CN111500618A - Experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction - Google Patents
Experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction Download PDFInfo
- Publication number
- CN111500618A CN111500618A CN202010347630.1A CN202010347630A CN111500618A CN 111500618 A CN111500618 A CN 111500618A CN 202010347630 A CN202010347630 A CN 202010347630A CN 111500618 A CN111500618 A CN 111500618A
- Authority
- CN
- China
- Prior art keywords
- eht1
- pichia pastoris
- gene
- strain
- knockout
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/44—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention is applicable to the technical field of gene action mechanism detection, and provides an experimental method for constructing pichia pastoris EHT1 gene overexpression and knockout strains, which is characterized in that by constructing an EHT1 gene expression strain of pichia pastoris, designing and synthesizing an EHT1 primer, extracting a plasmid of pichia pastoris bacteria, linearizing the plasmid, preparing pichia pastoris competence, constructing a pichia pastoris strain with an EHT1 gene knocked out, knocking out and converting the EHT1 gene, identifying whether the pichia pastoris EHT1 gene is knocked out, designing and synthesizing an EHT1 detection primer, detecting mRNA of EHT1 by utilizing qRT-PCR and analyzing the activity of SPGC-MS enzyme, so that the effect of the T1 gene on the generation of volatile fatty acid in a pichia pastoris fermentation product is detected, and theoretical basis is provided for further researching the expression and activity esterase of alcohol acyltransferase and revealing the action mechanism of the pichia pastoris EHT1 gene.
Description
Technical Field
The invention belongs to the technical field of gene action mechanism detection, and particularly relates to an experimental method for pichia pastoris EHT1 gene overexpression and construction of a knockout strain.
Background
HT1 has greater control over the synthesis of short chain fatty acid esters. The volatile aroma component detection of yeast strains separated from various foods shows that various esters such as ethyl octanoate and ethyl hexanoate can be produced. Analysis of enzymes controlling ester synthesis in yeast shows that EHT1 and EEB1 mainly control short-chain fatty acid esters, and earlier researches on the distribution of EHT1 and EEB1 genes show that EHT1 genes exist in all strains, while EEB1 genes exist in only part of yeast strains, and the EHT1 gene is presumed to be a gene essential for synthesizing esters by yeast. Therefore, mRNA and protein level expression of EHT1 is detected by Overexpression (OE) and knockout of Pichia pastoris endogenous EHT1 gene, total protein amount is determined by a Bradford method, esterase activity is determined by taking p-nitrophenyl acetate as a substrate, and generation of volatile fatty acid in an overexpression and knockout strain is detected by SPME GC-MS, so that theoretical basis is provided for further research on expression and esterase activity of alcohol acyltransferase and revealing action mechanism of Pichia pastoris EHT1 gene.
Disclosure of Invention
The invention provides an experimental method for pichia pastoris EHT1 gene overexpression and construction of a knockout strain, and aims to provide a theoretical basis for further researching expression and esterase activity of alcohol acyltransferase and disclosing an action mechanism of pichia pastoris EHT1 gene.
The invention is realized in such a way that an experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction comprises the following steps:
s1, constructing an EHT1 gene expression strain of pichia pastoris;
s11, designing and synthesizing an EHT1 primer;
s12, extracting plasmids of pichia pastoris thalli;
s13, linearizing the plasmid and preparing pichia pastoris competence;
s14, electrotransformation of EHT1/pPIC9k plasmid;
s2, constructing a pichia pastoris strain with the EHT1 gene knocked out;
s21, knocking out and transforming EHT1 gene;
s22, identifying whether the gene of Pichia pastoris EHT1 is knocked out or not;
s23, designing and synthesizing an EHT1 detection primer;
s24, detecting mRNA of EHT1 by using qRT-PCR;
s25, SPME GC-MS enzyme activity analysis.
Preferably, the method further comprises the following steps:
step S3, analyzing results;
s31, cloning EHT1 gene and constructing plasmid;
s32, identifying the level of the EHT1 gene knockout DNA;
s33, detecting the overexpression and knockout mRNA level of EHT 1;
s34, detecting the level of the EHT1 overexpression knockout protein;
s35, measuring esterase activity;
s36, SPME GC-MS analysis.
