CN111484993A - Long-chain non-coding RNA I L21-AS 1 and application thereof - Google Patents
Long-chain non-coding RNA I L21-AS 1 and application thereof Download PDFInfo
- Publication number
- CN111484993A CN111484993A CN202010368473.2A CN202010368473A CN111484993A CN 111484993 A CN111484993 A CN 111484993A CN 202010368473 A CN202010368473 A CN 202010368473A CN 111484993 A CN111484993 A CN 111484993A
- Authority
- CN
- China
- Prior art keywords
- cells
- long
- coding rna
- cell
- naive
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Hematology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a long-chain non-coding RNA I L21-AS 1, a vector capable of expressing the long-chain non-coding RNA I L21-AS 1 and application thereof, and also provides a method for inducing a Naive T CD4+ T cell into a TFH cell and application of the non-coding RNA I L21-AS 1 in preparation of a substance for inducing secretion of I L-21.
Description
Technical Field
The invention relates to the field of biomedicine, in particular to long-chain non-coding RNA and application thereof.
Background
The long-chain non-coding RNA (L ong non-coding RNA, &lTtT translation = L "&gTt L &lTt/T &gTt ncRNA) is a non-coding RNA of more than 200 nucleotides in length, generally between 200 + 100000nt in length, does not encode protein transcripts, according to the location and background in the genome, L ncRNA is divided into antisense long noncoding, intron noncoding, intergenic, untranslated region lncRNA and the like, L ncRNA has an important role in the field of life science research, and relates to DNA replication, transcriptional regulation, intracellular material transport, chromosome remodeling, epigenetics, participation in cell differentiation, apoptosis and the like L ncRNA is involved in the processes of growth and development in the organism, stress response and diseases including cancer, autoimmune diseases, occurrence and development of cardiovascular diseases and the like.
The expression vector is a vector in which an expression element such as a promoter, RBS, terminator and the like is added on the basis of the basic skeleton of a cloning vector to enable a target gene to be expressed. In the construction process, the ends matched with the target genes are cut by using restriction endonuclease, mostly viscous ends and also flat ends, and are connected by adopting DNA ligase and introduced into organisms to realize cloning expression.
TFH is different from CD4+ T cells such as Th1, Th2, Th17 and the like, and has the phenotype of CXCR5+ ICOS + PD1+, intracellular transcription factors BC L-6 and TOX2 are highly expressed, the main function of synthesizing a large amount of secreted I L-21 TFH is to assist B cell activation and maturation, TFH highly expressed CXCR5 and CXC L3 are combined to migrate to a Follicular zone to participate in the formation of Germinal Center (GC), TFH secreted I L-21 induces B cell differentiation and maturation into plasma cells, IgM, IgG and IgA, and can also regulate the isotype conversion of Ig, the number of TFH is too large or the function is too strong to cause autoimmune diseases, and vice versa, the TFH is involved in autoimmune diseases such as autoimmune diseases, RA L, CD differentiation and induction of TFH + T cells to develop into a model, and the development of TFH + T cells is provided as a research model for developing TFH, CD28, CD 26, CD, and CD 4.
Whether long non-coding RNAs are involved in the development and differentiation of TFH, and their specific functions, is not known, and the present invention addresses at least some of these problems.
Disclosure of Invention
The invention provides a full-length sequence (SEQ ID No: 1) of long-chain non-coding RNA I L21-AS 1.
The invention also provides an expression vector capable of expressing the long-chain non-coding RNA I L21-AS 1, wherein the expression vector can be a plasmid or a virus, and preferably, the plasmid is pcDNA3.1 expression plasmid.
The invention also provides a method for constructing the Naive CD4+ T cell, which comprises transfecting the expression vector into the Naive CD4+ T cell, and preferably, transfecting the Naive CD4+ T cell by using a pcDNA3.1-I L-As 1 expression vector containing long-chain non-coding RNA I L-AS 1.
The invention provides a method for inducing a Naive CD4+ T cell into a follicular helper T cell, which comprises the steps of electrotransfecting a pcDNA3.1-I L21-As 1 expression vector containing long-chain non-coding RNA I L21-AS 1 to the Naive CD4+ T cell, and then culturing the obtained transfected cell for 3 days.
The invention provides a long-chain non-coding RNA I L21-AS 1 and application of an expression vector containing the long-chain non-coding RNA I L21-AS 1 in preparation of a substance for inducing a Naive CD4+ T cell to be differentiated into a follicular helper T cell, and further, the expression of I L-21 in the obtained follicular helper T cell is increased, wherein the increase is compared with the expression of I L-21 in a naturally-generated follicular helper T cell.
The invention provides application of long-chain non-coding RNA I L21-AS 1 and an expression vector capable of expressing long-chain non-coding RNA I L21 AS1 in preparation of a substance for inducing secretion of I L-21.
The invention has the advantages that:
1. the full-length sequence of the long non-coding RNA I L21-As 1 is obtained.
2. An expression vector of the long-chain non-coding RNA I L21-As 1 is constructed.
3. The function and the application of a part of long-chain non-coding RNA I L21-As 1 are proved.
4. It is verified that the expression vector capable of expressing the long-chain non-coding RNA I L21-As 1 promotes the differentiation of the Naive CD4+ T cells to TFH cells and further promotes the increase of I L-21 secreted by the TFH cells.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention. In the drawings:
FIG. 1 shows the sequence of the long non-coding RNA I L21-As 1 of the present invention;
FIG. 2 shows the results of 1% agarose electrophoresis performed on eukaryotic expression vector pcDNA3.1-I L21-AS 1 after double digestion, wherein the lane 1 is pcDNA3.1, the lane 2 is pcDNA3.1-I L21-AS 1 digestion product lane M is KB L adder;
FIG. 3 shows RT-qPCR to verify the over-expression effect of the expression vector pcDNA3.1-I L21-AS 1 in TFH cells.
FIG. 4 shows the transfection of Naive CD4+ T cells with pcDNA3.1 and pcDNA3.1-I L21-As 1, respectively, after 3 days of incubation, flow cytometry sorting and the proportion of TFH cells (.: P < 001).
FIG. 5 shows that pcDNA3.1 and pcDNA3.1-I L21-As 1 were transfected with Naive CD4+ T cells, respectively, and cultured for 3 days after transfection, and RT-qPCR confirmed the expression of I L-21 (P < 001).
FIG. 6 shows that pcDNA3.1 and pcDNA3.1-I L21-As 1 were transfected with Naive CD4+ T cells, respectively, and cultured for 3 days after transfection, and E L ISA detected the expression of cell culture medium supernatant I L-21.
Detailed Description
The preferred embodiments of the present invention will be described in conjunction with the accompanying drawings, and it will be understood that they are described herein for the purpose of illustration and explanation and not limitation.
The experimental reagents and instruments involved in the examples of the present invention were as follows:
TRNzol Universal is provided by TIANGEN,
RACE5 '/3' Kit is supplied by Clontech, Gel Extraction Kit is supplied by OMEGA,
max DNA Polymerase is supplied by Takara, pEASY-Blunt Cloning Kit by TransGen Biotech, Transns 1-T1 phase reactive chemical Complex Cell by TransGen Biotech, Green Taq Mix by Vazyme, P3Primary Cell 4D-Nuclear effector X Kit transfection reagent and a companion transfection instrument supplied by L onZa, BioProducer DNA Polymerase by Takara, TransGen Biotech, Trans1-T1 phase reactive chemical Complex, Green Taq Mix by VazymeThe long medium 1640 is provided by Gibco, the FBS fetal bovine serum is provided by Gibco, the centrifuge manufacturer is a Thermo company in the United states and is a FRESC017 high-speed refrigerated centrifuge, the electrophoresis apparatus manufacturer is a BIO-RAD company in the United states and is a PowerPacTMand Mini-Sub Cell GT, the gel imager manufacturer is a BIO-RAD company in the United states and is a ChemiDocTMXRS + System, the mouse anti-Human CD3 antibody, the mouse anti-Human CD28 antibody, the Human-I L6, the Human-I L12 and the Human-TGF β are provided by peprotech company, the mouse anti-Human CD4-FITC antibody, the mouse anti-Human PD1-APC antibody, the mouse anti-Human CXCR 5-pecp-cy 5.5 antibody, the Naive CD4+ T Cell Isolation Kit II is provided by Miltenyi corporation and the Human Human 673654 ISA L21-I L-ISA detection Kit is provided by Naive CD 5393 + T Cell Isolation Kit.
Example 1 RACE experiments to determine the full Length of the Long non-coding RNA I L21-As 1 Gene
1.1RNA extraction (TIANGEN instructions, the content of which is incorporated by reference)
1.2RACE-Ready cDNA Synthesis
RACE-Ready cDNA synthesis was performed according to SMARTERRACE5 '/3' Kit instructions.
The 3 'and 5' RACE specific amplification primers were designed as follows:
smart-3' RACE inner primer: GCCTATGACCCTGGTGTCGTTT (SEQ ID No: 2)
Smart-3' RACE outer primer: TTTTGCTCTGTGAGTGTTGGGC (SEQ ID No: 3)
Smart-5' RACE inner primer: CACCACCGGTTGAGAACCACT (SEQ ID No: 4)
Smart-5' RACE outer primer: ACCTCACGGAAGGCCAAAGACAAGA (SEQ ID No: 5)
1.3PCR amplification, product recovery and ligation reactions (routine procedures, reference molecule cloning)
1.4 transformation, PCR cloning and sequencing verification (routine procedures, reference molecular cloning)
Long non-coding RNA I L21-As 1 was subjected to DNA sequencing validation (supplied by Kjekey Biotech, Inc. of Shanghai) As shown in FIG. 1.
Example 2 construction of a Long non-coding RNA I L21-AS 1 expression plasmid vector.
Firstly, synthesizing a long-chain non-coding RNA I L21-AS 1 (shown in figure 1) gene (provided by Nanjing King Shirui biotechnology company), then connecting the gene to vector plasmid obtained by enzyme digestion of pcDNA3.1 by BamH I and XhoI to obtain pcDNA3.1-I L21-AS 1 expression plasmid, wherein the specific construction process is AS follows:
(1) the pcDNA3.1 is subjected to double enzyme digestion, namely 4 mu g of the pcDNA3.1 vector is taken into an EP tube and is subjected to double enzyme digestion by using BamH I and XhoI, and the system is as follows
Enzyme-free water was added to make up a total volume of 50. mu. L, and the digestion was carried out at 37 ℃ for 20 minutes (min).
(2) The long-chain non-coding RNA I L21-AS 1 gene is connected with the gene (1) in the following system
Enzyme-free water was added to make up a total volume of 20. mu. L, ligation was performed at 37 ℃ for 30 minutes (min), and ice-cooled for 5 min.
(3) Thawing 100u L DH5 alpha competent bacteria on ice, adding 4ul pcDNA3.1-I L21-AS 1, mixing uniformly, carrying out ice bath for 30min, immediately carrying out water bath at 42 ℃ for 45 seconds(s), immediately carrying out ice bath for 2min, transferring to 1ml L B culture medium, carrying out shaking culture at 37 ℃ and 225r/min for 1h, coating the obtained bacteria on a L B culture plate (Amp concentration is 100 mu g/m L), carrying out culture in an incubator at 37 ℃ for 12h, selecting a single colony, placing the single colony into L B culture medium (Amp concentration is 100 mu g/m L), carrying out shaking culture at 37 ℃ and 300r/min for 15h, extracting plasmid pcDNA3.1-I L21-AS 1, carrying out enzyme digestion, sequencing and identification on the plasmid obtained in the step (3), wherein an enzyme digestion system is AS follows,
adding enzyme-free water to make the total volume 50 μ, and performing enzyme digestion reaction at 37 deg.C for 20 min.
5ul DNA Marker and 5. mu. L enzyme products were detected by electrophoresis on a 1.5% agarose gel, as shown in FIG. 2.
Example 3 transfection of Naive CD4+ T cells with expression plasmid vector containing long non-coding RNA I L21-AS 1, culture and verification of expression results
3.1 sorting of mononuclear cells (PBMC) from whole blood, requiring a whole process of aseptic manipulation, the main steps are as follows:
(1) collecting 100ml of heparin anticoagulation, and performing Ficoll PBMC sorting: diluting whole blood with PBS for three times at room temperature;
(2) adding 15ml of Ficoll into a 50ml centrifuge tube at room temperature for later use;
(3) adding 35ml of diluted whole blood obtained in the step (1) into each centrifugal tube in the step (2), wherein the operation action is required to be gentle, and the liquid level is ensured to be layered obviously for later use;
(4) adjusting the horizontal centrifuge to a centrifugal force of 750g, a temperature of 20 ℃, an acceleration of 8 and a deceleration of 0, balancing the sample obtained in the step (3), and centrifuging for 20min for later use;
(5) sucking the cloudy liquid enriched with the PBMC cells in the step (4) to a 50ml thin core tube by a Pasteur pipette, storing 15ml of the liquid in each tube, supplementing 35ml of PBS into the residual volume, and uniformly mixing for later use;
(6) adjusting the centrifugal force of the horizontal centrifuge to 350g, the temperature of 4 ℃, the acceleration of 8 and the deceleration of 9, balancing the sample in the step (5), and centrifuging for 10min for later use;
(7) discarding the supernatant of (6), resuspending the cell pellet with 15ml Buffer (PBS + 0.5% BSA), transferring to a 15ml centrifuge tube for use;
(8) adjusting the centrifugal force of the horizontal centrifuge to 300g, the temperature of 4 ℃, the acceleration of 8 and the deceleration of 9, balancing the sample in the step (7), and centrifuging for 10min for later use;
(9) the supernatant (8) was discarded, the cell pellet was resuspended in 5ml buffer (PBS + 0.5% BSA), an appropriate cell sample was taken, and the number of viable cells was counted using 0.45% trypan blue for use.
3.2 magnetic bead sorting of Naive CD4+ T cells
The procedure was performed strictly according to the Naive CD4+ T Cell Isolation Kit II instructions (Miltenyi Inc.), which are incorporated herein by reference, and the whole procedure was aseptically performed to obtain Naive CD4+ T cells for use.
3.3 transfection of Naive Using electrotransfectionCD4+ T cell (4D-Nucleofector)TMX Unit, L onza), the procedure is as follows:
(1) each reaction requires a quantity of Naive CD4+ T cells of 5 x10 or more6After cell counting is confirmed, the cell is ready for use;
(2) taking pcDNA3.1-I L21-AS 1 and pcDNA3.1 plasmid 4ug, and putting into an EP tube for later use;
(3) 200ul transfection reaction solution was added with 1x107Mixing the Naive CD4+ T cells uniformly, adding 100ul of the mixture into the step (2) respectively, and mixing uniformly for later use;
(4) transferring the cell suspension in the step (3) into a transfection cup to ensure that no air bubbles exist, and covering the bottom of the electric rotating cup with the cell suspension for later use;
(5) debugging electrotransformation instrument 4D-NucleofectorTMCore Unit parameters: human instantiatedtcell-high functionality for standby;
(6) the reaction cup of (4) is correctly aligned and placed in the procedure of (5) for electrotransfection.
3.4 cell culture and RNA extraction after electroporation as follows:
(1) the cells after electroporation were pipetted into a six-well plate of pre-prepared 1640 medium using micropipettes (L onza kit) at 37 ℃ with 5% CO2The incubator (2) is cultured for 6 hours to restore the cells to the state.
(2) The cells of (1) were collected in a 15ml centrifuge tube with a centrifugal force of 300g, the sample was trimmed and centrifuged for 10min, the cells were left and resuspended in 6ml 1640 culture (1640+ 10% FBS) for use.
(3) The cell suspension of (2) was divided into three equal portions, and cultured in a 12-well (2ug/ml) plate previously coated with mouse anti-human CD3 antibody at 37 ℃ with 5% CO2The culture box is used for culturing for 48h and 96h for standby.
(4) The cells cultured for 48h were collected and total RNA was extracted by Trizol method.
3.5 detection of transfection results
3.5.1 cells after transfection were cultured for three days for expression detection:
(1) synthesizing cDNA using RNA as a template (reverse transcription kit from takara);
(2) RT-qPCR (Roche) detects the over-expression effect of the long-chain non-coding RNAI L21-AS 1, RT-PCR detects the long-chain non-coding RNAI L21-AS 1, and AS shown in FIG. 3, the expression of the long-chain non-coding RNAI L21-AS 1 of the experimental group pcDNA3.1-I L21-AS 1 is 100 times higher than that of the control group pcDNA3.1, which indicates that the transfection of the pcDNA3.1-I L21-AS 1 is successful.
3.5.2 cells cultured for 3 days after transfection were harvested, the proportion of TFH cells was determined by flow cytometry, and the expression of I L-21 was determined by RT-qPCR and E L ISA, respectively, as follows:
the TFH cell ratio is detected by flow cytometry, the experimental group pcDNA3.1-I L21-As 1, the control group pcDNA3.1, the negative control and compensation control CD4, PD1 and CXCR5 are respectively collected, the cell number per tube is 1X106The proportion of TFH cells was measured using a flow cytometer BD FACScantoII (both the antibody and the instrument used in the above procedure were from BD Bioscience), and the results of flow cytometry analysis are shown in FIG. 4. three days after transfection, the PD1+ CXCR5+ double positive cells (differentiated TFH cells) of the experimental group pcDNA3.1-I L21-AS 1 accounted for 20% more than the control group pcDNA3.1, indicating that the transfection of pcDNA3.1-I L21-AS 1 promoted TFH differentiation.
Collecting cells 3 days after the transfection of the experimental group pcDNA3.1-I L21-As 1 and the control group pcDNA3.1, and taking 5 x10 cells5And detecting the expression of I L21 by RT-qPCR, wherein the experimental result is shown in figure 5, after three days of transfection, the expression level of I L21 mRNA of an experimental group pcDNA3.1-I L21-AS 1 is 2.2 times that of a pcDNA3.1 control group, which indicates that the transfection of pcDNA3.1-I L21-AS 1 promotes the expression of I L21 mRNA, wherein the RT-qPCR uses the following primers:
IL21：
F：TGGTCCCTGAATTTCTGCCAG(SEQ ID No：6)
R：TTAGTTGGGCCTTCTGAAAGCA(SEQ ID No：7)
β-actin
F：GAGCTACGAGCTGCCTGACG(SEQ ID No：8)
R：GTAGTTTCGTGGATGCCACAG(SEQ ID No：9)
LncRNA-IL21AS1：
F：AACTACATGCCAGGCCTCTT(SEQ ID No：10)
R：AGGTCAAGATCGCCACATGA(SEQ ID No：11)
cell culture supernatants of the experimental group pcDNA3.1-I L21-As 1 and the control group pcDNA3.1 after transfection are collected for 3 days, E L ISA detects the expression of I L-21, and the experimental result is shown in figure 6. after three days of transfection, the expression level of I L21 mRNA of the experimental group pcDNA3.1-I L21-AS 1 is 1.5 times that of the control group pcDNA3.1, which indicates that the transfection of the pcDNA3.1-I L21-AS 1 promotes the expression of the I L21 protein.
According to the experimental results, the skilled person can judge that the overexpression of the long-chain non-coding RNA I L21-AS 1 promotes the differentiation of the Naive CD4+ T cells to the TFH cells and improves the expression of I L-21, and the TFH cells play an important role in the occurrence of various autoimmune diseases, so that the expression vectors of the long-chain non-coding RNA I L21-AS 1 and the long-chain non-coding RNA I L21-AS 1 can be used for preparing substances for promoting the differentiation of the Naive CD4+ T cells to the TFH cells and substances for promoting the expression of I L-21 in the TFH cells.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<110> Xiangya II Hospital of Zhongnan university
<120> long-chain non-coding RNA I L21-AS 1 and application thereof
<130>CP20122
<141>2020-04-30
<160>11
<170>SIPOSequenceListing 1.0
<210>1
<211>4082
<212>RNA
<213> human (human species)
<400>1
gacccaagct ggctagcgtt taaacttaag cttggtaccg agctcggatc cggagaatcg 60
cttgaacctg ggaggcagag gttgcagtga gctgagatcg caccactgca ctccagccta 120
gcaacatatc gagactccgt ctcaaaaaaa aaaaaaaaaa aaaaaaaaaa ggattacctt 180
tgtcctacac acaaactagg tttatatcag ggtttctcaa cggtgatacc actgacattt 240
ggggctagat aattctttgt tgtcagggct gtcttgtgca ttctagaatg tttagtacct 300
ggcttctacc tactagatgc cagtagcacc cccattctac ctccaagtgt gacaaccaga 360
aatttttcca gccaatgcca aatgttttct ggggcacaaa aatcaccacc ggttgagaac 420
cactggttat atgattagac ggaaagaaaa agagaaaaag aaagatgcct ggctaggcca 480
attagagatc ttagataatt actatatgca tgcaacatta gatagtttta ttttcattaa 540
acttttaaat cttttaaaat ctcttacaga ccctactttg aagctagctt gatataatgc 600
taatgtgacc ttgaacgatt tctttcttcc tgagtttgcc tactagtata gcttaaagat 660
ccaagttaca ctattactca cttatatcat agccagcatt gcttgatcag attatcagat 720
agatacagta tcacggagac aaaatccttt cattatgatg taagataaaa aatatctttc 780
attaacaaca cacgtaaagg aagtacccac tggaccaact caggttagaa gggtaccaga 840
ccagaagatc agatcgtaga agttactgga gaaaaagatc agcggacagc actcttgaac 900
tacatgccag gcctcttctt cctggaactc taatggattt aaatggctta agagacggga 960
tgaattgttg aaaatggttc tttcaaaaga cctcacggaa ggccaaagac aagactcact 1020
gaggccaagc tgatcaacaa tatctataag ttgacgcatt ctaatcatgt ggcgatcttg 1080
accttgggag cttgatttgt ggaccagtgt ccccaagaag atgaccatca gacagatgac 1140
aatcctctcc atgttgccag gactggatct cataagtacc aacagtagag ctagaccttg 1200
gtctcgtttt cacttcagct tgactgagaa caggtatacg tgtgcatgtg ctaatgtgtg 1260
ggggcaggga ttgatggagt caacgaaatg tgccccatct gcatctttga caggaaaaag 1320
agagaatggg tgaattccaa ttttcagcatgaatcaagaa tgtcaccgat gaagtttttg 1380
aatgctgtgc tcctaatctc attttcctcc tccagagact tcggtgaagg atgatgcaaa 1440
ctgtgtttct tcagcatgtg agcaccatca gccatgagtg tggcagctcc agaatgtcta 1500
taccagagtg gctgagagtc agcaacttgg ctggaagcta cacttgaata gcaaacaaac 1560
cacttttact tagtttccat gtctatttgg taccttggag tacagtgatg agttttacta 1620
gatgtggact ttccaggaat atagccaagg tcgtcaccat gaaagtatga aactttagtc 1680
atttacccaa ggggattcat ggacatatat taagaatttt ctttaatgga ctgtgtttat 1740
agaacacctg gtcaggacgg aaatgaggcc agggaactaa aggggtagaa gtctgaagag 1800
gaatggtttt gcatgggaaa actgtgccag gtctaaaact gggctgaaca ctatttgtcc 1860
ccaactctct ggcccggtcc tcatagttct ttctgtgatc cctgcgtggt gaatactcct 1920
tttctgcttt cactggcttt ggcccctcat ggatagaatt agatgttctg catggcaaac 1980
tgtgggaaga gaggcctcca gtgtttagag tgatattatc atgtgtacca ctactattat 2040
acatactaaa ggtattcaga caggtggctt gtctctgggc tttatataga tctctgtcaa 2100
gctagaagaa aaatgtcact aaaataattc aagacaattt ttgtactttc caacgatgtt 2160
caggtaacag ctgaaaatat tctcacttat ttgacttgag gaagaaaatt cgaacgagga 2220
aaatcatcaa ggatttgcta aagtcccttc tgtaaaatct tccttaagga agtttaaaca 2280
ctcctattct ctcttctctc attcttttga actcactgca tgtattgata tcactgactt 2340
ggtttgtttt ctagaatata tgtaaaagta agagtgtgta tatataaccc attatgtaca 2400
taacaagaac agttccttcc aatattcaaa tttcatgact ctagatcact actgtgcatt 2460
ctaagaaggt cagggactca tggagaccaa agggtcaatc ctggtcattg ttgtcttacg 2520
agagaaaaac aagagccttc tcgggccccg tgttctctag ctcttgatgt ggcctcttcg 2580
gtatcactgg cagccccaca gtctggtggt cagtgtgtcg cagcagaggg tcattcaccg 2640
atgctgctta tccacagcac cttttctgtg gggaatgggg gcctctattc tgctagtaga 2700
ctcaggtgtg tcactctgtg atactcttaa gactgggttc attgaggaca ggtctctttg 2760
ctaacattca cacaaagtca ttgtttggaa gcacagtcct gcttctgaaa tgctaggtct 2820
ggaggagttc cagcagcagc cacatgggcc ctctcctcag atcttggctc caacatggga 2880
tactcagcag tgaggctaga gatcagatgt ccttcattcc ttgaccacta agcctagagg 2940
atggagagaa agaagtggaa catctgcact cttcaacctg agtccactcc aactccatcc 3000
cacaagggaa ctgcctccat tgctgatgtt ggattaaaca gaacagcctg tgcagttagt 3060
tcatggattc cataaaggga ctggacctta atgaagacgt tcctgacatg ggtttgggca 3120
agaagatatt ataattttgc aaatgaagaa actgagatac agaaatgaca tccagcaccc 3180
tcagtgtcac acagagagta aatggactgg cctgaaccag gctgcctcct ggaactggtt 3240
tctttggttg gttgaatcca tggatggaga actcgtggat acaagggctg actataatga 3300
gaagatatga aagctgaaaa gacaaacatt actacatatt tacatatgtc caaagaagaa 3360
ggttcatctc cacgtggacc tccctataga gcttcttgaa tggcctcaca acatggcggc 3420
tggcttccca cagagtgagc aatccaagat ttccttgatt cagagaaaga agataaaaac 3480
acatacaaag agacggcacc agctcctttc ccagttgtga ccagattgca cgatacccaa 3540
gccatggctc caaagagtgc gtgtactgaa gcctggccat tcatgacaga ctcatttcca 3600
cacctgagtc cggttttgct ctgtgagtgt tgggctttct ccaagggaat ggttggagct 3660
gttgcgagcg aacttcctgg ctgccacaga gttgattgga ttccttggaa atgcacactc 3720
acaggctgct gctctttgaa gctgtctcct tcactggcca tgattctcct gtctcattag 3780
ctgttgccta tgaccctggt gtcgttttct ccttttactc atcaacaccc aaatccacag 3840
ggttgtgatg gattagcagc ctttcttatt agcaagaagc cctgtggcct caagaggcaa 3900
aatgaatcgt ggttagaaat ctccatctcc tccctccctt ggtataatgc catcatttaa 3960
ctatctgaaa atagagaaga ctccgttcca attgtaaagc cctaaggaga aaaactgagt 4020
ttgaaacttt ccttaattat gctgatattt aacaataaac tttgtagtat gaaaatctca 4080
aa 4082
<210>2
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gcctatgacc ctggtgtcgt tt 22
<210>3
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ttttgctctg tgagtgttgg gc 22
<210>4
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
caccaccggt tgagaaccac t 21
<210>5
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
acctcacgga aggccaaaga caaga 25
<210>6
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
tggtccctga atttctgcca g 21
<210>7
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
ttagttgggc cttctgaaag ca 22
<210>8
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
<210>9
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
gtagtttcgt ggatgccaca g 21
<210>10
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
<210>11
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
Claims (10)
1. A long-chain non-coding RNA I L21-AS 1 is characterized in that the nucleotide sequence is shown AS SEQ ID No. 1.
2. An expression vector capable of expressing the long chain non-coding RNAI L21-AS 1 of claim 1.
3. The expression vector of claim 2, which is a eukaryotic expression plasmid.
4. The expression vector of claim 3, wherein the plasmid is pcDNA3.1 expression plasmid pcDNA3.1-I L21-AS 1.
5. A Naive CD4+ T cell, wherein the Naive CD4+ T cell comprises the expression vector of claim 2.
6. Method for constructing a Naive CD4+ T cell according to claim 5, wherein the eukaryotic expression vector according to claim 4 is transfected into a Naive CD4+ T cell.
7. A method for inducing Naive CD4+ T cells into follicular helper T cells, wherein transfected cells obtained according to claim 6 are cultured for a further 3 days.
8. Use of the long-chain non-coding RNA I L21-AS 1 of claim 1 or the expression vector of claim 2 for preparing a substance for inducing differentiation of Naive CD4+ T cells into follicular helper T cells.
9. The use according to claim 8, wherein the follicular helper T cells express increased I L-21.
10. Use of the long non-coding RNA I L21-AS 1 of claim 1 or the expression vector of claim 2 in the preparation of a substance for inducing secretion of I L-21.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010368473.2A CN111484993B (en) | 2020-04-30 | 2020-04-30 | Long-chain non-coding RNA IL21-AS1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010368473.2A CN111484993B (en) | 2020-04-30 | 2020-04-30 | Long-chain non-coding RNA IL21-AS1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111484993A true CN111484993A (en) | 2020-08-04 |
| CN111484993B CN111484993B (en) | 2021-06-22 |
Family
ID=71793046
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010368473.2A Active CN111484993B (en) | 2020-04-30 | 2020-04-30 | Long-chain non-coding RNA IL21-AS1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111484993B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112501192A (en) * | 2020-11-20 | 2021-03-16 | 中南大学湘雅二医院 | Hybridoma cell strain for generating anti-human IL21 monoclonal antibody and application thereof |
| CN117645673A (en) * | 2023-11-22 | 2024-03-05 | 武汉大学 | Fusion protein of IL-21, sCD4 and Fc and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106884016A (en) * | 2017-02-13 | 2017-06-23 | 中南大学 | The expression vector of long-chain non-coding RNA LINC00472, tumor suppression reagent and its application |
| CN109369797A (en) * | 2018-12-06 | 2019-02-22 | 中南大学湘雅二医院 | A kind of 1 albumen of recombinant human il-2 and its preparation and application |
-
2020
- 2020-04-30 CN CN202010368473.2A patent/CN111484993B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106884016A (en) * | 2017-02-13 | 2017-06-23 | 中南大学 | The expression vector of long-chain non-coding RNA LINC00472, tumor suppression reagent and its application |
| CN109369797A (en) * | 2018-12-06 | 2019-02-22 | 中南大学湘雅二医院 | A kind of 1 albumen of recombinant human il-2 and its preparation and application |
Non-Patent Citations (3)
| Title |
|---|
| EIRINI ZACHAROPOULOU ET AL.: ""The contribution of long non-coding RNAs in Inflammatory Bowel Diseases"", 《DIGESTIVE AND LIVER DISEASE》 * |
| LAURA A. VELLA ET AL.: ""T follicular helper cells in human efferent lymph retain lymphoid characteristics"", 《THE JOURNAL OF CLINICAL INVESTIGATION》 * |
| STRAUSBERG RL ET AL.: ""Homo sapiens IL21 antisense RNA 1 (IL21-AS1), long non-coding RNA，NCBI Reference Sequence: NR_104126.1"", 《GENBANK》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112501192A (en) * | 2020-11-20 | 2021-03-16 | 中南大学湘雅二医院 | Hybridoma cell strain for generating anti-human IL21 monoclonal antibody and application thereof |
| CN117645673A (en) * | 2023-11-22 | 2024-03-05 | 武汉大学 | Fusion protein of IL-21, sCD4 and Fc and application thereof |
| CN117645673B (en) * | 2023-11-22 | 2024-05-10 | 武汉大学 | Fusion protein of IL-21, sCD4 and Fc and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111484993B (en) | 2021-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210000976A1 (en) | Exosome transfer of nucleic acids to cells | |
| CN110691844B (en) | Methods and kits for generating simulated innate immune cells from pluripotent stem cells | |
| AU2023204606A1 (en) | Genetically modified cells, tissues, and organs for treating disease | |
| CN111484993B (en) | Long-chain non-coding RNA IL21-AS1 and application thereof | |
| CN109750035B (en) | sgRNA for targeting and guiding Cas9 protein to efficiently cleave TCR and B2M gene locus | |
| CN113801881B (en) | Use of super enhancer gene sequence in promoting human B2M gene expression | |
| WO2023138658A1 (en) | 2019-ncov-specific t cell receptor and use thereof | |
| CN111154763A (en) | Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function | |
| CN115948468A (en) | Human cytomegalovirus recombinant vector and preparation method and application thereof | |
| CN111440245B (en) | Chimeric antigen receptor T lymphocyte for targeted therapy of solid tumor | |
| CN106755093B (en) | Process for instantaneous transfection of drosophila cells | |
| CN110747230B (en) | Method for promoting bovine skeletal muscle satellite cell myogenic differentiation | |
| CN106086073A (en) | A kind of expression of cytokine IL 7 | |
| CN109593727B (en) | 6His-Nav1.1 fusion protein stable expression cell line and construction | |
| CN109055312B (en) | AIM2 in inducing differentiation CD4+Application of T cell to Tfh cell transformation | |
| WO2017036026A1 (en) | Genetically modified mesenchymal stem cell and bsab producing method by using same | |
| CN114317720B (en) | Application of hsa_circ_0066715 gene and detection method thereof | |
| CN111440246B (en) | Chimeric antigen receptor targeting HLA-B, encoding gene, CAR-Tregs cell and preparation method and application thereof | |
| CN113227375A (en) | Synthetic microRNA mimetics | |
| CN110564691A (en) | Preparation method of HLA homozygote-derived universal CAR-T cells | |
| CN113584085B (en) | Lentiviral vector for suspension cells and application thereof | |
| CN114164210B (en) | Long-chain non-coding RNA for regulating and controlling protooncogene MYB and application thereof | |
| CN113244412B (en) | Medicine for treating hyperuricemia or gout based on mRNA dosage form and preparation method thereof | |
| CN111228292B (en) | Application of human TPT1/TCTP gene in preparation of antitumor drugs | |
| CN116875545A (en) | Preparation method of immune effector cell expressing exogenous gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |