CN114075516B

CN114075516B - Genetically engineered bacterium for high yield of mycophenolic acid, construction method and application thereof

Info

Publication number: CN114075516B
Application number: CN202111385456.0A
Authority: CN
Inventors: 魏巍; 陈绵辉; 魏东芝; 熊志; 陈继敏
Original assignee: GUANGDONG BLUE TREASURE PHARMACEUTICAL CO LTD; East China University of Science and Technology
Current assignee: GUANGDONG BLUE TREASURE PHARMACEUTICAL CO LTD; East China University of Science and Technology
Priority date: 2021-11-22
Filing date: 2021-11-22
Publication date: 2024-01-30
Anticipated expiration: 2041-11-22
Also published as: CN114075516A

Abstract

The invention provides a genetically engineered bacterium for high yield of mycophenolic acid, which uses penicillium brevicompactum as a host cell, a recombinant plasmid pPKCMH formed by MpaB gene for expressing oxidative lyase and pPK2 plasmid, and a truncated Pgpd promoter (PgpdT) is used for starting the expression of the MpaB gene, and the recombinant plasmid is subjected to mediated transfer by agrobacterium tumefaciens GV 3101. The invention also provides a construction method and application of the corresponding genetically engineered bacterium. The genetically engineered bacterium for high yield of mycophenolic acid can remarkably improve the MpaB gene expression quantity in a mycophenolic acid synthesis gene cluster and actively improve the yield of mycophenolic acid. In addition, in the construction method provided by the invention, the molecular construction is based, complicated operation is not needed, the yield is obviously improved, and the method has good industrial application value.

Description

Genetically engineered bacterium for high yield of mycophenolic acid, construction method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a genetic engineering bacterium for high-yield mycophenolic acid, a construction method and application thereof.

Background

Mycophenolic acid (Mycophenolic Acid, MPA) is an antibiotic produced by penicillium brevicompactum (Penicillium brevicompactum) and has antifungal, antitumor and immunosuppressive effects. Mycophenolic acid can bind non-competitively to hypoxanthine mononucleotide dehydrogenase to inhibit lymphocyte activity. Its 2-morpholinoethyl derivative-mycophenolate mofetil (Morpholinoethyl Ester of Mycophenolic Acid, MMF) is a new generation immunosuppressant. Mycophenolate mofetil exerts immunosuppressive activity in vivo by converting to mycophenolic acid. At present, MMF has been widely used in organ transplantation at home and abroad, which also makes the production method of mycophenolic acid and the construction of high-yield strains thereof have been widely focused in the industry.

Pharmacokinetic profile of mycophenolic acid: mycophenolic acid ester (MMF) is completely absorbed by oral administration, and is quickly metabolized into an active ingredient MPA after entering the body, 99.99% of MPA is distributed in plasma, the binding rate of MPA and plasma protein is 97% -99%, in intestinal tracts, livers and kidneys, the MPA is mainly metabolized into mycophenolic acid glucuronide (MPAG) by guanosine diphosphate-glucuronyltransferase (UGTs) in the intestinal tracts, and in addition, small amount of MPA is metabolized into 7-O-glucoside-mycophenolic acid and mycophenolic acid acyl glucuronide (AcMPAG), the MPA has liver-intestine circulation in the body, and metabolites of MPA are metabolized into MPA by bacteria after being transported into bile in the intestinal tracts by multi-drug resistance related protein2 (multi-drug protein2, MRP-2), and then the MPA is exposed to the next peak of the liver again in the blood circulation, thus the MPA is increased by the next 4% of the near-40% of the body after the blood circulation. Finally about 93% mpa is excreted via urine, 87% of which is excreted as MPAG, and a small amount is excreted via faeces (about 6%).

The current production of mycophenolic acid is mainly based on biosynthesis, i.e. fermentation of fungi, wherein the efficient production of mycophenolic acid is: penicillium brevicompactum (Penicillium brevicompactum) and penicillium roqueforti (Penicillium roqueforti). The extraction of the product from the fermentation broth is mainly a method of separation after solvent leaching, and is also widely applied to separation of various biosynthesis products at present.

Disclosure of Invention

The invention aims to overcome at least one defect in the prior art and provides a genetically engineered bacterium for high-yield mycophenolic acid, a construction method and application thereof.