Compared with the prior art, the invention has the beneficial effects that: the invention discloses an experimental method for pichia pastoris EHT1 gene overexpression and strain knockout construction, which comprises the steps of constructing an EHT1 gene expression strain of pichia pastoris, designing and synthesizing an EHT1 primer, extracting a plasmid of pichia pastoris, linearizing the plasmid, preparing pichia pastoris competence, constructing a pichia pastoris strain with an EHT1 gene knockout function, knocking out and converting the EHT1 gene, identifying whether the EHT1 gene of the pichia pastoris is knocked out, designing and synthesizing an EHT1 detection primer, detecting mRNA of EHT1 by utilizing qRT-PCR, and analyzing enzyme activity of SPME GC-MS, so that the effect of the EHT1 gene on the generation of volatile fatty acid in a pichia pastoris fermentation product is detected, and a theoretical basis is provided for disclosing an action mechanism of the pichia pastoris EHT1 gene.
Drawings
FIG. 1 is a schematic diagram of the identification and correction of EcoRI + NotI double digestion vectors in the embodiment of the present invention.
FIG. 2 is a schematic representation of the identification of an EHT1 knockout gene at the DNA level in a particular embodiment of the invention.
FIG. 3 is a diagram illustrating quantitative detection of expression levels of KO and OEmRNA of EHT1 gene by qRT-PCR in accordance with an embodiment of the present invention.
FIG. 4 is a graph showing the results of Western blot analysis of the expression of EHT1 in KHT, WT and OE in accordance with an embodiment of the present invention.
FIG. 5 is a graphical representation of the results of expression assays during different time courses of extracellular expression of WT and OE in accordance with embodiments of the present invention.
FIG. 6 is a graph showing the results of measuring esterase activity using p-nitrophenylacetate as a substrate, in accordance with an embodiment of the present invention.
FIG. 7 is a schematic representation of SPME GC-MS detection of volatile fatty acid production in WT, KO and line 3 OE in an embodiment of the present invention.
FIG. 8 is a schematic flow chart of step S1 and step S2 of an experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
The invention provides a technical scheme that: an experimental method for pichia pastoris EHT1 gene overexpression and construction of a knockout strain.
In the embodiment, the pichia pastoris strain GS115 and the pPIC9K are purchased from China industrial microorganism strain preservation management center, and the strain number is CICC 1352. The strain characteristics are as follows: glucose, galactose, sucrose, maltose, raffinose, lactose and melezitose were not fermented, glucose, glycerol and ethanol were assimilated, and xylose was not assimilated.
The method comprises the following steps:
s1, constructing an EHT1 gene expression strain of pichia pastoris.
S11, and designing and synthesizing an EHT1 primer.
According to the following steps:
https://www.ncbi.nlm.nih.gov/nuccore/328349772？from＝1335369&to＝133672
primers were designed at 7& sat 2& sat _ key 46463764:
EHT1EcorIF：TTTGAATTCATGCCATCTTGGGGGTTCC。
EHT1NotIR：ATAAGAATGCGGCCGCAATTCCAGTTTTATAGCTG。
pichia EHT1 mRNA: no EcorI and NotI sites were available upon interrogation. And PCR detection was performed.
S12, extracting the plasmid of the pichia pastoris.
The method is carried out according to the specification of a plasmid extraction kit of Sigma company, and comprises the following specific steps:
(1) inoculating 100 mu L fresh bacterial liquid into 15-50 m L L B culture medium (DH5 α is added with AMP generally) containing a proper amount of antibiotics, shaking for 14-16 h at 37 ℃, centrifuging for 10min at 5,000g at room temperature, collecting thalli, pouring out supernatant, and inverting an EP tube on a paper towel to remove residual culture medium.
(2) Adding 2.5m L BufferA1 (ensuring that RNaseA is added before use), completely suspending thallus precipitate by using a pipette or a vortex oscillator, adding 2.5m L BufferB1, slightly reversing for 10 times to thoroughly mix the thallus precipitate evenly, standing for 5-10min until lysate becomes clear and viscous, completely cracking the thallus, which is the key for improving the DNA yield, and completely mixing the dissolved thallus to make the thallus clear and transparent.
