CN111484993B - Long-chain non-coding RNA IL21-AS1 and application thereof - Google Patents
Long-chain non-coding RNA IL21-AS1 and application thereof Download PDFInfo
- Publication number
- CN111484993B CN111484993B CN202010368473.2A CN202010368473A CN111484993B CN 111484993 B CN111484993 B CN 111484993B CN 202010368473 A CN202010368473 A CN 202010368473A CN 111484993 B CN111484993 B CN 111484993B
- Authority
- CN
- China
- Prior art keywords
- long
- coding rna
- cells
- cell
- naive
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Hematology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a long-chain non-coding RNA IL21-AS1, a vector capable of expressing long-chain non-coding RNA IL21-AS1 and application thereof; also provided are methods for inducing a Naive T CD4+ T cell into a TFH cell, and uses of non-coding RNA IL21-AS1 in the preparation of a substance for inducing IL-21 secretion.
Description
Technical Field
The invention relates to the field of biomedicine, in particular to long-chain non-coding RNA and application thereof.
Background
Long non-coding RNA (LncRNA) is non-coding RNA with a length of more than 200 nucleotides, generally between 200 and 100000nt, and does not code for protein transcripts. The LncRNA is classified into antisense long noncoding, intron noncoding, intergenic, untranslated region LncRNA, etc. according to the location and background in the genome. LncRNA plays an important role in the field of life science research, and relates to DNA replication, transcriptional regulation, intracellular substance transport, chromosome remodeling, epigenetics, participation in cell differentiation, apoptosis and the like. LncRNA is involved in the processes of growth and development in organisms, stress response, occurrence and development of diseases including cancer, autoimmune diseases and cardiovascular diseases.
The expression vector is a vector in which an expression element such as a promoter, RBS, terminator and the like is added on the basis of the basic skeleton of a cloning vector to enable a target gene to be expressed. In the construction process, the ends matched with the target genes are cut by using restriction endonuclease, mostly viscous ends and also flat ends, and are connected by adopting DNA ligase and introduced into organisms to realize cloning expression.
Follicular helper T cells (TFH), an important helper cell, Th cell subset, are derived primarily from tonsil tissue, localizing lymphoid follicles. TFH is different from CD4+ T cells such as Th1, Th2, Th17 and the like, the phenotype of the TFH is CXCR5+ ICOS + PD1+, intracellular transcription factors BCL-6 and TOX2 are highly expressed, and a large amount of secreted IL-21 is synthesized. The main functions of TFH are to assist B cell activation and maturation: TFH high expression CXCR5 and CXCL3 combine to migrate to a follicular region to participate in the formation of a Germinal Center (GC), TFH secretes IL-21, induces B cells to differentiate and mature into plasma cells, secretes IgM, IgG and IgA, and can also regulate the isotype switching of Ig. Excessive TFH numbers or over-function lead to autoimmune diseases and conversely to immunodeficiency diseases. TFH is involved in the development of autoimmune diseases such as SLE, RA, Graves disease and tumors. The condition of inducing and differentiating TFH by the Naive CD4+ T cell in vitro is mature, and a cell model is provided for researching the development, differentiation and function of TFH.
Whether long non-coding RNAs are involved in the development and differentiation of TFH, and their specific functions, is not known, and the present invention addresses at least some of these problems.
Disclosure of Invention
The invention provides a full-length sequence (SEQ ID No: 1) of long-chain non-coding RNA IL21-AS 1.
The invention also provides an expression vector capable of expressing the long-chain non-coding RNA IL21-AS 1; the aforementioned expression vector may be a plasmid or a virus; preferably, the aforementioned plasmid is pcDNA3.1 expression plasmid.
The invention provides a Naive CD4+ T cell, which contains the expression vector. The invention also provides a method for constructing the Naive CD4+ T cell, which comprises transfecting the expression vector into the Naive CD4+ T cell, preferably using pcDNA3.1-IL21-As1 expression vector containing long-chain non-coding RNA IL21-AS1 to the Naive CD4+ T cell.
The invention provides a method for inducing a Naive CD4+ T cell into a follicular helper T cell, the method comprising: pcDNA3.1-IL21-As1 expression vector containing long non-coding RNA IL21-AS1 was electroporated into Naive CD4+ T cells, and the resulting transfected cells were cultured for 3 days. The present invention also includes follicular helper T cells obtained by the aforementioned method.