The invention provides a genetically engineered bacterium for high yield of mycophenolic acid, which is mainly characterized in that penicillium brevicompactum (Penicillium brevicompactum) is used as a host cell to express a recombinant plasmid pPKCMH formed by an MpaB gene and a plasmid pPK2, the truncated Pgpd promoter is used for promoting the expression of the MpaB gene, and the recombinant plasmid is subjected to the mediated transfer of a GV3101 by agrobacterium tumefaciens (Agrobacterium tumefaciens).

Among them, the MpaB gene (oxidative cleavage enzyme) is a gene native to the mycophenolic acid synthesis gene cluster.

Preferably, the truncated Pgpd promoter is specifically: the nucleotide sequence 2156bp upstream of ATG from Aspergillus nidulans 3-phosphoglycerate dehydrogenase is the initial promoter sequence, truncated at-1046 bp, forming the truncated Pgpd promoter.

The invention also provides a construction method of the genetically engineered bacterium for high yield of mycophenolic acid, which is mainly characterized by comprising the following steps: the MpaB gene, truncated Pgpd promoter PgpdT, ttrpC terminator and pPK2 plasmid form recombinant plasmid, the recombinant plasmid is transferred to penicillium brevicompactum (Penicillium brevicompactum) through the mediation of agrobacterium tumefaciens (Agrobacterium tumefaciens) GV3101, and the copy number of the MpaB gene in a product synthetic gene cluster is increased to form the genetically engineered bacterium Penicillium brevicompactum pPKCMH-PgpdT-MpaB-Ttrpc of high-yield mycophenolic acid.

The MpaB gene is amplified from penicillium brevicompactum.

The PgpdT is a Pgpd truncated promoter, a 2156bp nucleotide sequence from the upstream of Aspergillus nidulans 3-phosphoglycerate dehydrogenase ATG is an initial promoter sequence, and the Pgpd truncated promoter is formed by truncating the initial promoter sequence at-1046 bp.

The recombinant plasmid is formed by the MpaB gene and the pPK2 plasmid, and specifically comprises the following components:

the MpaB gene, the truncated 3-phosphoglycerate dehydrogenase promoter PgpdT and the aspergillus nidulans tryptophan synthesis gene terminator Ttrpc are connected at the multiple cloning sites of the filamentous fungus shuttle expression vector pPK2 to obtain the recombinant plasmid pPKCMH.

Next, the recombinant plasmid pPK-CMH was transformed into agrobacterium tumefaciens GV1301 to obtain recombinant agrobacterium tumefaciens, and the vector fragment between RB and LB in the recombinant plasmid was transferred into penicillium brevicompactum by utilizing the function of binding transfer of agrobacterium tumefaciens to obtain recombinant penicillium brevicompactum.

The construction method provided by the invention specifically comprises the following steps:

1. cloning of the MpaB Gene, promoter PgpdT and terminator Tttrpc:

according to the MpaB gene sequence in the penicillium brevicompactum mycophenolic acid synthesis gene cluster published by Genebank, designing a synthesis primer:

P1：gagcagacatcaccATGTCTTTGTCTTTGCCTCCAGC

P2：CTAATGGAAGGGACATTTCCCC

according to the gene sequence of Pgpd from Aspergillus nidulans published by Genebank, after truncation, a primer is designed and synthesized according to the truncated promoter sequence:

P3：cgaattcttaattaagatatcCCAAATCTGTCCAGATCATGGT

P4：agacatGGTGATGTCTGCTCAAGCGG

primers were designed and synthesized based on the gene sequence of Ttrpc from aspergillus nidulans published by Genebank:

P5：ggaaatgtcccttccattagTGATTTAATAGCTCCATGTCAACAA

P6：ccgggtaccgagctcgatatcGTCTAGAAAGAAGGATTACCTCTAA

introducing homologous recombination fragments of KpnI enzyme cutting sites in the plasmid pPK2 polyclonal site at two ends of the primers P1 and P6, and completing PCR reaction by taking penicillium breve and the plasmid pPK2 as templates:

the reaction system of PCR is: buffer 25. Mu.L, ddH ₂ O18. Mu.L, template 1. Mu.L, upstream and downstream primers 2. Mu.L each, dNTPs 1. Mu.L, high fidelity enzyme. Mu.L. PCR reaction conditions: pre-denaturation at 95℃for 3min; 35 cycles were performed: denaturation at 95℃for 20s, annealing at 60℃for 20s, and extension at 72℃at a rate of 1 Kb/min. Finally, the temperature is kept at 72 ℃ for 10min, and the temperature is kept at 4 ℃ after the reaction is finished. After the reaction was terminated, 1% agarose gel electrophoresis was performed.