(3) 1m L BufferN3 was added, turned upside down 5 times immediately, shaken 5 times vigorously to mix thoroughly, if a clumpy, brown or sticky precipitate still appeared after mixing, more BufferN3 was added to dissolve the precipitate thoroughly, the lysate was clarified by high speed centrifugation, transferring the lysate to a high speed centrifuge tube at room temperature, 13,000r/min (14,000-18,000 g), 15min, transferring the clarified lysate to a 50m L conical centrifuge tube, a filter syringe, adding the lysate to a filter syringe, inserting the syringe into a 50m L conical centrifuge tube, allowing to stand at room temperature for 10min, the white precipitate should be suspended at the top, inserting a plunger gently, discharging the clarified lysate to a new centrifuge tube, and stopping when a large resistance is felt by pressing the plunger, at which point some flocculent precipitate in the lysate may be present.
(4) Adding 1 time volume of Buffer RET and 3m L100% absolute ethyl alcohol, shaking the wrist, shaking quickly for 5 times, mixing evenly, transferring a lysate/ethanol mixture to a DNA column of a 50m L conical collecting pipe, discharging the lysate from the DNA column by using a piston, pulling out the piston gently, adding 10m L DNAWashBuffer, discharging the Buffer (waste liquid) by using the piston, pushing and pulling the piston repeatedly for several times, completely discharging the waste liquid, detaching the extracted DNA column by using a plastic wrench (provided), inserting the extracted DNA column into an EP pipe of 2.0m L, centrifuging the DNA column for 1min at 13,000-15,000 r/min (maximum rotation speed), pouring the waste liquid gently, putting the DNA column back into the EP pipe again, and centrifuging at the maximum rotation speed for 2 min.
(5) Adding 500 mu L EndofreesElutionbuffer (preheating in a water bath kettle at 60 ℃ C. can improve the yield) to the center of the DNA column, standing for 1min at room temperature, centrifuging for 1min at 12,000r/min to elute the DNA, adding 300 mu L EndofreesElutionbuffer to the center of the DNA column, standing for 1min at room temperature, centrifuging for 1min at 12,000r/min to elute the DNA, repeating the operation once to improve the recovery rate.
(6) The eluted DNA is re-loaded into the DNA column, the first elution of DNA is usually only 60% -70%, the second elution yield is another 20% -30%.
S13, linearization of plasmids and preparation of pichia pastoris competence.
Cutting 40 μ g of EHAT1/pPIC9k plasmid with Sail restriction endonuclease, treating overnight at 37 deg.C, recovering linearized plasmid by ethanol precipitation, recovering competent cells of Pichia pastoris by recovering GS115 strain by dipping frozen seed liquid at-80 deg.C with sterile toothpick, streaking onto fresh YPD plate, culturing at 30 deg.C for 3-5d, inoculating recovered GS115 seed onto the YPD plate, culturing at 30 deg.C and 200r/min overnight, inoculating 1M L strain from the overnight cultured seed liquid into 100M L YPD medium, culturing at 30 deg.C and 200r/min overnight, collecting the overnight cultured strain with 50M L sterile medium, centrifuging at 4 deg.C for 5min, resuspending with 50M L sterile deionized water, 1,500g, centrifuging at 4 deg.C for 5min, resuspending with 50M sorbitol, resuspending in L M sterile tubes, resuspending with sorbitol, resuspending at 500M, resuspending in sterile tubes, and resuspending on sterile ice, 100M L, 5min, and resuspending the strain with sorbitol, and centrifugation at 500 μ M L min.
S14, electrotransformation of EHT1/pPIC9k plasmid.
