CN102827792B - Plant growth-promoting rhizobacterium SXH-3 and application thereof - Google Patents
Plant growth-promoting rhizobacterium SXH-3 and application thereof Download PDFInfo
- Publication number
- CN102827792B CN102827792B CN201210284747.5A CN201210284747A CN102827792B CN 102827792 B CN102827792 B CN 102827792B CN 201210284747 A CN201210284747 A CN 201210284747A CN 102827792 B CN102827792 B CN 102827792B
- Authority
- CN
- China
- Prior art keywords
- sxh
- klebsiella oxytoca
- plant
- promoting
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses a plant growth-promoting rhizobacterium SXH-3. The plant growth-promoting rhizobacterium is classified and named as Klebsiella oxytoca SXH-3 and is preserved in China General Microbiological Culture Collection Center (CGMCC) with an accession number of CGMCC No. 6298. The Klebsiella oxytoca SXH-3 can synthesize heteroauxin and Siderophore and has an effect on dissolving phosphorus, so the Klebsiella oxytoca SXH-3 can provide plants with heteroauxin and Siderophore and promote absorption of phosphorus by the plants, thereby promoting growth of the plants. The Klebsiella oxytoca SXH-3 has a substantial promotion effect on plant height, fresh weight and dry weight of leek.
Description
Technical field
The invention belongs to plant growth-promoting bacteria technical field, relate to a kind of plant growth-promoting rhizobacteria SXH-3 and application thereof.
Background technology
Leek (Allium tuberosum Rottl.ex Spr.) is the perennial root plant of Liliaceae allium (Allium tuberosum), originates in China, and all there is cultivation domestic various places.Leek rich vitamin and various mineral substance, and there is special aromatising flavour because containing multiple thioether, can improve a poor appetite, and have certain pharmaceutical use.Its seed and leaf etc. can be used as medicine.Tool stomach invigorating, refresh oneself, the effect such as hidroschesis is astringent or styptic treatment for spontaneous sweating, tonify the kidney and support yang, controlling nocturnal emission with astringent drugs.In the traditional Chinese medical science, leek has very loud being named as " Folium Allii tuberosi ", and somebody calls leek " intestinal lavage grass ", and moreover, leek also has a lot of names.Leek is also careless clock breast, Folium Allii tuberosi, houseleek, claims again flat dish.Because its mouthfeel is good, so delicious flavour is subject to everybody liking, especially before the Spring Festival, enjoys and pursue especially, so be a kind of economic plants.
But plantation leek need to be used a large amount of chemical fertilizer, and this has not only affected the quality of leek, has also destroyed edatope, and along with a large amount of uses of chemical fertilizer, the continuous reduction of its utilization ratio has been well known fact.This explanation, it is limited only depending on a large amount of application fertilizers to improve leek output.For this reason various countries scientist making great efforts always explore improve chemical fertilizer utilization ratio reach balance fertilizing, the rational application of fertilizer to overcome the approach of its drawback.Microbial fertilizer has original effect in solution this respect problem.So, according to China's crop species and edaphic condition, adopt microbial fertilizer and chemical fertilizer compounding application, can guarantee volume increase, reduced again fertilizer application amount, reduce costs, can also improve soil and crop quality simultaneously, reduce and pollute.
Microbial fertilizer refers to the particular product that a class contains live microorganism, is applied in agriculture production, can obtain specific fertilizer effect.In the production process of this effect, in goods, live microorganism plays a crucial role.Generally microorganism fertilizer material products is divided at present to two large classes: a class is the microbial fertilizer of narrow sense, finger is by the vital movement of microorganism, increased the supply of plant nutrient, comprise the total supply of plant nutrient in soil and production environment, cause the improvement of plant nutrition situation, and then output increase, the Representative Cultivars of this quasi-microorganism fertilizer is rhizobia fertilizer; Another kind of is the microbial fertilizer of broad sense, refer to by the vital movement of microorganism wherein, not only can improve the supply of plant nutrient, can also produce plant growth hormones, promote the pathogenic effects that absorbs or have some pathogenic micro-organism of antagonism of Plant To Nutrient element, alleviate diseases and pests of agronomic crop and promote the increase of crop yield.There is following characteristics compared with chemical fertilizer: not spoiled soil structure, protection ecology, free from environmental pollution, nontoxic to people, animal and plant; Fertilizer efficiency is lasting; Improve crop yield and improve crop product quality; With low cost.
In recent years, about the research of plant rhizosphere growth-promoting bacterium (PGPR), day by day receive people's concern.Because chemical fertilizer, agricultural chemicals cause severe contamination to environment, fertilizer price is surging, energy scarcity, and the states such as Australia, the U.S., European Community's tissue and Japan, have all carried out the special item of PGPR.Within 1988～1997 years, in Canada, Switzerland, Australia and Japan, held international symposium four times respectively, and one of continuation 3 years has been held in different continents in turn.Show that PGPR research and application have become one of new focus of current agriculture microbe research, the aspect relevant with it forming a new field.As the PGPR of microbial fertilizer can be directly for host plant provides nutrition or indirectly for the growth of host plant root provides positive effect, or help host plant and other symbiote to form useful symbiotic relationship.
Summary of the invention
The problem that the present invention solves is to provide a kind of plant growth-promoting rhizobacteria SXH-3 and application thereof, and this bacterium is a kind of new plant growth-promoting bacteria, can be applicable to the preparation of plant growth-promoting agent or microbial fertilizer.
The present invention is achieved through the following technical solutions:
A kind of plant growth-promoting rhizobacteria SXH-3, its Classification And Nomenclature is Klebsiella oxytoca SXH-3(Klebsiella oxytoca), being preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), preserving number is CGMCC No.6298
This bacterium can be synthesized acc deaminase in born of the same parents, under aerobic condition, ACC is grown as only nitrogen source, simultaneously by its decomposition.
Further, also there is following characteristics:
This bacterium can synthesis of indole acetic acid.
This bacterium can be synthesized and had a liking for iron element.
This bacterium has molten phosphorus.
Described plant growth-promoting rhizobacteria SXH-3 is in the application of promoting growth of plants.Concrete comprises:
Describedly preparing the application of preparation of promoting growth of plants.
Described preparation is one or more in the synthetic preparation of the preparation that suppresses ACC generation, short indolylacetic acid, the short preparation of having a liking for the synthetic preparation of iron element, short phosphorus absorption.
The application of the preparation of growing in the short leek of preparation.
Described preparation is microbiobacterial agent or microbial fertilizer.
Compared with prior art, the present invention has following useful technique effect:
Klebsiella oxytoca SXH-3 provided by the invention, as the substratum in unique N source, the microorganism from the Rhizosphere Soil of leek to be carried out to screening and separating using ACC, the microorganism that can grow using ACC as unique N source obtaining, detected result shows that this bacterium is a kind of new Klebsiella oxytoca that can synthesize acc deaminase, and Classification And Nomenclature is Klebsiella oxytoca.
Klebsiella oxytoca SXH-3 provided by the invention, due to its synthetic acc deaminase, allly can suppress the synthetic of ACC in plant materials, and then reduce because environment-stress causes a large amount of accumulation of ethene in plant materials, thereby improve its resistance.
Klebsiella oxytoca SXH-3 provided by the invention, can also synthesis of indole acetic acid and have a liking for iron element, but also have molten phosphorus effect, thereby can help plant that indolylacetic acid and ferro element are provided, and promotes the absorption of phosphorus, thereby play the effect of promoting growth of plants.Therefore, although this bacterium be from leek foundation soil institute's screening and separating to, the general character of the promoting growth of plants having due to above-mentioned effect, thus this bacterium can also as one widely growth-promoting bacterium be applied in the middle of other plant.
Klebsiella oxytoca SXH-3 provided by the invention, has significant promoter action to the plant height of leek.The leek of processing through Klebsiella oxytoca (Klebsiella oxytoca) SXH-3, in the time of 14 days, compared with the control, plant height increases by 73.18%.
Plant fresh weight and the dry weight of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 viable bacteria to leek, there is significant promoter action.The leek of processing through Klebsiella oxytoca (Klebsiella oxytoca) SXH-3, compared with the control, plant fresh weight increases by 230.26%, and dry weight increases by 179.13%.
Preservation explanation
Klebsiella oxytoca of the present invention (Klebsiella oxytoca) SXH-3 has carried out following preservation:
The preservation time: on June 26th, 2012, preservation place: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica; Depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center, CGMCC; Preserving number is CGMCC NO.6298.
Accompanying drawing explanation
Fig. 1 is the upgrowth situation of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 on ADF substratum.
Fig. 2 is the synthetic tethelin content of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3.
Fig. 3 is the picture that Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 has a liking for iron element circle.
Fig. 4 is the picture of the molten phosphorus circle of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3.
Plant height when Fig. 5 is Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 to leek growth-promoting 14 days.
When Fig. 6 is Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 to leek growth-promoting 14 days, fresh weight (10 strain) relatively.
When Fig. 7 is Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 to leek growth-promoting 14 days, dry weight (10 strain) relatively.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in further detail, and the explanation of the invention is not limited.
