inoculant in the market, the treatment of adding the microbial fermentation inoculant has the advantages that the content of crude protein, crude fat, calcium and phosphorus is obviously increased, and the content of crude fiber and crude ash is obviously reduced. For the enzyme activity, the activity bacteria of alpha-amylase, protease and cellulase related to straw fermentation are obviously improved, which is consistent with the comparison result of the rotten degrees of the three treatment groups observed in the step 2, and the microbial fermentation inoculum disclosed by the invention can be used for accelerating the straw fermentation speed.
4. Quantitative determination of fusarium graminearum in compost and detection of DON toxin
1) Quantitative determination of fusarium graminearum
Fusarium graminearum detection specific primers: fg16F: CTCCGGATATGTTGCGTCAA; fg16R: GGTAGGTATCCGACATGGCAA. And (3) preparing a standard curve by utilizing fluorescent quantitative PCR (polymerase chain reaction), namely the relation between the lg number of the copy number of the fusarium graminearum standard substance and the cycle number Ct when the threshold value is reached. Instant powerful plant DNA extraction kit (
DNA Isolation Kit, MOBIO) to extract the straw sample DNA after fermentation and decomposition, and quantitatively detecting fusarium graminearum by comparing with the Ct value in the standard curve:
the reaction system (20. mu.L) is shown below:
the program settings for fluorescent quantitative PCR were as follows:
FIG. 3 is a specific verification map of the fusarium graminearum detection primer, namely a fluorescence quantitative PCR dissolution curve, and it can be seen from the map that the dissolution curves obtained many times have only one characteristic peak, which indicates that the primer has good specificity, and fusarium graminearum can be quantitatively detected by the fluorescence quantitative PCR technology, and the result is reliable.
2) Detection method of DON toxin
25g of the sample is weighed into a stirring cup, 5g of polyethylene glycol (PEG 8000) and 100mL of pure water are added, a cup cover is covered, and the mixture is stirred at a high speed for 2 min. The cap was removed and the extract poured onto fluted filter paper and the filtrate collected in a 100mL beaker and filtered through Whatman microfiber filter paper. 5mL of the extract was taken, and the pressure was controlled so that the sample solution was passed through the Don-test immunoaffinity column at a flow rate of 1 drop/s. The affinity column was rinsed with 10mL of pure water at a flow rate of 2 drops/s, and all the effluent was discarded. 1.0mL of methanol was added accurately, and the mixture was eluted at a flow rate of 1 drop/s, and the whole amount of the eluate was collected in a glass tube. 20 μ L of the purified solution was analyzed by HPLC. And (4) carrying out qualitative determination according to peak retention time and quantitative determination according to a peak area external standard method.
Detection conditions of high performance liquid chromatography: chromatographic column Symmetry C18Column, 4.6mm × 150mm, particle size 5 μm, column temperature 40 deg.C, mobile phase acetonitrile, water (16:84, v/v), flow rate 0.8mL/min, sample size 20 μ L, ultraviolet detector wavelength 218 nm.
The comparison results of the quantity of fusarium graminearum and the content of the DON toxins in the three treatment groups are shown in fig. 4, the HPLC detection spectra of the DON toxins in the composts of the three treatment groups are shown in fig. 5A, 5B and 5C, and it can be seen from fig. 4, 5A, 5B and 5C that the quantity of fusarium graminearum and the content of the DON toxins in the straws treated by adding the microbial fermentation inoculum prepared by the invention are significantly lower than those of the other two treatment groups, which shows that the microbial fermentation inoculum prepared by the invention has a strong prevention and control effect on fusarium graminearum and has a unique advantage in the treatment problem of diseased straws.
The foregoing illustrates and describes the principles, general features, and advantages of the present invention. However, the above description is only an example of the present invention, the technical features of the present invention are not limited thereto, and any other embodiments that can be obtained by those skilled in the art without departing from the technical solution of the present invention should be covered by the claims of the present invention.
Claims (6)
1. A preparation method of a microbial fermentation inoculant for accelerating fermentation of wheat straws is characterized by comprising the following specific preparation steps:
s1 pretreatment of straw raw materials: taking straws infected by wheat scab, crushing the straws into powder, and naturally drying the straws for later use;
separation of S2 microbial flora: filling 100mL of sterile inorganic salt culture medium into a triangular flask with the specification of 250mL, adding straws into the triangular flask according to the amount of 5% of the liquid volume, carrying out primary culture in a shaking table at 30 ℃, transferring flora suspension into a fresh 100mL of sterile inorganic salt culture medium according to the amount of 10% of the liquid volume, continuing to culture for 48h, and carrying out subculture for 5 times according to the method to obtain microbial flora;
s3 preparation of fermentation liquor: placing 400L inorganic salt culture medium in 500L fermentation tank, sterilizing at 121 deg.C and 0.1MPa for 30min, and cooling to room temperature;
expanding culture of S4 flora: adding the treated straw into a fermentation tank according to the amount of 5% of the liquid volume, adding the microbial flora seed solution for subculture for 5 generations into the fermentation tank according to the amount of 10% of the liquid volume, and culturing for 60-72h under set fermentation conditions to obtain a bacterial suspension of the microbial fermentation agent.
2. The method for preparing a microbial fermentation inoculant for accelerating the fermentation of wheat straw as claimed in claim 1, wherein the rotation speed of the shaking table during the primary culture in step S2 is 160-180rpm, and the culture time is 45-55 h.