Adding 5-10 μ G of linearized EHT1/pPIC9k plasmid into a pichia pastoris competence, gently mixing uniformly, standing on ice for 5min, transferring the pichia pastoris competence mixed with the plasmid into an ice-cold 0.2cm electric transfer cup, wherein the parameters of electric shock are voltage of 1,500V, capacitance of 25 μ F, resistance of 200 Ω and discharge time of 4-5ms, adding 1M L sterile ice-cold sorbitol (1M) into the electric transfer cup after electric shock, standing on ice for 5min, transferring bacterial liquid in the electric transfer cup into a 15M L sterile centrifugal tube, adding an equal volume of YPD medium, placing the centrifugal tube in a shaker at 28 ℃ for resuscitation at least 2h at 200r/min, placing the centrifugal tube at 15M 64 in a centrifuge, 1,500G, centrifuging at 25 ℃ for 5min, placing the centrifugal tube at 10M L sterile deionized water in the centrifuge, placing the centrifugal tube at1, 500G, centrifuging at 25 ℃ for 5min, placing the centrifugal tube at 1M 3963 in a sterile centrifuge, sucking 300M in a 300M resuspension box, drawing a strain plate at 500G, and cloning the strain containing a strain plate at L, and carrying out cloning on a plate culture.
S2, constructing the Pichia pastoris strain with the EHT1 gene knocked out.
S21, knockout and transformation of EHT1 gene.
We knocked out EHT1 gene (KO) using homologous recombination methods. The EHT1 gene knockout was performed using the Agrobacterium-mediated fungal transformation (ATMT) method. Primers EHT1O1 (5'-GGTCTTAAUTGGAAAATACCTGGGCCAGT-3') and EHT1O2 (5'-GGCATTAAUCTGTCAAACGAACCTGCACA-3') amplified the left arm of the EHT1 gene. Primers EHT1A3 (5'-GGACTTAAUGTTGGCGCCCCTATTGATTT-3') and EHT1A4 (5'-GGGTTTAAUCGGTGGCAAAGTGAAAGTGA-3') amplified the right arm of the EHT1 gene. A base U is added into each of 2 pairs of primers, and the sequence is as follows:
EHT1O1：GGTCTTAAUTGGAAAATACCTGGGCCAGT
EHT1O2：GGCATTAAUCTGTCAAACGAACCTGCACA
EHT1A3：GGACTTAAUGTTGGCGCCCCTATTGATTT
EHT1A4：GGGTTTAAUCGGTGGCAAAGTGAAAGTGA
PCR fragments were ligated to vector pRF-HU2 and transformed into DH5 α PCR clone products containing both recombinant arms of EHT1 gene were sequenced to verify the presence of EHT1 gene insert in E.coli transformants, the corrected EHT1 gene clones were amplified in L B medium and recombinant plasmids were extracted.
The Agrobacterium containing the plasmid was resuspended and added to L B medium containing 20 μ g/m L rifampicin, 25 μ g kanamycin and 75 μ g/m L carbenicillin, cultured to OD 3-4. a single colony from solid YPD medium was inoculated in YPD liquid medium and cultured to OD 1-2. the two microorganisms were collected, resuspended and washed 3 times in IMAS liquid medium, the Agrobacterium and Pichia were co-cultured in IMAS solid medium containing 20 μ g/m L, kanamycin 25 μ g/m L and kanamycin 75 μ g/m L rifampicin for 3-4d until cloning occurred.
S22, identifying whether the gene of Pichia pastoris EHT1 is knocked out.
The flora of the transfected yeasts was detected by means of a bacterial liquid PCR reaction, using primers specific for the Hyg gene, a selection marker (forward primer sequence: 5'-AGCTGCGCCGATGGTTTCTACAA-3' and reverse primer sequence 5'-CGCGTCTGCTGCTCCATACAA-3'). The correct crossover was checked on the left using primers EHT1O1 (5'-GGTCTTAAUTGGAAAATACCTGGGCCAGT-3') and RF-2 (5'-TCTCCTTGCATGCACCATTCCTTG-3'). EHT1A4 (5'-GGGTTTAAUCGGTGGCAAAGTGAAAGTGA-3') and RF-1 (5'-AAATTTTGTGCTCACCGCCTGGAC-3') were tested on the right for correct amplification.
S23, and designing and synthesizing an EHT1 detection primer.