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Separation and the evaluation of embodiment 1, Klebsiella oxytoca (Klebsiella oxytoca) SXH-3
1, the separation of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3
The separation of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 comprises sampling, screening and two steps of purifying, and concrete grammar is as follows:
1.1, sampling
From the Rhizosphere Soil of leek, screen, concrete for examination leek and soil, be taken at twin-well town, Hulan District, Harbin, Heilongjiang Province (soil physico-chemical property is as follows: pH 8.15, total salt content 1.83%, alkali-hydrolyzable nitrogen 36mg/kg, available phosphorus 8mg/kg, quick-acting 132mg/kg, organic 2.69%).Leek and plant rhizosphere soil are packed in the clean freshness protection package of previously prepd, take back laboratory plantation to be measured.
Take 1g Rhizosphere sampling in containing the triangular flask of 50mL PAF nutrient solution, room temperature (21 1 ℃ of scholar) shaking culture (200r/min) 24h.Then, shift lmL bacteria suspension to another 50mL PAF nutrient solution, under equal conditions, cultivate 24h.The 3rd day, from PAF nutrient solution, shift 1mL bacteria suspension to 50mL DF nutrient solution, under the same terms, cultivate 24h.The 4th day, then shift 1mL bacteria suspension to 50mL ADF nutrient solution, under the same terms, cultivate 48h, for the separation and purification containing acc deaminase activated bacterial.
1.2, screening and purifying
(1) get 1g Rhizosphere sampling in 50mL PAF substratum, 28 ℃ of shaking culture 24 hours.In this PAF substratum.PAF substratum contains peptone 10g, casein hydrolysate 10g, MgSO
41.5g, K
2hPO
41.5g, glycerine 10ml, (1L measures PH=7.5) is specifically with reference to Penrose D M, Glick B R.Methods for isolating and characterizing ACC deaminase-containing plant growth-promoting rhizobacteria[J] .Physiologia Plantarum, 2003,118 (1): 10-15 prepares.
(2) get the PAF nutrient solution (suspension) after 1mL above-mentioned (1) concussion, in 50mL PAF substratum, 28 ℃ of shaking culture 24 hours.
(3) get the PAF nutrient solution that 1mL above-mentioned (2) obtains, in 50mL DF salt nutrient solution, 28 ℃ of shaking culture 24 hours.This DF salt nutrient solution contains KH
2pO
44g, Na
2hPO
46g, MgSO
47H
2o 0.2g, FeSO
47H
2o 1mg, glucose 2g, gluconic acid 2g, citric acid 2g, (NH
4)
2sO
42g, (100ml measures H to micro-0.1ml
3bO
310mg, MnSO
411.2mg, ZnSO
4124.6mg, CuSO
478.2mg, MoO
310mg).
(4) get the DF salt nutrient solution that 1mL above-mentioned (3) obtains, in 50mL, do not contain (NH
4)
2sO
4, but in the DF salt nutrient solution that contains 3mM 1-amino-cyclopropane-1-carboxylic acid (ACC) (using ACC as unique N source), 28 ℃ of shaking culture 24 hours.
(5) get the nutrient solution that 1mL above-mentioned (4) obtains, coat on the ADF salt nutrient agar containing 3mM ACC 28 ℃ of cultivations; 48 hours grow bacterium colony.
(6) get the bacterium colony of growing on above-mentioned (5) substratum, the purifying of ruling on ADF substratum, obtains single bacterium colony.
Like this through substratum using ACC as unique N source to utilizing its bacterium as the growth of N source to screen in Rhizosphere Soil, thereby obtained single bacterium colony (pure growth).
2, the evaluation of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3
The pure culture bacterial strain that above-mentioned separation and purification is obtained carries out a series of Physiology and biochemistry evaluations, and carries out DNA extraction, the amplification of 16S rDNA and order-checking.
That 2.1 these bacterial strains form on ADF substratum is circular, translucent, oyster white, projection are smooth, neat in edge, sticking bacterium colony, as shown in Figure 1.Microscopy shows atrichia, has pod membrane, belongs to Gram-negative bacteria.
Other detections are as follows:
Plus sige represents the positive, and minus sign represents feminine gender; Positive expression exists, and negative expression do not exist.
2.2 utilize primers F 8 and the R1541 16S rDNA that increases, and primer sequence is as follows:
F8/20：5′AGAGTTTGATCCTGGCTCAG3′，
R1541/20：5′AAGGAGGTGATCCAGCCGCA3。
Pcr amplification condition is: 94 ℃ of 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 90s, 30 circulations; 72 ℃ of 10min.