3. The method for preparing a microbial fermentation inoculant for accelerating the fermentation of wheat straw as claimed in claim 1, wherein the fermentation conditions in step S4 are that the culture temperature is 30-35 ℃, the stirring speed is 200-220rpm, and the ventilation rate is 1: 0.4.
4. The method for preparing a microbial fermentation inoculant for accelerating fermentation of wheat straw as claimed in claim 1, wherein the number of effective viable bacteria in the bacterial suspension obtained in step S4 is 5 × 108one/mL.
5. The method of claim 1, wherein the microbial flora obtained in step S2 mainly comprises two major groups of bacteria and actinomycetes, and the identified bacterial groups of the genus further comprise bacillus, pseudomonas, pantoea, bifidobacterium, acetobacter, lactobacillus, stenotrophomonas, klebsiella, citrobacter, and flavobacterium.
6. A microbial fermentation inoculant for accelerating fermentation of wheat straws is characterized in that the microbial inoculant is obtained by carrying out amplification culture on a microbial flora separated from infected straws, wherein the microbial flora mainly comprises two major components of bacteria and actinomycetes, and the identified bacterial components of the wheat straws also comprise bacillus, pseudomonas, pantoea, bifidobacterium, acetobacter, lactobacillus, stenotrophomonas, klebsiella, citrobacter and flavobacterium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010323193.XA CN111548953A (en) | 2020-04-22 | 2020-04-22 | Microbial fermentation inoculant for accelerating fermentation of wheat straws and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010323193.XA CN111548953A (en) | 2020-04-22 | 2020-04-22 | Microbial fermentation inoculant for accelerating fermentation of wheat straws and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111548953A true CN111548953A (en) | 2020-08-18 |
Family
ID=72001144
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010323193.XA Withdrawn CN111548953A (en) | 2020-04-22 | 2020-04-22 | Microbial fermentation inoculant for accelerating fermentation of wheat straws and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111548953A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113789405A (en) * | 2021-09-15 | 2021-12-14 | 中国科学院南京土壤研究所 | Method for detecting content of gibberella zeae in soil based on real-time fluorescent quantitative PCR |
-
2020
- 2020-04-22 CN CN202010323193.XA patent/CN111548953A/en not_active Withdrawn
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113789405A (en) * | 2021-09-15 | 2021-12-14 | 中国科学院南京土壤研究所 | Method for detecting content of gibberella zeae in soil based on real-time fluorescent quantitative PCR |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103113167B (en) | Compound microbial organic fertilizer and preparation method thereof | |
| KR101039176B1 (en) | Antagonistic bacteria for preventing and eliminating the bacterial wilt of continuous cropping tobacco and their microbial organic fertilizer | |
| CN102976801B (en) | Method for producing functional microorganism organic fertilizer by using food residue | |
| CN105567612B (en) | A kind of degradation composite bacteria agent preparation of garden waste and application | |
| CN103555624B (en) | One strain fixed nitrogen Bacillus licheniformis and uses thereof | |
| CN104911129B (en) | The Bacillus amyloliquefaciens strain and its microbial organic fertilizer of control of plant bacterial wilt | |
| CN103484396B (en) | New strain of streptomyces thermocarboxydus and application thereof | |
| CN111793498A (en) | Microbial agent and preparation method and application thereof | |
| CN105964680B (en) | A kind of beach saline land continuous cropping cotton soil ecology renovation agent and the preparation method and application thereof | |
| CN105936881A (en) | Bacillus saccharophila used for degrading alginic acid, and application method thereof | |
| CN108552235A (en) | A kind of bio-bacterial manure and its preparation and application for preventing flue-cured tobacco root rot and improveing soil | |
| CN113980836A (en) | Bacillus belgii and application thereof in prevention and treatment of strawberry root rot | |
| CN113817615A (en) | Composite biocontrol microbial inoculum produced by fermenting Shuanghuanglian decoction dregs and application thereof | |
| CN116396888A (en) | Microbial composite microbial agent suitable for livestock and poultry manure and straw fermentation and preparation method thereof | |
| CN109868242B (en) | Salt-tolerant acetoin-producing bacillus subtilis and application thereof | |
| CN107628894A (en) | Composite bacteria agent increase soil fertility and its preparation method and application | |
| CN102827792B (en) | Plant growth-promoting rhizobacterium SXH-3 and application thereof | |
| CN111254082B (en) | Salt-tolerant termite-inhabiting bacterium and application thereof in production of seaweed liquid fertilizer | |
| CN111548953A (en) | Microbial fermentation inoculant for accelerating fermentation of wheat straws and preparation method thereof | |
| CN111484368A (en) | Solid fermentation production method of microbial fertilizer and solid composite microbial fertilizer | |
| CN104560815B (en) | Bacillus licheniformis with azo compound degradation activity and application thereof | |
| CN113481111B (en) | Efficient biological straw fermentation inoculant and preparation method thereof | |
| CN113322217B (en) | Vibrio freundii and application thereof in preparation of multifunctional small-tank fertilizer | |
| CN111575194B (en) | Mixed bacteria for degrading straw and application thereof | |
| CN110438026B (en) | Bacillus amyloliquefaciens GLD-191 and microbial inoculum, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20200818 |
|
| WW01 | Invention patent application withdrawn after publication |