After a large amount of pichia pastoris strains with EHT1 gene knocked out are cultured, the strains are centrifuged at 2,000r/min for 2min, liquid nitrogen is used for grinding the pichia pastoris strains after centrifugation, and a mortar is frozen in a refrigerating chamber of a refrigerator at the temperature of-20 ℃ for 2h before use. The total RNA extraction steps are as follows:
(1) the method comprises the steps of subpackaging the pichia pastoris body ground by liquid nitrogen into centrifuge tubes of 1.5m L, adding 1m L RNAiSoPlus into the centrifuge tubes added with the pichia pastoris body, respectively oscillating for 30s by using a vortex oscillator, wherein the oscillating is mainly used for fully dispersing the pichia pastoris body ground by liquid nitrogen into a cracking agent RNAiSoPlus, fully and uniformly mixing, standing for 5-10min at 25 ℃, centrifuging for 5min by using a high-speed refrigerated centrifuge of 12,000r/min (or with the gravity acceleration of 13,000g) at the low temperature of 4 ℃, absorbing supernatant (about 1,000 mu L), and transferring to a new centrifuge tube of 1.5m L.
(2) Adding 200 mu L chloroform into the supernatant, shaking gently, mixing uniformly, standing at normal temperature for 5-10min, centrifuging at 4 ℃ and low temperature for 15min by using a high-speed refrigerated centrifuge with the speed of 12,000r/min (or the acceleration of gravity of 13,000g), taking out the centrifuged EP tube gently, dividing the centrifuged liquid level into 3 layers (sequentially from top to bottom, respectively: liquid phase (containing nucleic acid), protein and redundant chloroform), carefully absorbing the upper liquid phase by using a 400 mu L pipette gun, transferring the upper liquid phase into a 1.5m L centrifuge tube, adding 200 mu L isopropanol into a new centrifuge tube, turning upside down, mixing uniformly, standing at normal temperature for 10min, centrifuging at 4 ℃ and low temperature for 15min by using a high-speed refrigerated centrifuge with the speed of 12,000r/min (or the acceleration of gravity of 13,000g), pouring off the centrifuged supernatant, and obtaining the white precipitate stored at the bottom of the centrifuge tube, namely the total pichia pastoris RNA.
(3) Adding 1,000 mu L75% ethanol (prepared by 0.1% DEPC water) into the white precipitate at the bottom of the centrifuge tube, gently shaking and mixing, suspending the white precipitate in 75% ethanol, centrifuging for 5min at 4 ℃ and low temperature by using a high-speed refrigerated centrifuge at 12,000r/min (or with the gravity acceleration of 13,000g), pouring off the supernatant, drying for 5-10min at normal temperature in a super clean workbench, respectively adding 30-50 mu L RNase-freeH2O, gently shaking, dissolving the total RNA of the pichia pastoris, and measuring the total RNAOD260/280 value and concentration of the extracted pichia pastoris.
S24, mRNA of EHT1 was detected by qRT-PCR.
The cDNA micro-template after reverse transcription of the over-expression pichia strain and the pichia knockout strain is used, the concentration is adjusted to be 500 ng/mu L, the reaction system is shown in the table 1, and all samples are repeated for 6 times.
Table one:
s25, SPME GC-MS enzyme activity analysis.
SPME GC-MS enzyme activity analysis overexpression of enzyme activity in a pichia strain and a pichia knockout strain, centrifuging a product obtained after thallus fermentation at 4 ℃ for 10,000r/min for 10min, collecting supernatant, storing the supernatant at 4 ℃ for later use, sucking 8m L supernatant, placing the supernatant into a 20m L sample bottle, adding 0.6g of NaCl, adopting a headspace automatic sample injection method, wherein the headspace sample injection conditions comprise oscillation temperature of 45 ℃, oscillation time of 2min and sample injection amount of 2m L, GC analysis conditions comprise that a chromatographic column is TR-5MS (30m × 0.25mm and 0.25 mu m), a sample injection port temperature of 300 ℃, carrier gas, a flow rate of 1m L/min, a sample injection amount of 350 mu L, a split flow ratio of 20:1, a temperature raising program, wherein the initial temperature is 40 ℃, the temperature is kept for 3min, the temperature is raised to 190 ℃ at a speed of 3 ℃/min, the temperature is kept for 5min, the temperature is raised to 270 ℃ at a speed of 20 ℃/min, the ion source is kept at a 5min condition of electron bombardment (70 eV), the temperature of a polar temperature of 250 ℃, the ion source temperature of a quadrupole scanning ion source is kept at a scanning speed
And S3, analyzing results.