Fusion PCR was then performed as follows to ligate three fragments of PgpdT-MpaB-Ttrpc together:

I. using 1. Mu.L of each of the three cloned fragments as a template, buffer 25. Mu.L, ddH ₂ O 20μL,dNTPs1μL，High fidelity enzyme 1μL。

PCR reaction conditions: pre-denaturation at 95 ℃ for 5min; 10 cycles were performed: denaturation at 94℃for 20s, annealing at 57℃for 20s, and extension at 72℃at a rate of 1 Kb/min. Finally, the temperature is kept at 72 ℃ for 10min, and the temperature is kept at 4 ℃ after the reaction is finished.

II. Using 2. Mu.L of the above fusion fragment as a template, buffer 25. Mu.L, ddH ₂ O 17μL,dNTPs 1μL，High fidelity enzyme 1μL,P1 2μL，P2 2μL。

PCR reaction conditions: pre-denaturation at 95 ℃ for 5min; 35 cycles were performed: denaturation at 94℃for 20s, annealing at 60℃for 20s, and extension at 72℃at a rate of 1 Kb/min. Finally, the temperature is kept at 72 ℃ for 10min, and the temperature is kept at 4 ℃ after the reaction is finished.

After the reaction is terminated, 1% agarose gel electrophoresis detection is carried out, and the purified product is connected with a pPK2 carrier after KpnI digestion after being purified by a PCR purification recovery kit and is sequenced.

2. Agrobacterium tumefaciens mediated binding metastasis:

preparation of Agrobacterium tumefaciens competence:

agrobacterium GV3101 was inoculated into 5mL of LB liquid medium (containing 25. Mu.g/mL of streptomycin) and cultured overnight at 28℃and 200 rpm. 5mL of the culture was continuously cultured in LB liquid medium (50 mL) (containing 25. Mu.g/mL of streptomycin) and OD600 was 0.5. The culture was placed in an ice bath for 30min, centrifuged at 5000rpm at 4℃for 5min, and the supernatant was discarded. The supernatant was discarded by centrifugation at 5000rpm at 4℃for 5min with 10mL of cold 10% glycerol suspension. The supernatant was discarded by centrifugation at 5000rpm at 4℃for 5min with 2.5mL of cold 10% glycerol suspension. Suspended with 1.0mL of cold 10% glycerol. Split charging into 100 μl/tube, freezing with liquid nitrogen for 1min, and storing at-70deg.C.

Transformation of pPKCMH into agrobacterium GV1301 competent:

a Bio-rad Micro Pulser electrotransformation instrument was used, a 0.2cm thick electrocuvette, 5. Mu.L of recombinant plasmid was mixed with 100. Mu.L of Agrobacterium GV1301 competent cells, and the whole mixture was added to the electrocuvette. Electric shock transformation is carried out under the conditions of 2.5KV,25 mu F and 1000 omega, 800 mu L of LB liquid medium is added, and shaking culture and recovery are carried out at 30 ℃ and 150rpm for 10 hours. Is spread on LB solid medium containing 25 mug/mL kanamycin and 25 mug/mL streptomycin, and is inversely cultured for 2 days at 30 ℃ for colony formation. Single colonies were picked and inoculated into LB liquid medium containing 25. Mu.g/mL kanamycin and 25. Mu.g/mL streptomycin, and cultured at 30℃with shaking at 200 rpm. Positive clones were verified by PCR and passaged.

Culture of conidia of Penicillium breve:

uniformly coating penicillium brevicompactum spores in eggplant bottles containing PDA culture medium, inversely culturing at 28 ℃ for 8-10 days, collecting spores from PDA plates into 10mL of sterile aqueous solution, vigorously vortexing for 2-5 minutes until the spores are completely dispersed, and filtering the spore suspension with sterile glass filaments to remove mycelia. Transferring the spore suspension into a new sterile 50mL centrifuge tube, centrifuging at 8000rpm for 10min, collecting spores, discarding supernatant, suspending spores with sterile water solution, and calculating spore concentration by blood cell counting plate 10 ⁸ cfu/mL, readjusted to the appropriate concentration, stored in a refrigerator at 4deg.C.

Binding transfer:

first, the spore concentration was diluted to 10 ⁶ cfu/mL

Placing agrobacterium tumefaciens in a 250mL conical flask containing 20mL of LB, adding the Carna resistance, and culturing for 16-18h;

taking 0.5mL of Agrobacterium tumefaciens culture solution, taking 4.5mL of IM culture medium (containing 200 μM AS (acetosyringone)), and placing into a 50mL centrifuge tube so that the final OD600 is about 0.2;

culturing the mixed liquid in darkness at 28deg.C for 6 hr until OD600 reaches 0.6-0.8;

mixing 100 μl of induced Agrobacterium tumefaciens and 100 μl of spore solution, placing on cellulose film (Whatman), placing in IM culture medium solid medium, and culturing at 25deg.C under dark condition for 48 hr;

the cellulose film was then transferred to PDA solid medium containing 50. Mu.g/mL hygromycin and 300. Mu.g/mL cytomycin and incubated upside down at 25℃for 4-5 days.

After the transformants were grown, single colonies were picked and passaged to stable traits on PDA plates containing 50. Mu.g/mL hygromycin resistance.

The genome of the transformant with stable characteristics was extracted and verified by PCR. After the successful PCR verification, the transformant grows mature spores, the transformant is cultured in a liquid PDA culture medium, RNA of the transformant is extracted and reverse transcribed after the transformant grows to the logarithmic growth phase, and qRT-PCR is used for verifying the expression condition of the MpaB gene.

3. qRT-PCR verification-obtaining recombinant genetic engineering bacteria:

the qRT-PCR reaction system is as follows:

mix 10. Mu.L Up primer 0.4. Mu.L Down primer 0.4. Mu.L template 1. Mu.L ddH ₂ O 8.2μL

The two-step RT-PCR reaction conditions were as follows:

pre-denaturation: 95 ℃ for 30s;

40 cycles: denaturation, 95 ℃,10s, annealing extension, 60 ℃ and 30s;

melting curve: 95 ℃ for 15s;60 ℃ for 60s;95℃for 15s.

And selecting a strain with the highest relative expression amount of the MpaB gene, culturing and preserving the strain as an engineering strain, and naming the engineering strain as Penicillium brevicompactum pPKCMH-PgpdT-MpaB-Ttrpc.

The invention also provides application of the genetically engineered bacterium in the production of mycophenolic acid.

The genetically engineered bacterium for high yield of mycophenolic acid can obviously improve the MpaB gene expression quantity in a mycophenolic acid synthesis gene cluster, thereby positively increasing the yield of mycophenolic acid. In addition, in the construction method provided by the invention, the molecular construction is based, complicated operation is not needed, the yield is obviously improved, and the method has good industrial application value.

Drawings

FIG. 1 is a nucleic acid photograph of the MpaB gene after constructing a vector, which was verified by PCR.

FIG. 2 shows the overexpression data of the MpaB gene compared with that of the original strain obtained by RT-PCR after engineering bacteria are obtained.

FIG. 3 is fermentation yield verification data for engineering and primary strains.

FIG. 4 shows biomass change data during fermentation of engineering strains.

FIG. 5 shows the pH change data of fermentation broth during fermentation of engineering strain.

FIG. 6 shows the change data of reducing sugar in fermentation broth during fermentation of engineering strain.

FIG. 7 is a schematic diagram of the construction of a truncated PgpdT promoter.

FIG. 8 is a schematic diagram of the promoter efficiency of a promoter truncated at different positions.

FIG. 9 shows the constructed plasmid map pPKCMH-PgpdT-MpaB-Ttrpc.

Detailed Description

In order to make the technical contents of the present invention more clearly understood, the following examples are specifically described. It is to be understood that the examples are intended to illustrate the invention and are not to be limiting.

Wherein the truncated Pgpd promoter is specifically: the nucleotide sequence 2156bp upstream of ATG from Aspergillus nidulans 3-phosphoglycerate dehydrogenase is the initial promoter sequence, truncated at-1046 bp, forming the truncated Pgpd promoter.

As shown in FIGS. 7-8, the present invention truncates the entire Pgpd promoter at different positions. According to the GeneBank query, the invention uses a 2156bp nucleotide sequence from Aspergillus nidulans 3-phosphoglycerate dehydrogenase ATG upstream as the initial promoter sequence. After verifying that the starting effect is good, the genes are truncated at-1946, -1646, -1346, -1046 and-646 bp, and the starting efficiency of the genes is verified respectively. Experimental results show that the truncated promoter at the position of-1046 bp achieves better starting effect, and the sequence length is reduced by 50% compared with the initial promoter, so that the plasmid load is effectively reduced.

The truncated Pgpd promoter provided by the invention can achieve the purposes of smaller plasmid load and more convenient construction procedure under the condition of not affecting the starting efficiency of the precursor, and the truncated 3-phosphoglycerate dehydrogenase promoter Pgpd is named as PgpdT.

In constructing the pPKCMH-PgpdT-MpaB-Ttrpc as shown in FIG. 9, a truncated promoter PgpdT was used.

The expression vector skeleton pPK2 is stored in the laboratory.

Example 1: obtaining recombinant plasmid pPKCMH

According to Genebank: the MpaB gene sequence in the penicillium brevicompactum mycophenolic acid synthesis gene cluster published by KM595305 is shown as SEQ ID NO.1, the amino acid sequence of the MpaB can be referred to UniProtKB/Swiss-Prot: A0A0B5LB52, and synthetic primers are designed:

P1：5’-gagcagacatcaccATGTCTTTGTCTTTGCCTCCAGC-3’；

P2：5’-CTAATGGAAGGGACATTTCCCC-3’；

according to the gene sequence of Pgpd from Aspergillus nidulans published by Genebank, after truncation verification, the primer is designed and synthesized according to the truncated promoter sequence:

P3：5’-cgaattcttaattaagatatcCCAAATCTGTCCAGATCATGGT-3’；

P4：5’-agacatGGTGATGTCTGCTCAAGCGG-3’；

P5：5’-ggaaatgtcccttccattagTGATTTAATAGCTCCATGTCAACAA-3’；

P6：5’-ccgggtaccgagctcgatatcGTCTAGAAAGAAGGATTACCTCTAA-3’；

homologous recombination fragments of KpnI enzyme cutting sites in a plasmid pPK2 polyclonal site are introduced at two ends of the primers P1 and P6, and PCR reaction is completed by taking penicillium breve and the plasmid pPK2 as templates.

The PCR reaction system is as follows: buffer 25. Mu.L, ddH ₂ O18. Mu.L, template 1. Mu.L, upstream and downstream primers 2. Mu.L each, dNTPs 1. Mu.L, high fidelity enzyme. Mu.L. The PCR reaction conditions were: pre-denaturation at 95℃for 3min; 35 cycles were performed: denaturation at 95℃for 20s, annealing at 60℃for 20s, and extension at 72℃at a rate of 1 Kb/min. Finally, the temperature is kept at 72 ℃ for 10min, and the temperature is kept at 4 ℃ after the reaction is finished. After the reaction was terminated, 1% agarose gel electrophoresis was performed.

After the reaction is terminated, 1% agarose gel electrophoresis detection is carried out, and the purified product is connected with a pPK2 carrier after KpnI digestion after being purified by a PCR purification recovery kit and is sequenced. Nucleic acid pictures of the recombinant plasmid can be seen in FIG. 1.

Example 2: preparation of Agrobacterium tumefaciens perception

Example 3: transformation of pPKCMH into Agrobacterium GV1301 competent by electrotransformation

Example 4: culture of conidium of Penicillium breve

Uniformly coating penicillium brevicompactum spores in eggplant bottles containing PDA culture medium, inversely culturing at 28 ℃ for 8-10 days, collecting spores from PDA plates into 10mL of sterile aqueous solution, vigorously vortexing for 2-5 minutes until the spores are completely dispersed, and filtering the spore suspension with sterile glass filaments to remove mycelia. Transferring the spore suspension into a new sterile 50mL centrifuge tube, centrifuging at 8000rpm for 10min, collecting spores, discarding supernatant, suspending spores with sterile water solution, calculating spore concentration with a hemocytometer, and adjusting to 10 ⁸ cfu/mL, stored in a refrigerator at 4 ℃.

Example 5: agrobacterium tumefaciens mediated binding metastasis

First, the spore concentration was diluted to 10 ⁶ cfu/mL

(1) Placing agrobacterium tumefaciens in a 250mL conical flask containing 20mL of LB, adding the Kazakhstan resistance, and culturing for 16-18h;

(2) Taking 0.5mL of Agrobacterium tumefaciens culture solution, taking 4.5mL of IM culture medium (containing 200 μM AS (acetosyringone)), and placing into a 50mL centrifuge tube so that the final OD600 is about 0.2;

(3) Culturing the mixed liquid in darkness at 28deg.C for 6 hr until OD600 reaches 0.6-0.8;

(4) Mixing 100 μl of induced Agrobacterium tumefaciens and 100 μl of spore solution, placing on cellulose film (Whatman), placing in solid IM culture medium, and culturing at 25deg.C under dark condition for 48 hr;

(5) Transferring the cellulose film to PDA culture medium containing 50 mug/mL hygromycin and 300 mug/mL cytomycin, culturing at 25 deg.C for 4-5 days;

(6) After the transformant grows out, picking a single colony, and carrying out passage on a PDA plate containing resistance until the character is stable;

(7) The genome of the transformant with stable characteristics was extracted and verified by PCR. After the successful PCR verification, the transformant grows mature spores, the transformant is cultured in a liquid PDA culture medium, RNA of the transformant is extracted and reverse transcribed after the transformant grows to the logarithmic growth phase, and qRT-PCR is used for verifying the expression condition of the MpaB gene.

Example 6: qRT-PCR verification-acquisition of recombinant genetic engineering bacteria

The qRT-PCR reaction system is as follows:

The reaction conditions of the qRT-PCR by the two-step method are as follows:

pre-denaturation: 95 ℃ for 30s;

40 cycles: denaturation, 95 ℃,10s, annealing extension, 60 ℃ and 30s;

melting curve: 95 ℃ for 15s;60 ℃ for 60s;95℃for 15s.

Investigation results:

The engineering bacteria are applied to the production of mycophenolic acid.

Example 7: engineering bacteria Penicillium brevicompactum pPKCMH-PgpdT-MpaB-Ttrpc are fermented by glucose shake flask to produce mycophenolic acid.

(1) Starting strain: penicillium brevicompactum pPKCMH-PgpdT-MpaB-Tttrpc

(2) Shake flask seed culture:

shake flask seed medium: glucose 100.0g/L, peptone 15.0g/L, soybean meal 15.0g/L, malt extract 1.0g/L, KH ₂ PO ₄ 1.0g/L，MgSO ₄ ·7H ₂ O0.5 g/L. The pH was adjusted to 6.3 using sodium hydroxide or phosphoric acid.

Culture conditions: 250mL triangular flask, liquid loading amount of 50mL, culture temperature of 28 ℃, rotation speed of a shaking table of 220r/min and culture time of 48 hours.

(3) Primary seed culture:

primary seed medium: glucose 100.0g/L, peptone 15.0g/L, KH ₂ PO ₄ 1.0g/L，MgSO ₄ ·7H ₂ O1.0 g/L. The pH was adjusted to 6.5 using 3M sodium hydroxide or phosphoric acid.

Inoculating: the shake flask seed solution was inoculated into the primary seed medium at 1% inoculum size.

(4) Secondary seed culture:

secondary seed medium: glucose 100.0g/L, peptone 10.0g/L, KH ₂ PO ₄ 1.0g/L，MgSO ₄ ·7H ₂ O1.0 g/L. The pH was adjusted to 6.5 using 3M sodium hydroxide or phosphoric acid.

Inoculating: the primary seed liquid was inoculated into the secondary seed medium at an inoculum size of 10%.

Culture conditions: 250mL triangular flask, liquid loading amount of 50mL, culture temperature of 28 ℃, shaking table rotation speed of 220r/min and culture time of 30 hours.

(5) Fermentation culture:

fermentation medium: 108.0g/L glucose, 0.5 g/L-methionine, 3.3g/L Saccharomyces cerevisiae, feSO ₄ ·7H ₂ O 0.2g/L，MnSO ₄ ·H ₂ O 0.1g/L，ZnSO ₄ ·7H ₂ O 2.5g/L，CaSO ₄ ·2H ₂ O0.3 g/L. The formula of the inorganic salt solution comprises the following steps: KH (KH) ₂ PO ₄ 3.0g/L，MgSO ₄ ·7H ₂ O2.0 g/L. The inorganic salt solution is sterilized separately and then mixed with the base medium solution.

Inoculating: the secondary seed solution was inoculated to the fermentation medium at 15% inoculum size.

Culture conditions: 250mL triangular flask, liquid loading amount of 50mL, culture temperature of 28 ℃, rotation speed of shaking table of 220r/min and culture time of 180 hours.

Comparative example 1: the primary strain Penicillium brevicompactum utilizes glucose shake flask fermentation to produce mycophenolic acid.

(1) Starting strain: penicillium brevicompactum

(2) Shake flask seed culture:

shake flask seed medium: glucose 100.0g/L, peptone 15.0g/L, soybean meal 15.0g/L, malt extract 1.0g/L, KH ₂ PO ₄ 1.0g/L，MgSO ₄ ·7H ₂ O0.5 g/L. The pH was adjusted to 6.3 using 3M sodium hydroxide or phosphoric acid.

(3) Primary seed culture:

(4) Secondary seed culture:

secondary seed medium: glucose 100.0g/L, peptone 10.0g/L, KH ₂ PO ₄ 1.0g/L，MgSO ₄ ·7H ₂ O1.0 g/L. Using 3M oxyhydrogenSodium or phosphoric acid adjusts the pH to 6.5.

(5) Fermentation culture:

The overexpression and fermentation yields of the MpaB genes of example 7 and comparative example 1 are shown in FIGS. 2 to 3, respectively. The biomass change, pH change and reducing sugar change structures during fermentation of the engineering strain in example 7 are shown in FIGS. 4 to 6, respectively.

The present invention is not limited to the above-described embodiments, but covers all changes and modifications that can be made without departing from the spirit and scope of the present invention. Such changes and modifications are not to be considered as departing from the spirit and scope of the present invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the appended claims.

Sequence listing

<110> university of Industy of Huadong

<120> genetically engineered bacterium for high yield of mycophenolic acid, construction method and application thereof

<141> 2021-11-22

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3037

<212> DNA

<213> Penicillium brevicompactum

<400> 1

ccaaatctgt ccagatcatg gttgaccggt gcctggatct tcctatagaa tcatccttat 60

tcgttgacct agctgattct ggagtgaccc agagggtcat gacttgagcc taaaatccgc 120

cgcctccacc atttgtagaa aaatgtgacg aactcgtgag ctctgtacag tgaccggtga 180

ctctttctgg catgcggaga gacggacgga cgcagagaga agggctgagt aataagcgcc 240

actgcgccag acagctctgg cggctctgag gtgcagtgga tgattattaa tccgggaccg 300

gccgcccctc cgccccgaag tggaaaggct ggtgtgcccc tcgttgacca agaatctatt 360

gcatcatcgg agaatatgga gcttcatcga atcaccggca gtaagcgaag gagaatgtga 420

agccaggggt gtatagccgt cggcgaaata gcatgccatt aacctaggta cagaagtcca 480

attgcttccg atctggtaaa agattcacga gatagtacct tctccgaagt aggtagagcg 540

agtacccggc gcgtaagctc cctaattggc ccatccggca tctgtagggc gtccaaatat 600

cgtgcctctc ctgctttgcc cggtgtatga aaccggaaag gccgctcagg agctggccag 660

cggcgcagac cgggaacaca agctggcagt cgacccatcc ggtgctctgc actcgacctg 720

ctgaggtccc tcagtccctg gtaggcagct ttgccccgtc tgtccgcccg gtgtgtcggc 780

ggggttgaca aggtcgttgc gtcagtccaa catttgttgc catattttcc tgctctcccc 840

accagctgct cttttctttt ctctttcttt tcccatcttc agtatattca tcttcccatc 900

caagaacctt tatttcccct aagtaagtac tttgctacat ccatactcca tccttcccat 960

cccttattcc tttgaacctt tcagttcgag ctttcccact tcatcgcagc ttgactaaca 1020

gctaccccgc ttgagcagac atcaccatgt ctttgtcttt gcctccagca ctttctgagc 1080

ttgcgagggc acttccctac agcagaactc aatggcttcc aatcttggtg ggatttctga 1140

ttgggtaccc cctcctcatc aaggcattgc gttataagcg acttggagag atgaagaaga 1200

agttctattt cccaactcgc gagtctatgg ctgaaatgac cgatgaggag gcattcctga 1260

ttcaaaagga aatggcacag ctcgagtttc cattcatgtt cttgacatct gggcagtttg 1320

cactattccg ggtatgcagt tcaatttcat tgattatata gttctataca cgaaagccac 1380

acgggcacct ttgcttgaac ttgatttatc tttttctaat catttacaga catatggcat 1440

tccgacaatc tctcatcttc taacgaaaac cgggcaattc tccaagccag aaacatcttt 1500

caaacgctat acagacacag ctgctctgat tggtgaaatg gtagagaata gtcctacctc 1560

gcagagggca ttcatctcag tagcccgcac acgattccta catagcggct atcaagcttc 1620

gggcaagatc ctcgatgctg atttgcttta cacccttgca ctctttgcgg tccaacctgt 1680

gcgatttatt gagaattttg aatggcggac cttgagtgat ttggaactct gtgctattgg 1740

gaccttttgg aagagtctag gtgatgcttt gggtattagc tctgagattc ttccatcggg 1800

caagaccggc ttcaaagatg gtatccaatg gcttgaagag gtggatgttt ggagtcagga 1860

ttatgaggcc aagtatatgg tcccagatcc caagaaccgc gagtcagcag accaagcgac 1920

ggcagttctg ctttacaatc tgccgaagat tttgcatcca ataggactgc agtttacatc 1980

ttatatgatg gatgatcggt tgaggaaggc gatgttgtat gtgatattag tccattcgag 2040

atcctaccat ttgatcctgt atacaatcac agatactaac ttcaaacaga tacgaggccc 2100

caagtcctgg ctggagcgct gttttctcat ccctcttggc tactcgcaag ttcgttctgc 2160

gttatctatc gccaccacgg cctgcggctc ttgcagtgtc aaacatagct caaaagcccg 2220

acaaagatga tcgctatcac cgcatgtctt gggatgcact cccattttac atcaggccta 2280

ctttctggaa tagatggggt ccaatggctt ggatctcttg gttgatggcc caccctgtcc 2340

caggcgatca tggccagaag tactatccac agggatatca tatacaagat attggaccaa 2400

aatactttga aggaaagggc cacaaggaaa tccaggaaat gatgaaggaa ttaaagatct 2460

caaggacggg gaaatgtccc ttccattaga gtagatgccg accgggatcc acttaacgtt 2520

actgaaatca tcaaacagct tgacgaatct ggatataaga tcgttggtgt cgatgtcagc 2580

tccggagttg agacaaatgg tgttcaggat ctcgataaga tacgttcatt tgtccaagca 2640

gcaaagagtg ccttctagtg atttaatagc tccatgtcaa caagaataaa acgcgtttcg 2700

ggtttacctc ttccagatac agctcatctg caatgcatta atgcattgga cctcgcaacc 2760

ctagtacgcc cttcaggctc cggcgaagca gaagaatagc ttagcagagt ctattttcat 2820

tttcgggaga cgagatcaag cagatcaacg gtcgtcaaga gacctacgag actgaggaat 2880

ccgctcttgg ctccacgcga ctatatattt gtctctaatt gtactttgac atgctcctct 2940

tctttactct gatagcttga ctatgaaaat tccgtcacca gcccctgggt tcgcaaagat 3000

aattgcactg tttcttcctt gaactctcaa gcctaca 3037

Claims

1. A genetic engineering bacterium for high yield of mycophenolic acid is characterized in that penicillium brevicompactum is taken as a chassis cell, a recombinant plasmid ppkCMH formed by an MpaB gene and a ppK2 plasmid is expressed, the nucleic acid sequence of the MpaB gene is shown as SEQ ID NO.1, the expression of the MpaB gene is started by a truncated Pgpd promoter, the recombinant plasmid ppkCMH is transferred by the mediation of agrobacterium tumefaciens GV3101, the co-culture temperature is 25 ℃ during the transfer by the mediation of the agrobacterium tumefaciens GV3101, and the truncated Pgpd promoter is specifically as follows: the nucleotide sequence 2156bp upstream of ATG from Aspergillus nidulans 3-phosphoglycerate dehydrogenase is the initial promoter sequence, truncated at-1046 bp, forming the truncated Pgpd promoter.

2. The construction method of the genetically engineered bacterium for high yield of mycophenolic acid is characterized by comprising the following steps: the nucleic acid sequence of the MpaB gene is shown as SEQ ID NO.1, the truncated Pgpd promoter is used for promoting the expression of the MpaB gene, the recombinant plasmid pPKCMH is transferred to penicillium brevicompactum through the mediation of agrobacterium tumefaciens GV3101, and the co-culture temperature is 25 ℃ during the mediation transfer of the agrobacterium tumefaciens GV3101, so that the genetically engineered bacterium for producing mycophenolic acid in high yield is formed;

the truncated Pgpd promoter is specifically: the nucleotide sequence 2156bp upstream of ATG from Aspergillus nidulans 3-phosphoglycerate dehydrogenase is the initial promoter sequence, truncated at-1046 bp, forming the truncated Pgpd promoter.

3. The construction method according to claim 2, wherein the MpaB gene is amplified from Penicillium breve.

4. The construction method according to claim 2, wherein the recombinant plasmid pPKCMH is formed by the MpaB gene and the pPK2 plasmid, specifically:

the truncated Pgpd promoter PgpdT, the MpaB gene and the aspergillus nidulans tryptophan synthesis gene terminator Ttrpc are connected at the multiple cloning site of the pPK2 plasmid to obtain the recombinant plasmid pPKCMH-PgpdT-MpaB-Ttrpc.

5. Use of the genetically engineered bacterium of claim 1 or the genetically engineered bacterium obtained by the construction method of any one of claims 2 to 4 in the production of mycophenolic acid.