Pcr amplification product is checked order, and sequencing result is as shown in SEQ.ID.NO.1.
By strain called after Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 in the pure culture bacterial strain of above-mentioned acquisition, and by its preservation, preserving number is CGMCC No.6298.
The acc deaminase determination of activity of embodiment 2, CGMCC No.6298
Strains tested is incubated overnight in TSB nutrient solution (Tryptones 17.0g, soya peptone 3.0g, NaCl 5.0g, glucose 2.5g, K2HPO42.5g, distilled water 1000mL, pH 7.5), 4 ℃ of centrifugal collection thalline.DF nutrient solution washing three times for somatic cells, Eddy diffusion is in ADF nutrient solution, and room temperature (21 1 ℃ of scholar) shaking culture is after 2 days, and 4 ℃ of centrifugal collection thalline, use 0.1molL
-1tris-HCl damping fluid (pH=7.6) washs centrifugal three times, is resuspended to 600 μ L 0.1molL
-1in Tris-HCl damping fluid (pH=8.0), add 30 μ L toluene rapid vibration 30s with smudge cells, transferase 12 00 μ L contains the cell extract of toluene to 1.5mL centrifuge tube, adds 20 μ L 0.5molL
-1aCC mixes, and does the blank test of not adding ACC simultaneously, cultivates 15min for 30 ℃.Add 1mL 0.56molL
-1hCl, the centrifugal 5min of 16000g, gets 1mL suspension to test tube, adds 800 μ L 0.56molL
-1hCl and 300 μ L 2,4 dinitrophenyl hydrazines, hatch 30min for 30 ℃, adds 2mL 2molL
-1naOH, 540nm wavelength is surveyed absorbancy.Take 1mL concentration as 0,0.1,0.3,0.7,1 and 2 μ molL
-1α-batanone acid be reference liquid, survey light absorption value under 540nm wavelength.
Protein determination adopts BioRad protein microdetermination method, (Pr) standard take bovine serum albumin as protein.The activity of acc deaminase is to show at the scale of surveying every milligram of albumen formation per hour α-batanone acid in enzyme system, and unit is μ mol α-KA (mgPrh)
-1.Blank rear calculating of sample contrast all deducted in enzyme assay, repeats 3 times.
Adopt α-batanone acid standard substance to replace above cell extract to carry out identical experiment the production standard curve of experimental group of step 4, typical curve equation (equation first) is as follows: y=192x-1.7864, R
2=0.9713, x represents OD
540nmnumerical value, y represents a-batanone acid (μ mol/L).
According to production standard curve and detected result, can obtain the activity of acc deaminase activity.Detected result shows to have acc deaminase activity in the cytoclasis thing of CGMCC NO.6298, and enzymic activity reaches as high as 0.198 μ mol α-KA (mg Prh)
-1, this shows that CGMCC NO.6289 can synthesize acc deaminase in born of the same parents.
ACC is the synthetic precursor of ethene, and the too much existence of ethene can suppress the growth of plant, and the existence of acc deaminase can reduce the existence of ACC, thereby reduces the generation of ethene, near and Promoting plant growth.
The mensuration of the synthetic content of embodiment 3, CGMCC NO.6298 tethelin IAA
Strains tested Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 first cultivates 2d in DF nutrient solution, then trace proceeds to the DF nutrient solution that adds different concns tryptophane (L-Trp) (containing 0,50,100,200 and 500 μ g L-TrpmL
-1) the middle cultivation 2d that continues, bacterium liquid OD is surveyed in sampling
600, under all the other nutrient solution room temperatures, 8000g is centrifugal, gets 500 μ L supernatant liquors, adds 2mL Salkowski reagent (containing 150mL H
2sO
4, 250mL ddH
2o and 7.5mL 0.5mol/L FeC1
3), after room temperature dark culturing 20min, at 535nm place, survey absorbancy (OD
535).Aseptic culture medium is the same to be done identical processing and returns to zero in contrast.Take concentration as 0,0.01,0.05,0.25,0.5mgmL
-1iAA reference liquid with method, do typical curve.IAA content unit is μ g (mLOD
600)
-1, parallel 2 times of IAA typical curve, sample repeats 3 times.Typical curve equation is as follows: y=0.0784x-0.0139, R
2=0.9792, x represents OD
535nmnumerical value, y represents IAA concentration (μ gmL
-1).
According to production standard curve and detected result, can obtain the IAA resultant quantity of CGMCC NO.6298; And detected result also shows, Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 can utilize tryptophane to produce indolylacetic acid, and along with the difference of L-Trp concentration, the indolylacetic acid resultant quantity of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 also increases thereupon, as shown in Figure 2, the IAA resultant quantity of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 is 500 μ gmL in L-Trp concentration
-1in scope, be directly proportional to the increase of L-Trp.