S31, cloning EHT1 gene and constructing plasmid.
The recombinant expression plasmid was digested with SalI restriction enzymes, transformed into Pichia pastoris GS115 by agarose gel electrophoresis using internal protocols after transformation, the tube contents were spread on MD medium and incubated at 30 ℃ for 5 d.clones appearing on MD medium were re-streaked stepwise on YPD medium containing 0.2mg/m L, 0.5mg/m L, 1mg/m L, 2mg/m L G418 for selection of EHT1 high expression strains, the results are shown in FIG. 1. pPIC9K-EHT1, EcoRI and NotI digested pPIC9K-EHT1 agarose bands were consistent with those expected, the bands were single, high in brightness, meeting the experimental requirements, and can be used for subsequent extraction and mRNA level detection.
S32, and identifying the level of the EHT1 gene knockout DNA.
The band of interest was single, RF-1 and RF-2 were located on the vector, and there was no band in the PCR amplification electrophoresis result from Knockout strain (KO) compared to wild-type Pichia pastoris, indicating the success of construction of Pichia pastoris EHT1 knock-out strain, as shown in FIG. 2.
S33, detecting the over-expression and knockout mRNA level of EHT 1.
Please refer to fig. 3, qRT-PCR is used to quantitatively detect expression levels of KO and OEmRNA of EHT1 genes, KO group is significantly lower than OE group and WT group (P <0.01), OE-2 overexpression group mRNA expression is significantly higher than OE-1 and OE-2 group (P <0.05), and OE-2 pichia pastoris overexpression strains are selected to prepare pichia pastoris recombinant microbial inoculum, which indicates that the knock-out strain is successfully constructed at EHT1mRNA level.
S34, detecting the level of the EHT1 overexpression knockout protein.
FIG. 4 shows the results of Western blot analysis of EHT1 expression in KHT, WT and OE. In OE, small amount of EHT1 protein accumulation exists in Pichia pastoris cells, and KO does not express EHT 1. FIG. 5 is a time course of EHT1 expression outside WT and OE cells. Samples were taken 24h, 48h, 72h and 96h after OE induction. Cultures were adjusted to 20D, WT at 96h as control Western blot assay. The successful construction of the knockout strain on the protein level of EHT1 is proved, and the knockout strain can be used for detecting the fermentation level in the later period.
S35, measuring the esterase activity.
FIG. 6 shows the determination of esterase activity using p-nitrophenyl acetate as substrate. Total protein was determined by Bradford assay, using Bovine Serum Albumin (BSA) as standard and samples were collected after 72h of methanol induction. The results show that after the gene of pichia pastoris EHT1 is knocked out, the esterase activity is extremely obviously reduced (P <0.01) compared with that of a control group, and the esterase activities of 3 strains OE-1, OE-2 and OE-3 of pichia pastoris over-expressing EHT1 genes are all extremely higher than that of a WT group (P < 0.01). In 3 strains OE-1, OE-2 and OE-3 of Pichia pastoris with over-expressed EHT1 genes, the esterase activity of an OE-2 group is obviously higher than that of OE-1 and OE-3 groups (P is less than 0.01), which indicates that the construction success of the OE-2 strain with over-expressed EHT1 genes is achieved, and further indicates that the EHT1 gene has an important regulation and control function on the esterase activity in fermentation products of the Pichia pastoris.
S36, SPMEGC-MS analysis.
Please refer to FIG. 7 for the detection of volatile fatty acid production by SPMEGC-MS in WT, KO and line 3 OE. 3 strains OE-1, OE-2 and OE-3 of Pichia pastoris over-expressing EHT1 genes, the relative percentage content of ethyl heptanoate, methyl octanoate, ethyl octanoate, methyl nonanoate, methyl decanoate, ethyl decanoate, methyl laurate, ethyl laurate and ethyl myristate in fermentation products is remarkably higher than that of a WT group (P <0.01), the relative percentage content of 3 fatty acids of methyl nonanoate, methyl decanoate and ethyl decanoate is remarkably higher than that of ethyl heptanoate, methyl octanoate, ethyl octanoate, methyl laurate, ethyl laurate and ethyl myristate (P <0.05), and the fact that Pichia pastoris esterase EHT1 plays a greater control role in the synthesis of short-chain fatty acid esters is explained again.