The invention provides application of a long-chain non-coding RNA IL21-AS1 and an expression vector containing the long-chain non-coding RNA IL21-AS1 in preparing a substance for inducing a Naive CD4+ T cell to be differentiated into a follicular helper T cell. Further, increased IL-21 expression in the obtained follicular helper T cells is compared to IL-21 expression in naturally occurring follicular helper T cells.
The invention provides application of a long-chain non-coding RNA IL21-AS1 and an expression vector capable of expressing a long-chain non-coding RNA IL21AS1 in preparation of a substance for inducing IL-21 secretion.
The invention has the advantages that:
1. the full-length sequence of the long non-coding RNA IL21-As1 was obtained.
2. An expression vector of the long-chain non-coding RNA IL21-As1 is constructed.
3. The function and the application of a part of the long-chain non-coding RNA IL21-As1 are proved.
4. It is verified that the expression vector capable of expressing the long-chain non-coding RNA IL21-As1 promotes the differentiation of the Naive CD4+ T cells to TFH cells and further promotes the increase of IL-21 secreted by the TFH cells.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention. In the drawings:
FIG. 1 shows the sequence of the long non-coding RNA IL21-As1 of the invention;
FIG. 2 shows the results of 1% agarose electrophoresis of eukaryotic expression vector pcDNA3.1-IL21-AS1 after double digestion, wherein, lane 1: pcDNA3.1; lane 2 pcDNA3.1-IL21-AS1 cleavage product Lane M KB Ladder;
FIG. 3 shows RT-qPCR to verify the over-expression effect of expression vector pcDNA3.1-IL21-AS1 in TFH cells.
FIG. 4 shows the transfection of Naive CD4+ T cells with pcDNA3.1 and pcDNA3.1-IL21-As1, respectively, after 3 days of transfection, flow cytometry sorting and the proportion of TFH cells (.: P < 001).
FIG. 5 shows that pcDNA3.1 and pcDNA3.1-IL21-As1 were transfected into Naive CD4+ T cells, respectively, and cultured for 3 days after transfection, and IL-21 expression was confirmed by RT-qPCR (P < 001).
FIG. 6 shows that pcDNA3.1 and pcDNA3.1-IL21-As1 were transfected with Naive CD4+ T cells, respectively, and cultured for 3 days after transfection, and the expression of IL-21 in the cell culture medium supernatant was detected by ELISA.
Detailed Description
The preferred embodiments of the present invention will be described in conjunction with the accompanying drawings, and it will be understood that they are described herein for the purpose of illustration and explanation and not limitation.
The experimental reagents and instruments involved in the examples of the present invention were as follows:
TRNzol Universal is provided by TIANGEN,
RACE5 '/3' Kit is supplied by Clontech, Gel Extraction Kit is supplied by OMEGA,
max DNA Polymerase is supplied by Takara, pEASY-Blunt Cloning Kit is supplied by TransGen Biotech, Transns 1-T1Phage Resistant chemical Complex Cell is supplied by TransGen Biotech, Green Taq Mix is supplied by Vazyme; p3 Primary Cell 4D-Nucleofector X Kit transfection reagent and a matched transfection instrument, supplied by LonZa; growth medium 1640 was supplied by Gibco; FBS fetal bovine serum is supplied by Gibco; the centrifuge manufacturer is a Thermo company in America, and the model is an FRESC017 high-speed freezing centrifuge; the electrophoresis apparatus manufacturer is BIO-RAD company in America, and the model is PowerPacTMand Mini-Sub cell GT; the gel imager manufacturer is BIO-RAD company in America, and the model is ChemiDocTMXRS + System; murine anti-human CD3 antibody, murine anti-human CD28 antibody, human-IL 6, human-IL 12 and human-TGF β are supplied by peprotech corporation, murine anti-human CD4-FITC antibody, murine anti-human PD1-APC antibody, murine anti-human CXCR5-percp-cy5.5 antibody; a Naive CD4+ T Cell Isolation Kit II is available from Miltenyi. The Human-IL21ELISA detection kit is provided by proteintech.