CGMCC NO.6298 is synthetic plant growth hormones indolylacetic acid (IAA) take tryptophane (L-Trp) as precursor, because it is adsorbed on the surface of seed and root, thereby utilized by plant, simultaneously also can with IAA acting in conjunction stimulating plant Growth of Cells and the propagation of plant endogenesis, can promote growing and effectively absorbing moisture and the nutrient in soil of root system of plant, other vital movements of plant be regulated simultaneously.
The iron element resultant quantity of having a liking for of embodiment 4, CGMCC NO.6298 is measured
The preparation of chrome azurol CAS (chrome azurol S) substratum
A: blue dye liquor
A.0.06gCAS be dissolved in 50ml deionized water.B.0.0027g FeCl6H
2o is dissolved in 10ml, and (36% dense HCl concentration is 11.6mol/L to 10mMHCl, and joining 10ml 10mM needs dense HCl 8.6 μ l) to use deionized water.C.0.073g HDTMA (CTAB) is dissolved in 40ml deionized water.A mixes with 9ml b, and remix c is now blue, high-temperature sterilization, (121 ℃ of 20min)
B: mixed solution
A MM915g KH
2pO
4, 25g NaCl, 50g NH
4cl is dissolved in 500ml deionized water (0.6gKH
2pO
41gNaCl, 2g NH4Cl, is dissolved in 20ml deionized water), b.20% glucose solution, 110 ℃ of independent sterilizings, 20g is dissolved in 100ml deionized water, c.NaOH solution, and 25g NaOH is dissolved in 150ml deionized water, PH is about 12, (5g NaOH is dissolved in 30ml) d. casein hydrolysate solution membrane filtration.3g casein hydrolysate is dissolved in 27ml deionized water, c.CAS agar plate is prepared (1L amount) and is a.100mlMM9 added to 750ml deionized water, b. dissolve 32.24g piperazine-N, N '-bis (2-ethanesulfonic acid) PIPES (6.448g PIPES).C. add Bacto-agar 15g.D. high-temperature sterilization (121 ℃, 20min), is cooled to 50 ℃.E. add the caseinhydrolysate of 30ml filtration sterilization, the glucose solution of 10ml 20% is (6ml+2ml) in MM9/PIPES mixed solution.F. slowly add 100ml (blue dye liquor, adds along vial wall, fully mixes).G. a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices.The bacterium that separates preservation is connected on chrome azurol CAS (chrome azurol S) substratum, cultivates 48～72h for 28 ℃, observe the colour-change of periphery of bacterial colonies, and the diameter of the saffron transparent haloing producing.
It is had a liking for to the synthetic qualitative experiment of iron element.Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 is connected to chromium alcohol CAS(chrome difficult to understand azurol S) on solid medium, cultivate 48h for 28 ℃, observe the colour-change of periphery of bacterial colonies, there is orange chromosphere to produce to produce and have a liking for iron element.
Result shows, on CAS solid medium, CGMCC NO.6298 periphery of bacterial colonies has safran haloing to produce, and Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 can produce and have a liking for iron element.As shown in Figure 3, its diameter ratio is (D/d) 1.508 to result.
CAS detects the preparation of liquid
1. 10mM HDTMA(CTAB) 50ml:0.182g is dissolved in 50ml deionized water.2. the dense HCl of 10mM HCl20ml:17.2ul is fixed molten to 20ml 1mM FeCl6H
2o 20ml:0.0054g is dissolved in 20ml10mM HCl, obtains Fe
3+solution.3. 2mM CAS 50ml:0.0605g is dissolved in 50ml deionized water.4. 3. 2. 1.5ml mix with 7.5ml, more 1. mix with 6ml, obtains mixed solution 4..5. for 4.307gPIPES, deionized water (about 20-30ml) is molten, adds the dense HCl of 6.25ml, adjusts PH5.6 (adjusting with NaOH).Will be 4. with 5. mixes, molten 100ml calmly.
The bacterium liquid of CGMCC NO.6298 is centrifugal with 50ml centrifuge tube, 10000rpm/min, 10min, 28 ℃.Get supernatant 3ml+CAS and detect 3ml.Reaction 1h, volume 1:1.OD630 surveys light absorption value, and sample value is A.Inoculation medium 3ml+CAS does not detect liquid 3ml.Reaction 1h.OD
630for Ar.A/Ar value is less, illustrates that synthetic to have a liking for iron element ability stronger, the strongest lower than 0.5.Result shows, the A/Ar value of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 is 1.894, illustrates that it can synthesize to have a liking for iron element.