After the EHT1 gene is knocked out, ethyl heptanoate, methyl caprylate, ethyl caprylate, methyl nonanoate, methyl decanoate, ethyl decanoate, methyl laurate, ethyl laurate and ethyl myristate in the pichia pastoris fermentation product are all remarkably reduced (P <0.01) compared with a control group, and the relative percentage content of 3 fatty acids of methyl nonanoate, methyl decanoate and ethyl decanoate is remarkably lower than that of the ethyl heptanoate, methyl octanoate, ethyl octanoate, methyl laurate, ethyl laurate and ethyl myristate (P <0.05) in the control group and the knocked-out group, which indicates that pichia pastoris esterase EHT1 has a greater control effect on the synthesis of short-chain fatty acid esters.
And (4) conclusion: after the gene of pichia pastoris EHT1 is knocked out, the esterase activity is extremely obviously reduced (P <0.01) compared with that of a control group, and the esterase activities of 3 strains OE-1, OE-2 and OE-3 of pichia pastoris with over-expressed EHT1 genes are all extremely higher than that of a WT group (P < 0.01). In 3 strains OE-1, OE-2 and OE-3 of Pichia pastoris with over-expression EHT1 genes, the esterase activity of the OE-2 group is obviously higher than that of OE-1 and OE-3 groups (P < 0.01). It was shown that EHT1 gene showed successful construction of both knock-out and over-expressed strains at DNA, mRNA and protein levels. The EHT1 gene has an important regulation and control function on the generation of volatile fatty acid in a pichia pastoris fermentation product.
The invention discloses an experimental method for pichia pastoris EHT1 gene overexpression and strain knockout construction, which comprises the steps of constructing an EHT1 gene expression strain of pichia pastoris, designing and synthesizing an EHT1 primer, extracting a plasmid of pichia pastoris, linearizing the plasmid, preparing pichia pastoris competence, constructing a pichia pastoris strain with an EHT1 gene knockout function, knocking out and converting the EHT1 gene, identifying whether the EHT1 gene of the pichia pastoris is knocked out, designing and synthesizing an EHT1 detection primer, detecting mRNA of EHT1 by utilizing qRT-PCR, and analyzing enzyme activity of SPME GC-MS, so that the effect of the EHT1 gene on the generation of volatile fatty acid in a pichia pastoris fermentation product is detected, and a theoretical basis is provided for disclosing an action mechanism of the pichia pastoris EHT1 gene.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Claims (2)
1. An experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction is characterized in that: the method comprises the following steps:
s1, constructing an EHT1 gene expression strain of pichia pastoris;
s11, designing and synthesizing an EHT1 primer;
s12, extracting plasmids of pichia pastoris thalli;
s13, linearizing the plasmid and preparing pichia pastoris competence;
s14, electrotransformation of EHT1/pPIC9k plasmid;
s2, constructing a pichia pastoris strain with the EHT1 gene knocked out;
s21, knocking out and transforming EHT1 gene;
s22, identifying whether the gene of Pichia pastoris EHT1 is knocked out or not;
s23, designing and synthesizing an EHT1 detection primer;
s24, detecting mRNA of EHT1 by using qRT-PCR;
s25, SPME GC-MS enzyme activity analysis.