Example 1 RACE experiments to determine the full Length of the Long non-coding RNA IL21-As1 Gene
1.1RNA extraction (TIANGEN instructions, the content of which is incorporated by reference)
1.2RACE-Ready cDNA Synthesis
RACE-Ready cDNA synthesis was performed according to SMARTERRACE5 '/3' Kit instructions.
The 3 'and 5' RACE specific amplification primers were designed as follows:
smart-3' RACE inner primer: GCCTATGACCCTGGTGTCGTTT (SEQ ID No: 2)
Smart-3' RACE outer primer: TTTTGCTCTGTGAGTGTTGGGC (SEQ ID No: 3)
Smart-5' RACE inner primer: CACCACCGGTTGAGAACCACT (SEQ ID No: 4)
Smart-5' RACE outer primer: ACCTCACGGAAGGCCAAAGACAAGA (SEQ ID No: 5)
1.3PCR amplification, product recovery and ligation reactions (routine procedures, reference molecule cloning)
1.4 transformation, PCR cloning and sequencing verification (routine procedures, reference molecular cloning)
Long non-coding RNA IL21-As1 was subjected to DNA sequencing validation (supplied by Kjekey Biotech, Inc. of Shanghai) As shown in FIG. 1.
Example 2: and (3) constructing a long-chain non-coding RNA IL21-AS1 expression plasmid vector.
Firstly, a long-chain non-coding RNA IL21-AS1 (shown in figure 1) gene (provided by Nanjing King Shirui biotechnology company) is synthesized, and then the gene is connected to vector plasmid obtained by BamH I and XhoI enzyme digestion of pcDNA3.1 to obtain pcDNA3.1-IL21-AS1 expression plasmid. The specific construction process is as follows:
(1) the pcDNA3.1 is subjected to double enzyme digestion, namely 4 mu g of the pcDNA3.1 vector is taken into an EP tube and is subjected to double enzyme digestion by using BamH I and XhoI, and the system is as follows
Enzyme-free water was added to make up a total volume of 50. mu.L, and the digestion was carried out at 37 ℃ for 20 minutes (min).
(2) The long-chain non-coding RNA IL21-AS1 gene is connected with the gene (1): the system is as follows
Enzyme-free water was added to make up a total volume of 20. mu.L, ligated at 37 ℃ for 30 minutes (min), and ice-cooled for 5 min.
(3) Transforming the obtained in step (2) to a competent amplification and extracting plasmid: thawing 100uL DH5 alpha competent bacteria on ice, adding 4uL pcDNA3.1-IL21-AS1, mixing, performing ice bath for 30min, immediately performing water bath at 42 ℃ for 45 seconds(s), immediately performing ice bath for 2min, transferring to 1mL LB culture medium, performing shaking culture at 37 ℃ and 225r/min for 1h, coating the obtained bacteria on an LB culture plate (Amp concentration of 100 mu g/mL) and culturing in an incubator at 37 ℃ for 12h, selecting a single colony, placing the single colony into the LB culture medium (Amp concentration of 100 mu g/mL), performing shaking culture at 37 ℃ and 300r/min for 15h, and extracting the plasmid pcDNA3.1-IL21-AS1 to obtain the recombinant plasmid. (4) Carrying out enzyme digestion and sequencing identification on the plasmid obtained in the step (3): the enzyme digestion system is as follows,
adding enzyme-free water to make the total volume 50 μ, and performing enzyme digestion reaction at 37 deg.C for 20 min.
5ul of DNA Marker and 5. mu.L of the cleaved product were detected by electrophoresis on a 1.5% agarose gel, as shown in FIG. 2.