Have a liking for iron element and be microorganism and part crop produce under low iron stressed condition a kind of can high-level efficiency in conjunction with the low molecular weight organic compound of ferric ion.The ability power of having a liking for iron element can affect the absorption of plant to ferric ion.Like this CGMCC NO.6298 can by produce and secrete iron is had to a high-affinity have a liking for iron element, dissolve also in conjunction with the ferro element in soil for vegetable cell utilization, increase iron nutrition, Promoting plant growth.
The molten phosphorus of embodiment 5, CGMCC NO.6298 is measured
Molten phosphorus circle: bacterial strain point is connected on NBRIP solid medium with sterilized toothpick, cultivates 3-5 days, measure molten phosphorus loop diameter (D) and colony diameter (d) for 30 ℃.
NBRIP solid medium 1L measures manner of formulation: glucose 10g, Ca
3(PO
4)
25g, MgCl
25g, MgSO
47H
2o 0.25g, KCl 0.2g, (NH4)
2sO
40.1g, agar 15g, PH=7.0110 ℃ of sterilizing.As shown in Figure 4, the D/d value of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 is 1.958 to detected result.
Amount of phosphorus dissolved: the bacterial strain of the molten phosphorus of tool is inoculated in NBRIP liquid nutrient medium to 30 ℃ of shaking culture (170r/min) 7 days by 1% inoculum size.Fermented liquid is through the centrifugal 10min of 10000r/min, and supernatant phosphorus content is measured with molybdenum antimony resistance colorimetric method.Manner of formulation: 1) put 35ml and cultivate based in 200ml triangular flask, sterilizing, shakes 5 days.2) after centrifugal, get supernatant.3) by the available phosphorus amount in colorimetric method for determining filtrate.(a) get filtrate 5-10ml(depending on phosphorus content in filtrate), be placed in 50ml measuring bottle, add the anti-mixing developer of 7.5N molybdenum trisulfate antimony 5ml, add deionized water and be settled to scale, fully shake up standing 30min.(b) after 30min at spectrophotometer colorimetric (wavelength 660nm), during colorimetric, must do blank determination simultaneously.(c) meanwhile draw phosphorus typical curve, draw respectively 5ppm phosphoric acid standardized solution 0ml, 1ml, 2ml, 3ml, 4ml, 5ml in 50ml volumetric flask, the concentration of each measuring bottle phosphorus is 0,0.1,0.2,0.3,0.4,0.5ppm, the individual 7.5N molybdenum trisulfate antimony that adds is anti-again, mix developer 5ml, then carry out colorimetric the same as liquid to be measured.Drawing standard curve.(d) result is calculated pmg/100g phosphorus source=(ppm × colorimetric volume × point get multiple)/(adding phosphorus compound grams × 10 in substratum), result shows, the molten phosphorus value of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 is 4.481, and molten phosphorus ability is stronger.CGMCCNO.6298 will contribute to plant by the indissoluble phosphorus in soil, convert to be easy to the phosphorus of absorption like this, makes plant be easier to absorb.
Embodiment 6, the CGMCC NO.6298 growth-promoting effect to leek
Adopt respectively in two ways leek is carried out to Biological control, one is to adopt bacterium liquid to the leek experiment of soaking seed; Another kind of mode is that perennial leek is filled with to root experiment.One month by a definite date, water during this time bacterium liquid one time, observe the plant height of the leek of pouring bacterium liquid, fresh weight and on the ground the dry weight situation of growing of comparing with the leek of not watering bacterium liquid on the ground.
Soil for leek Biological control is taken at twin-well town, Hulan District, Harbin, Heilongjiang Province, and 5 sample prescriptions are set during collected specimens in each region, and sample area is 1 × 0.3m
2, collect topsoil (0 ~ 20cm), after mixing with soil, pack in the clean freshness protection package of previously prepd, rapidly soil sample is taken back to laboratory, soil, through pulverizing, mixes, the preservation of sieving after air-dry.
CGMCC NO.6298 is inoculated in TSB liquid nutrient medium, shaking culture at 28 ℃, 4 ℃ of centrifugal collection thalline, are resuspended in sterilized water after washing centrifugal 2 times with sterilized water, make the final concentration of viable count in sterilized water reach 10
9cFU/mL.Leek seed, with washing with sterilized water after 0.5% (V/V) clorox surface sterilization 10min, is then soaked to 1h with CGMCC NO.6298, make it be attached to seed-coat.With (CK) in contrast of the leek seed without CGMCC NO.6298 immersion treatment, evenly plant in basin, every basin 20 strains, repeat 5 times, in culturing room, (25 ℃) are cultivated, and water every other day, water CGMCC NO.6298 bacterium liquid (contrast is normally watered) after Yu Qitian, each 50ml, every pouring in 7 days once.In germinateing, within latter 14 days, measure plant high, after 14 days, measure 10 strain plant fresh weights and dry weight, root fresh weight and dry weight.Concrete detected result is as shown in table 1:
The growth-promoting effect of table 1CGMCC NO.6298 to leek
| Bacterium name | Fresh weight (g/10 strain) | Dry weight (g/10 strain) | Plant height (cm) |
| CGMCC NO.6298 | 5.450 | 0.614 | 16.767 |
| Blank | 13.097 | 1.343 | 23.697 |
Detected result shows, CGMCC NO.6298 viable bacteria has significant promoter action to the plant height of leek.The leek that mensuration is processed through CGMCC NO.6298, in the time of 14 days, compared with the control, plant height increases by 38.96%, and its statistics is as shown in Figure 5.
And, plant fresh weight and the dry weight of CGMCC NO.6298 viable bacteria to leek, there is significant promoter action.The leek that mensuration is processed through CGMCC NO.6298, compared with the control, plant fresh weight increases by 108.5%, and dry weight increases by 121.67%, and its statistics is as shown in Figure 6, Figure 7.
To sum up detect and show, its synthetic acc deaminase of CGMCC NO.6298, thus can suppress the synthetic of the interior ACC of plant materials, and then reduce because environment-stress causes a large amount of accumulation of ethene in plant materials, thereby improve its resistance; Especially can also synthesis of indole acetic acid and have a liking for iron element, thus can help plant that indolylacetic acid is provided and promote the absorption of iron, phosphoric, play the effect of promoting growth of plants.Therefore, the general character of the promoting growth of plants having due to above-mentioned effect, so although this bacterium from the Rhizosphere Soil of leek, separate, this bacterium can also as one widely growth-promoting bacterium be applied in the middle of Plant growth-promoting effect.
Concrete detected result shows that Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 can promote from many aspects the growth of plant, comparison and detection result shows that plant height, fresh weight and the dry weight of Klebsiella oxytoca (Klebsiella oxytoca) SXH-3 all have significant promoter action, can be applicable to the preparation of leek growth-promoting preparation or microbial fertilizer.
Claims (6)
1. a plant growth-promoting rhizobacteria SXH-3, is characterized in that, its Classification And Nomenclature is Klebsiella oxytoca SXH-3(Klebsiella oxytoca), be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, preserving number is CGMCC No.6298.
2. plant growth-promoting rhizobacteria SXH-3 claimed in claim 1 is in the application of promoting growth of plants.
3. application as claimed in claim 2, is characterized in that, is preparing the application of preparation of promoting growth of plants.
4. application as claimed in claim 3, is characterized in that, described preparation is one or more in the synthetic preparation of the preparation that suppresses ACC generation, short indolylacetic acid, the short preparation of having a liking for the synthetic preparation of iron element, short phosphorus absorption.
5. application as claimed in claim 2, is characterized in that, the application of the preparation of growing in the short leek of preparation.
6. application as claimed in claim 5, is characterized in that, described preparation is microbiobacterial agent or microbial fertilizer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210284747.5A CN102827792B (en) | 2012-08-10 | 2012-08-10 | Plant growth-promoting rhizobacterium SXH-3 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210284747.5A CN102827792B (en) | 2012-08-10 | 2012-08-10 | Plant growth-promoting rhizobacterium SXH-3 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102827792A CN102827792A (en) | 2012-12-19 |
| CN102827792B true CN102827792B (en) | 2014-04-16 |
Family
ID=47331106
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210284747.5A Expired - Fee Related CN102827792B (en) | 2012-08-10 | 2012-08-10 | Plant growth-promoting rhizobacterium SXH-3 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102827792B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104496574A (en) * | 2014-12-25 | 2015-04-08 | 贵州省草业研究所 | Novel soybean or leguminous forage rhizosphere biological-bacterial fertilizer as well as preparation method and application thereof |
| CN106399185A (en) * | 2016-10-18 | 2017-02-15 | 中国科学院天津工业生物技术研究所 | Pseudomonas sp. and application thereof |
| CN108587970B (en) * | 2018-05-07 | 2020-09-25 | 长治学院 | Klebsiella oxytoca and application thereof in promoting growth of codonopsis pilosula |
| CN110106123B (en) * | 2019-05-31 | 2021-09-24 | 河南农业大学 | Klebsiella strain Z3 and application thereof in reduction of hexavalent chromium ions |
| CN110564637B (en) * | 2019-07-10 | 2022-07-12 | 西北农林科技大学 | Composite microbial inoculum for promoting wheat growth and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100747701B1 (en) * | 2006-03-24 | 2007-08-08 | 영남대학교 산학협력단 | 11 Antagonistic soil bacterium Bacillus Licheniformis K11 and biological control and plant growth promotion using the same |
| CN101092599A (en) * | 2007-05-30 | 2007-12-26 | 江苏省农业科学院 | Preventing Bacillus subtilis grown inside diseased plant |
| KR101065262B1 (en) * | 2008-06-03 | 2011-09-19 | 김갑진 | The novel antifungal and growth promoting bacteria Bacillus subtilis EB-045 KACC- 91355P and the bio-pesticides containing its' fermented broth |
-
2012
- 2012-08-10 CN CN201210284747.5A patent/CN102827792B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100747701B1 (en) * | 2006-03-24 | 2007-08-08 | 영남대학교 산학협력단 | 11 Antagonistic soil bacterium Bacillus Licheniformis K11 and biological control and plant growth promotion using the same |
| CN101092599A (en) * | 2007-05-30 | 2007-12-26 | 江苏省农业科学院 | Preventing Bacillus subtilis grown inside diseased plant |
| KR101065262B1 (en) * | 2008-06-03 | 2011-09-19 | 김갑진 | The novel antifungal and growth promoting bacteria Bacillus subtilis EB-045 KACC- 91355P and the bio-pesticides containing its' fermented broth |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102827792A (en) | 2012-12-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103539535B (en) | Active biological matrix product specially used for culture of cucumber seedlings | |
| CN102787088B (en) | Enterobacter cloacae and application of enterobacter cloacae | |
| CN103194405B (en) | Growth-promoting bacteria for promoting ginger growth and preventing and controlling continuous cropping ginger soil-borne wilt and microorganism organic fertilizer produced from growth-promoting bacteria | |
| CN104263684B (en) | A kind of product siderophore series bacillus and application thereof | |
| CN102796684B (en) | Alfalfa growthpromoting rhizobacteria MJM-11 and application thereof | |
| CN102816719B (en) | Growth-promoting rhizobacteria SXH-2 and application thereof | |
| CN101948780B (en) | Antagonist bacterium for preventing and treating continuous cropping hot pepper epidemic disease and microbial organic fertilizer thereof | |
| CN103484396B (en) | New strain of streptomyces thermocarboxydus and application thereof | |
| CN102399713B (en) | Bacillus subtilis HL-1 and application thereof in respect of soil phosphate dissolving | |
| CN106754463B (en) | One plant of tool dissolving P capacity Burkholderia bacterium NJAU-B8 and its microbial manure of development | |
| CN102827794B (en) | Pseudomonas mediterranea strain and application thereof | |
| CN102827793B (en) | Medicago pseudomonas strain capable of producing ACC (1-aminocyclopropane-1-carboxylate) deaminase and application of medicago pseudomonas strain | |
| CN102086444A (en) | Paenibacillus elgii strain and application thereof | |
| CN102827792B (en) | Plant growth-promoting rhizobacterium SXH-3 and application thereof | |
| CN102787090A (en) | Alfalfa root growth-promoting rhizobacteria MJM-5 and application of alfalfa root growth-promoting rhizobacteria MJM-5 | |
| CN104818233A (en) | Bacillus vallismortis and functional vegetable seedling raising biological matrix prepared from bacillus vallismortis | |
| CN110117560A (en) | One plant of plant growth-promoting rhizobacteria for enhancing salt tolerance of crops and its microbial manure and application | |
| CN107903092A (en) | A kind of method and application using mushroom bran discarded object production bio-feritlizer synergist | |
| CN109456915A (en) | One seed sand good fortune bacillus strain X3 and its application | |
| CN106520630B (en) | A kind of bacillus megaterium QBJP-F6 and its application | |
| CN104630090A (en) | Corn rhizosphere growth promoting bacteria YM3 and application thereof | |
| CN104630092A (en) | Tobacco growth-promoting rhizobacterium YC9 and application thereof | |
| CN104630094A (en) | Peanut growth-promoting rhizobacterium and application thereof | |
| CN103409351A (en) | Growth promoting strain used for promoting banana growth and microbial organic fertilizer produced with same | |
| CN102747006B (en) | Potassium decomposition bacteria, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140416 Termination date: 20210810 |