2. The experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction as claimed in claim 1, wherein: further comprising:
step S3, analyzing results;
s31, cloning EHT1 gene and constructing plasmid;
s32, identifying the level of the EHT1 gene knockout DNA;
s33, detecting the overexpression and knockout mRNA level of EHT 1;
s34, detecting the level of the EHT1 overexpression knockout protein;
s35, measuring esterase activity;
s36, SPME GC-MS analysis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010347630.1A CN111500618A (en) | 2020-04-28 | 2020-04-28 | Experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010347630.1A CN111500618A (en) | 2020-04-28 | 2020-04-28 | Experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111500618A true CN111500618A (en) | 2020-08-07 |
Family
ID=71866487
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010347630.1A Pending CN111500618A (en) | 2020-04-28 | 2020-04-28 | Experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111500618A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571764A (en) * | 2013-08-26 | 2014-02-12 | 天津科技大学 | Saccharomyces cerevisiae engineering bacterium for highly yielding medium-chain fatty acid ethyl ester as well as construction method thereof |
| WO2015031859A1 (en) * | 2013-08-29 | 2015-03-05 | The Regents Of The University Of California | Bacteria engineered for ester production |
-
2020
- 2020-04-28 CN CN202010347630.1A patent/CN111500618A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571764A (en) * | 2013-08-26 | 2014-02-12 | 天津科技大学 | Saccharomyces cerevisiae engineering bacterium for highly yielding medium-chain fatty acid ethyl ester as well as construction method thereof |
| WO2015031859A1 (en) * | 2013-08-29 | 2015-03-05 | The Regents Of The University Of California | Bacteria engineered for ester production |
Non-Patent Citations (2)
| Title |
|---|
| JIA CHEN等: "Ester-Producing Mechanism of Ethanol O-acyltransferase EHT1 Gene in Pichia pastoris from Shanxi Aged Vinegar", 《BIOMED RESEARCH INTERNATIONAL》 * |
| 李锋等: "过表达EHT1基因对酿酒酵母己酸乙酯生产能力的影响", 《现代食品科技》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110791468B (en) | Construction method and application of mycobacterium genetic engineering bacteria | |
| WO2015062190A1 (en) | Mortierella alpina recombinant gene expression system and construction method and use thereof | |
| CN113265340B (en) | Squalene-producing schizochytrium limacinum genetic engineering strain and construction method and application thereof | |
| CN111893049A (en) | Schizochytrium limacinum genetic engineering strain for over-expressing squalene synthetase gene and construction method and application thereof | |
| WO2015018198A1 (en) | Mortierella alpine uracil auxotroph with ura5 gene knocked out through homologous recombination, and construction method thereof | |
| CN114736916B (en) | Application of perilla frutescens PfLPAT2-3 gene in improvement of total lipid content of plants | |
| CN106554926B (en) | Method for preparing recombinant L-glutamic acid-producing strain, strain prepared by the method, and method of using the same | |
| CN113881586A (en) | High-temperature-resistant, high-sugar-resistant and high-salt-resistant saccharomyces cerevisiae strain as well as construction method and application thereof | |
| CN109609537A (en) | A kind of application of gene editing method in Amycolatopsis orientalis | |
| CN114277042A (en) | Rhodosporidium toruloides recombinant expression strain for high-yield ergothioneine and construction method and application thereof | |
| CN110791439B (en) | Recombinant aspergillus niger strain for fermentation production of malic acid by genetic engineering construction and application | |
| WO2016029802A1 (en) | Identification and use of synthetic gene cluster of cordycepin | |
| CN117025629A (en) | Cyperus esculentus CePLPP1-5 gene and application thereof | |
| CN111471602A (en) | Construction method and application of mucor circinelloides engineering strain for efficiently synthesizing gamma-linolenic acid by using cellulose | |
| CN111500618A (en) | Experimental method for pichia pastoris EHT1 gene overexpression and knockout strain construction | |
| CN108823234B (en) | Agrobacterium-mediated transformation method for Tilletia foetida | |
| CN108949798B (en) | Agrobacterium-mediated transformation method for Tilletia controversa Kuhn | |
| CN114426995A (en) | Method for improving yield of cordyceps militaris extracellular polysaccharide by over-expression of hexokinase gene HK | |
| CN111073821B (en) | Construction method of monascus ruber strain capable of producing lovastatin with high yield and producing no citrinin | |
| CN110846331B (en) | Construction method and application of wine coccus engineering bacteria | |
| CN108929882B (en) | Gene editing method and application of bacillus licheniformis | |
| CN111118044B (en) | Kenaf HcCLA1 gene VIGS silencing system | |
| CN112779174B (en) | Saccharomyces cerevisiae genetically engineered bacterium for knocking out Cln3 gene, construction method and application thereof | |
| CN114075516B (en) | Genetically engineered bacterium for high yield of mycophenolic acid, construction method and application thereof | |
| CN116426564B (en) | Application of GhALY1 gene in improving oil yield of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200807 |
|
| RJ01 | Rejection of invention patent application after publication |