Example 3: the expression plasmid vector containing the long-chain non-coding RNA IL21-AS1 is used for transfecting Naive CD4+ T cells, the cells are cultured, and the expression result is verified
3.1 sorting of mononuclear cells (PBMC) from whole blood, requiring a whole process of aseptic manipulation, the main steps are as follows:
(1) collecting 100ml of heparin anticoagulation, and performing Ficoll PBMC sorting: diluting whole blood with PBS for three times at room temperature;
(2) adding 15ml of Ficoll into a 50ml centrifuge tube at room temperature for later use;
(3) adding 35ml of diluted whole blood obtained in the step (1) into each centrifugal tube in the step (2), wherein the operation action is required to be gentle, and the liquid level is ensured to be layered obviously for later use;
(4) adjusting the horizontal centrifuge to a centrifugal force of 750g, a temperature of 20 ℃, an acceleration of 8 and a deceleration of 0, balancing the sample obtained in the step (3), and centrifuging for 20min for later use;
(5) sucking the cloudy liquid enriched with the PBMC cells in the step (4) to a 50ml thin core tube by a Pasteur pipette, storing 15ml of the liquid in each tube, supplementing 35ml of PBS into the residual volume, and uniformly mixing for later use;
(6) adjusting the centrifugal force of the horizontal centrifuge to 350g, the temperature of 4 ℃, the acceleration of 8 and the deceleration of 9, balancing the sample in the step (5), and centrifuging for 10min for later use;
(7) discarding the supernatant of (6), resuspending the cell pellet with 15ml Buffer (PBS + 0.5% BSA), transferring to a 15ml centrifuge tube for use;
(8) adjusting the centrifugal force of the horizontal centrifuge to 300g, the temperature of 4 ℃, the acceleration of 8 and the deceleration of 9, balancing the sample in the step (7), and centrifuging for 10min for later use;
(9) the supernatant (8) was discarded, the cell pellet was resuspended in 5ml buffer (PBS + 0.5% BSA), an appropriate cell sample was taken, and the number of viable cells was counted using 0.45% trypan blue for use.
3.2 magnetic bead sorting of Naive CD4+ T cells
The procedure was performed strictly according to the Naive CD4+ T Cell Isolation Kit II instructions (Miltenyi Inc.), which are incorporated herein by reference, and the whole procedure was aseptically performed to obtain Naive CD4+ T cells for use.
3.3 transfection of Naive CD4+ T cells (4D-Nucleofector) by electrotransfectionTMX Unit, Lonza), the procedure was as follows:
(1) each reaction requires a quantity of Naive CD4+ T cells of 5 x10 or more6After cell counting is confirmed, the cell is ready for use;
(2) taking pcDNA3.1-IL21-AS1 and pcDNA3.1 plasmid 4ug, and putting into an EP tube for later use;
(3) 200ul transfection reaction solution was added with 1x107Mixing the Naive CD4+ T cells uniformly, adding 100ul of the mixture into the step (2) respectively, and mixing uniformly for later use;
(4) transferring the cell suspension in the step (3) into a transfection cup to ensure that no air bubbles exist, and covering the bottom of the electric rotating cup with the cell suspension for later use;
(5) debugging electrotransformation instrument 4D-NucleofectorTMCore Unit parameters: human unscheduled cell-high functionality for use;
(6) the reaction cup of (4) is correctly aligned and placed in the procedure of (5) for electrotransfection.
3.4 cell culture and RNA extraction after electroporation as follows:
(1) the cells after the electroporation were pipetted into a six-well plate of prepared 1640 medium at 37 ℃ with 5% CO using a micropipette (provided by Lonza kit)2The incubator (2) is cultured for 6 hours to restore the cells to the state.
(2) The cells of (1) were collected in a 15ml centrifuge tube with a centrifugal force of 300g, the sample was trimmed and centrifuged for 10min, the cells were left and resuspended in 6ml 1640 culture (1640+ 10% FBS) for use.
(3) The cell suspension of (2) was divided into three equal portions, and cultured in a 12-well (2ug/ml) plate previously coated with mouse anti-human CD3 antibody at 37 ℃ with 5% CO2The culture box is used for culturing for 48h and 96h for standby.
(4) The cells cultured for 48h were collected and total RNA was extracted by Trizol method.
3.5 detection of transfection results
3.5.1 cells after transfection were cultured for three days for expression detection:
(1) synthesizing cDNA using RNA as a template (reverse transcription kit from takara);
(2) RT-qPCR (Roche) detects the over-expression effect of long-chain non-coding RNAIL21-AS1, RT-PCR detects long-chain non-coding RNAIL21-AS1, and the picture shown in figure 3: the expression of the long-chain non-coding RNAIL21-AS1 of the experimental group pcDNA3.1-IL21-AS1 is 100 times higher than that of the pcDNA3.1 control group, which indicates that the pcDNA3.1-IL21-AS1 is transfected successfully.
3.5.2 cells cultured for 3 days after transfection were collected, the proportion of TFH cells was detected by flow cytometry, and the expression of IL-21 was detected by RT-qPCR and ELISA, respectively, as follows:
flow cytometry to detect the proportion of TFH cells: respectively collecting experimental group pcDNA3.1-IL21-As1, control group pcDNA3.1, negative control and compensation control CD4, PD1 and CXCR5, and the cell number per tube is 1X106And adding a labeled fluorescent monoclonal antibody into each labeled tube. The fraction of TFH cells was measured using a flow cytometer BD FACScantoII (both the antibody and the instrument used in the above procedure were from BD Bioscience), and the results of the flow cytometry analysis are shown in FIG. 4: three days after transfection, the PD1+ CXCR5+ double positive cells (differentiated TFH cells) of experimental group pcDNA3.1-IL21-AS1The ratio of the transfection is 20% higher than that of the control group of pcDNA3.1, which indicates that the transfection of pcDNA3.1-IL21-AS1 promotes TFH differentiation.
Collecting cells 3 days after the transfection of the experimental group pcDNA3.1-IL21-As1 and the control group pcDNA3.1, and taking 5 x10 cells5And detecting the expression of IL21 by RT-qPCR, wherein the experimental result is shown in figure 5: three days after transfection, the expression level of IL21 mRNA of the experimental group pcDNA3.1-IL21-AS1 was 2.2 times that of the pcDNA3.1 control group, which indicates that the transfection of pcDNA3.1-IL21-AS1 promoted the expression of IL21 mRNA. Wherein, the following primers are used in RT-qPCR:
IL21：
F：TGGTCCCTGAATTTCTGCCAG(SEQ ID No：6)
R：TTAGTTGGGCCTTCTGAAAGCA(SEQ ID No：7)
β-actin
F：GAGCTACGAGCTGCCTGACG(SEQ ID No：8)
R：GTAGTTTCGTGGATGCCACAG(SEQ ID No：9)
LncRNA-IL21AS1：
F：AACTACATGCCAGGCCTCTT(SEQ ID No：10)
R：AGGTCAAGATCGCCACATGA(SEQ ID No：11)
cell culture supernatants of the experimental group pcDNA3.1-IL21-As1 and the control group pcDNA3.1 after 3 days of transfection were collected, ELISA was used to detect the expression of IL-21, and the experimental results are shown in FIG. 6: three days after transfection, the expression level of IL21 mRNA of the experimental group pcDNA3.1-IL21-AS1 was 1.5 times that of the pcDNA3.1 control group, which indicates that the transfection of pcDNA3.1-IL21-AS1 promotes the expression of IL21 protein.
According to the above experimental results, those skilled in the art can determine that the overexpression of the long-chain non-coding RNA IL21-AS1 promotes the differentiation of the Naive CD4+ T cells into TFH cells and improves the expression of IL-21; TFH cells play an important role in the occurrence of various autoimmune diseases, so that the expression vectors of long-chain non-coding RNA IL21-AS1 and long-chain non-coding RNA IL21-AS1 can be used for preparing substances for promoting the differentiation of Naive CD4+ T cells to the TFH cells and substances for promoting the expression of IL-21 in the TFH cells.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<110> Xiangya II Hospital of Zhongnan university
<120> long non-coding RNA IL21-AS1 and application thereof
<130> CP20122
<141> 2020-04-30
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4082
<212> RNA
<213> human (human species)
<400> 1
gacccaagct ggctagcgtt taaacttaag cttggtaccg agctcggatc cggagaatcg 60
cttgaacctg ggaggcagag gttgcagtga gctgagatcg caccactgca ctccagccta 120
gcaacatatc gagactccgt ctcaaaaaaa aaaaaaaaaa aaaaaaaaaa ggattacctt 180
tgtcctacac acaaactagg tttatatcag ggtttctcaa cggtgatacc actgacattt 240
ggggctagat aattctttgt tgtcagggct gtcttgtgca ttctagaatg tttagtacct 300
ggcttctacc tactagatgc cagtagcacc cccattctac ctccaagtgt gacaaccaga 360
aatttttcca gccaatgcca aatgttttct ggggcacaaa aatcaccacc ggttgagaac 420
cactggttat atgattagac ggaaagaaaa agagaaaaag aaagatgcct ggctaggcca 480
attagagatc ttagataatt actatatgca tgcaacatta gatagtttta ttttcattaa 540
acttttaaat cttttaaaat ctcttacaga ccctactttg aagctagctt gatataatgc 600
taatgtgacc ttgaacgatt tctttcttcc tgagtttgcc tactagtata gcttaaagat 660
ccaagttaca ctattactca cttatatcat agccagcatt gcttgatcag attatcagat 720
agatacagta tcacggagac aaaatccttt cattatgatg taagataaaa aatatctttc 780
attaacaaca cacgtaaagg aagtacccac tggaccaact caggttagaa gggtaccaga 840
ccagaagatc agatcgtaga agttactgga gaaaaagatc agcggacagc actcttgaac 900
tacatgccag gcctcttctt cctggaactc taatggattt aaatggctta agagacggga 960
tgaattgttg aaaatggttc tttcaaaaga cctcacggaa ggccaaagac aagactcact 1020
gaggccaagc tgatcaacaa tatctataag ttgacgcatt ctaatcatgt ggcgatcttg 1080
accttgggag cttgatttgt ggaccagtgt ccccaagaag atgaccatca gacagatgac 1140
aatcctctcc atgttgccag gactggatct cataagtacc aacagtagag ctagaccttg 1200
gtctcgtttt cacttcagct tgactgagaa caggtatacg tgtgcatgtg ctaatgtgtg 1260
ggggcaggga ttgatggagt caacgaaatg tgccccatct gcatctttga caggaaaaag 1320
agagaatggg tgaattccaa ttttcagcat gaatcaagaa tgtcaccgat gaagtttttg 1380
aatgctgtgc tcctaatctc attttcctcc tccagagact tcggtgaagg atgatgcaaa 1440
ctgtgtttct tcagcatgtg agcaccatca gccatgagtg tggcagctcc agaatgtcta 1500
taccagagtg gctgagagtc agcaacttgg ctggaagcta cacttgaata gcaaacaaac 1560
cacttttact tagtttccat gtctatttgg taccttggag tacagtgatg agttttacta 1620
gatgtggact ttccaggaat atagccaagg tcgtcaccat gaaagtatga aactttagtc 1680
atttacccaa ggggattcat ggacatatat taagaatttt ctttaatgga ctgtgtttat 1740
agaacacctg gtcaggacgg aaatgaggcc agggaactaa aggggtagaa gtctgaagag 1800
gaatggtttt gcatgggaaa actgtgccag gtctaaaact gggctgaaca ctatttgtcc 1860
ccaactctct ggcccggtcc tcatagttct ttctgtgatc cctgcgtggt gaatactcct 1920
tttctgcttt cactggcttt ggcccctcat ggatagaatt agatgttctg catggcaaac 1980
tgtgggaaga gaggcctcca gtgtttagag tgatattatc atgtgtacca ctactattat 2040
acatactaaa ggtattcaga caggtggctt gtctctgggc tttatataga tctctgtcaa 2100
gctagaagaa aaatgtcact aaaataattc aagacaattt ttgtactttc caacgatgtt 2160
caggtaacag ctgaaaatat tctcacttat ttgacttgag gaagaaaatt cgaacgagga 2220
aaatcatcaa ggatttgcta aagtcccttc tgtaaaatct tccttaagga agtttaaaca 2280
ctcctattct ctcttctctc attcttttga actcactgca tgtattgata tcactgactt 2340
ggtttgtttt ctagaatata tgtaaaagta agagtgtgta tatataaccc attatgtaca 2400
taacaagaac agttccttcc aatattcaaa tttcatgact ctagatcact actgtgcatt 2460
ctaagaaggt cagggactca tggagaccaa agggtcaatc ctggtcattg ttgtcttacg 2520
agagaaaaac aagagccttc tcgggccccg tgttctctag ctcttgatgt ggcctcttcg 2580
gtatcactgg cagccccaca gtctggtggt cagtgtgtcg cagcagaggg tcattcaccg 2640
atgctgctta tccacagcac cttttctgtg gggaatgggg gcctctattc tgctagtaga 2700
ctcaggtgtg tcactctgtg atactcttaa gactgggttc attgaggaca ggtctctttg 2760
ctaacattca cacaaagtca ttgtttggaa gcacagtcct gcttctgaaa tgctaggtct 2820
ggaggagttc cagcagcagc cacatgggcc ctctcctcag atcttggctc caacatggga 2880
tactcagcag tgaggctaga gatcagatgt ccttcattcc ttgaccacta agcctagagg 2940
atggagagaa agaagtggaa catctgcact cttcaacctg agtccactcc aactccatcc 3000
cacaagggaa ctgcctccat tgctgatgtt ggattaaaca gaacagcctg tgcagttagt 3060
tcatggattc cataaaggga ctggacctta atgaagacgt tcctgacatg ggtttgggca 3120
agaagatatt ataattttgc aaatgaagaa actgagatac agaaatgaca tccagcaccc 3180
tcagtgtcac acagagagta aatggactgg cctgaaccag gctgcctcct ggaactggtt 3240
tctttggttg gttgaatcca tggatggaga actcgtggat acaagggctg actataatga 3300
gaagatatga aagctgaaaa gacaaacatt actacatatt tacatatgtc caaagaagaa 3360
ggttcatctc cacgtggacc tccctataga gcttcttgaa tggcctcaca acatggcggc 3420
tggcttccca cagagtgagc aatccaagat ttccttgatt cagagaaaga agataaaaac 3480
acatacaaag agacggcacc agctcctttc ccagttgtga ccagattgca cgatacccaa 3540
gccatggctc caaagagtgc gtgtactgaa gcctggccat tcatgacaga ctcatttcca 3600
cacctgagtc cggttttgct ctgtgagtgt tgggctttct ccaagggaat ggttggagct 3660
gttgcgagcg aacttcctgg ctgccacaga gttgattgga ttccttggaa atgcacactc 3720
acaggctgct gctctttgaa gctgtctcct tcactggcca tgattctcct gtctcattag 3780
ctgttgccta tgaccctggt gtcgttttct ccttttactc atcaacaccc aaatccacag 3840
ggttgtgatg gattagcagc ctttcttatt agcaagaagc cctgtggcct caagaggcaa 3900
aatgaatcgt ggttagaaat ctccatctcc tccctccctt ggtataatgc catcatttaa 3960
ctatctgaaa atagagaaga ctccgttcca attgtaaagc cctaaggaga aaaactgagt 4020
ttgaaacttt ccttaattat gctgatattt aacaataaac tttgtagtat gaaaatctca 4080
aa 4082
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gcctatgacc ctggtgtcgt tt 22
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ttttgctctg tgagtgttgg gc 22
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
caccaccggt tgagaaccac t 21
<210> 5
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
acctcacgga aggccaaaga caaga 25
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tggtccctga atttctgcca g 21
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ttagttgggc cttctgaaag ca 22
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gtagtttcgt ggatgccaca g 21
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
Claims (6)
1. A Naive CD4+ T cell, wherein the Naive CD4+ T cell contains an expression vector capable of expressing long-chain non-coding RNA IL21-AS1, and the nucleotide sequence of the long-chain non-coding RNA IL21-AS1 is shown in SEQ ID No: 1 is shown.
2. Method for constructing a Naive CD4+ T cell according to claim 1, wherein an expression vector capable of expressing long non-coding RNA IL21-AS1 is transfected into a Naive CD4+ T cell.
3. A method for inducing Naive CD4+ T cells into follicular helper T cells, wherein transfected cells obtained according to the method of claim 2 are cultured for an additional 3 days.
4. Use of long-chain non-coding RNA IL21-AS1 or an expression vector capable of expressing long-chain non-coding RNA IL21-AS1 in preparation of a substance for inducing a Naive CD4+ T cell to differentiate into a follicular helper T cell, wherein the nucleotide sequence of the long-chain non-coding RNA IL21-AS1 is shown AS SEQ ID No: 1 is shown.
5. Use according to claim 4, characterized in that the follicular helper T cells express increased IL-21.
6. Use of long non-coding RNA IL21-AS1 or an expression vector capable of expressing long non-coding RNA IL21-AS1 in the preparation of a substance for inducing IL-21 secretion, wherein the nucleotide sequence of the long non-coding RNA IL21-AS1 is shown AS SEQ ID No: 1 is shown.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010368473.2A CN111484993B (en) | 2020-04-30 | 2020-04-30 | Long-chain non-coding RNA IL21-AS1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010368473.2A CN111484993B (en) | 2020-04-30 | 2020-04-30 | Long-chain non-coding RNA IL21-AS1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111484993A CN111484993A (en) | 2020-08-04 |
| CN111484993B true CN111484993B (en) | 2021-06-22 |
Family
ID=71793046
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010368473.2A Active CN111484993B (en) | 2020-04-30 | 2020-04-30 | Long-chain non-coding RNA IL21-AS1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111484993B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112501192B (en) * | 2020-11-20 | 2022-03-01 | 中南大学湘雅二医院 | Hybridoma cell strain for generating anti-human IL21 monoclonal antibody and application thereof |
| CN117645673B (en) * | 2023-11-22 | 2024-05-10 | 武汉大学 | Fusion protein of IL-21, sCD4 and Fc and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106884016B (en) * | 2017-02-13 | 2020-02-14 | 中南大学 | Expression vector and anti-tumor reagent of long-chain non-coding RNALINC00472 and application thereof |
| CN109369797B (en) * | 2018-12-06 | 2020-02-14 | 中南大学湘雅二医院 | Recombinant human IL-21 protein and preparation and application thereof |
-
2020
- 2020-04-30 CN CN202010368473.2A patent/CN111484993B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111484993A (en) | 2020-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2023204606A1 (en) | Genetically modified cells, tissues, and organs for treating disease | |
| CN110691844B (en) | Methods and kits for generating simulated innate immune cells from pluripotent stem cells | |
| CN111909966B (en) | Method for preparing modified immune cells | |
| CN111484993B (en) | Long-chain non-coding RNA IL21-AS1 and application thereof | |
| CN111154763B (en) | Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function | |
| CN114230658B (en) | Novel coronavirus specific T cell receptor and uses thereof | |
| CN113801881B (en) | Use of super enhancer gene sequence in promoting human B2M gene expression | |
| CN110747230B (en) | Method for promoting bovine skeletal muscle satellite cell myogenic differentiation | |
| CN112626027A (en) | Treg cell culture method | |
| CN112194717A (en) | Peptide segment Tr for promoting regeneration of cochlear hair cells and application thereof | |
| CN114729320B (en) | Compositions, methods and uses for reprogramming cells to dendritic cell type 2 capable of presenting antigen | |
| CN110760480A (en) | Anti-tumor NK (Natural killer) cell and preparation method thereof | |
| CN111440245B (en) | Chimeric antigen receptor T lymphocyte for targeted therapy of solid tumor | |
| CN113684184A (en) | Method for preparing chimeric antigen receptor NK (natural killer) cells of targeted CD19 from human pluripotent stem cells and application of method | |
| CN115698301A (en) | Active DNA transposable systems and methods of use thereof | |
| CN109593727B (en) | 6His-Nav1.1 fusion protein stable expression cell line and construction | |
| WO2017036026A1 (en) | Genetically modified mesenchymal stem cell and bsab producing method by using same | |
| CN116693626A (en) | Staple peptides and uses thereof and methods for expanding stem cells in vitro | |
| CN117836416A (en) | Transposon subsystem and use thereof | |
| CN111378621B (en) | B lymphoma cell strain stably transfected by EB virus latent membrane protein 1, construction method and application thereof | |
| CN113355283A (en) | Preparation method and application of antigen reactive T cells based on RNA vaccine | |
| CN113227375A (en) | Synthetic microRNA mimetics | |
| US9422360B2 (en) | Porcine CD28 receptor, gene for encoding same, and application of same | |
| CN113584085B (en) | Lentiviral vector for suspension cells and application thereof | |
| EP4060038A1 (en) | Method for introducing antigen-specific receptor gene into t cell genome using cyclic dna |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |