CN111394399A - Method for reducing content of acylglyceride impurities in long-chain dibasic acid - Google Patents

Abstract

The invention provides a method for reducing the content of acylglyceride impurities in long-chain dibasic acid and long-chain dibasic acid obtained by the method. The method can obviously reduce the mass ratio of the impurities of the acylglyceride in the fermentation liquor after the fermentation is finished by controlling the concentration of the fermentation substrate in the fermentation liquor during the fermentation production of the long-chain dibasic acid. The long-chain dibasic acid with low content of impurities in the acylglyceride greatly reduces the difficulty of the post-extraction and purification of the dibasic acid and the wastewater treatment process, simplifies the process and saves the energy consumption; meanwhile, the quality of downstream products is improved.

Description

Method for reducing content of acylglyceride impurities in long-chain dibasic acid

Technical Field

The invention belongs to the technical field of biological fermentation, and particularly relates to a fermentation method for reducing impurities in production of long-chain dicarboxylic acid.

Background

The long chain dicarboxylic acid (L CDA; also known as long chain dicarboxylic acid or long chain diacid) comprises the formula HOOC (CH)₂)_nA dibasic acid of COOH, wherein n is more than or equal to 7. It is widely used as an important monomer raw material for synthesizing nylon, resin, hot melt adhesive, powder coating, preservative, spice, lubricant, plasticizer and the like.

The microbial fermentation method for producing the long-chain dibasic acid has the characteristics of low pollution, environmental friendliness, capability of synthesizing products which are difficult to synthesize by a chemical synthesis method, such as long-chain dibasic acid with more than 12 carbon atoms, relatively high product purity, reduction of extraction and purification cost and the like, and gradually replaces the chemical synthesis method in recent years and becomes a main way for producing the long-chain dibasic acid.

The previous researches mostly focus on removing acyl coenzyme A oxidase and acyl coenzyme A oxidase POX gene to block β -oxidation pathway so as to accumulate products and excessively express P450 oxidase and CPR cytochrome oxidoreductase gene so as to improve omega-oxidation efficiency (mol.cell.biol.,11 (9)), 4333-.

Although the microbial fermentation method for producing long-chain dibasic acid has higher purity than the dibasic acid produced by the traditional chemical method, the excessive accumulation of metabolic byproducts, such as diacyl glyceride (DAG) and triacyl glyceride (TAG) which can be produced by the excessive accumulation of fatty acid, can still be caused in the fermentation process due to the oxidation rate of intermediate metabolites and the coordination of transportation and accumulation. DAG and TAG are formed by esterifying glycerol and two or three molecules of fatty acid, and are the main existing forms of neutral fat in cells; usually generated when the energy is excessive and stored as energy substance. The presence of such impurities can present challenges to subsequent extractive purification processes, resulting in increased costs and decreased yields from the purification steps. Meanwhile, the product quality problem of the long-chain dicarboxylic acid product or crude product caused by the existence of impurities causes great trouble to the downstream process, and the development of the biological long-chain dicarboxylic acid industry is influenced to a certain extent.

At present, no report is found on the research of modifying a dibasic acid production strain by controlling fermentation conditions and a genetic engineering means to reduce the content of acylglycerols.

Disclosure of Invention

The invention aims to provide a method for reducing the content of acylglyceride impurities in long-chain dibasic acid and the long-chain dibasic acid obtained by the method.

In order to achieve the object of the present invention, in a first aspect, the present invention provides a method for reducing the content of acylglyceride impurities in a long-chain dibasic acid, wherein the concentration of a fermentation substrate in a fermentation broth during fermentation production of the long-chain dibasic acid is controlled to be 0.1% to 17%, for example, 0.1% to 0.5%, 0.5% to 1%, 1% to 3%, 2% to 4%, 3% to 5%, 4% to 6%, 5% to 7%, 6% to 8%, 7% to 9%, 8% to 10%, 9% to 11%, 10% to 12%, 11% to 13%, 12% to 14%, 13% to 15%, 14% to 16%, or 15% to 17%. The concentration of the fermentation substrate can be controlled by adjusting the rate of addition of the fermentation substrate during the fermentation process. The control of the concentration of the fermentation substrate is beneficial to the microorganisms to fully utilize the fermentation substrate to produce the long-chain dibasic acid by fermentation, and the impurity content of acylglyceride (neutral fat) in the obtained long-chain dibasic acid is effectively reduced. Preferably, the concentration of the fermentation substrate is controlled to be 0.1-15%.

Preferably, the fermentation substrate or feedstock for fermentative production of long-chain diacids, referred to as fermentative conversion, comprises long-chain alkanes, fatty acids, fatty acid derivatives or mixtures thereof.

Preferably, the fermentation substrate of the invention comprises long-chain alkanes, which are among the saturated onesAnd a chain hydrocarbon, a saturated hydrocarbon under hydrocarbon, the whole structure of which is mostly composed of carbon, hydrogen, carbon-carbon single bond and carbon-carbon single bond only, and the chemical formula of which comprises CH₃(CH₂)_nCH₃Wherein n.gtoreq.7. Preferably C9-C22, more preferably C9-C18, namely C9, C10, C11, C12, C13, C14, C15, C16, C17 or C18, more preferably any one or combination of n-decane, n-undecane, n-dodecane, n-tridecane, n-tetradecane, n-hexadecane, n-heptadecane or n-octadecane.

Preferably, the acylglycerides include diacylglycerides (i.e., DAG) and triacylglycerides (i.e., TAG). The diacylglycerides are compounds consisting of one molecule of glycerol and two molecules of fatty acid, and the triacylglycerides are compounds consisting of one molecule of glycerol and three molecules of fatty acid. Preferably, the fatty acid is oleic acid.

Preferably, the diacylglyceride is C₃₉H₇₂O₅The triacylglycerol is C₅₇H₁₀₄O₆。

Preferably, the engineering bacteria for producing long-chain dicarboxylic acid used in the fermentation are selected from the group consisting of species in Corynebacterium (Corynebacterium), Geotrichum (Geotrichum), Candida (Candida), Pichia (Pichia), Rhodotorula (Rhodotorula), saccharomyces (saccharomyces), Yarrowia (Yarrowia); preferably a Candida species; more preferably Candida tropicalis (Candida tropicalis) or Candida sake (Candida desake).

Preferably, the engineering bacteria for producing the long-chain dicarboxylic acid used in the fermentation is obtained by knocking out a copy of SCT1 gene or homologous gene thereof in the genome of the engineering bacteria for producing the long-chain dicarboxylic acid by a genetic engineering means. Wherein, the genetic engineering means includes but is not limited to a mode of homologous recombination. The modified engineering bacteria are used for fermenting the long-chain dibasic acid to produce the long-chain dibasic acid, so that the microorganisms are facilitated to further fully utilize fermentation substrates to ferment and produce the long-chain dibasic acid, and the impurity content of the diacyl glyceride and the triacyl glyceride is further reduced.

Preferably, the engineering bacteria for producing the long-chain dicarboxylic acid used in the fermentation is obtained by knocking out a copy of SCT1 gene or homologous gene in the genome of Candida tropicalis (Candida tropicalis) or Candida sake (Candida sake) which is the engineering bacteria for producing the long-chain dicarboxylic acid by a homologous recombination method.

In a specific embodiment of the invention, a strain used for fermentation is an engineering bacterium 630 for producing long-chain dicarboxylic acid, and the engineering bacterium 630 is obtained by knocking out a strain with a preservation number of CCTCC NO: candida tropicalis (Candida tropicalis) CAT N145 genome of M2011192 was derived from a copy of the SCT1 gene. The candida tropicalis CAT N145 is biologically preserved in 2011 at 6, 9 months, and the preservation unit: china center for type culture Collection (Address: Wuhan, Wuhan university, China, zip code: 430072).

In another embodiment of the invention, the strain used for fermentation is an engineering bacterium 631 producing long-chain dicarboxylic acid, and the engineering bacterium 631 is obtained by knocking out a strain with a preservation number of CCTCC NO: m203052 was obtained as a copy of the SCT1 gene in the Candida tropicalis genome. The preservation number is CCTCC NO: m203052 Candida tropicalis has been biologically deposited at 6.6.2003, depository: china center for type culture Collection (Address: Wuhan, Wuhan university, China, zip code: 430072).

The Candida tropicalis with the preservation number of CCTCCM 2011192 can be seen in CN201110168672. X. The preservation number is CCTCC NO: candida tropicalis, M203052, is described in CN 200710170899.1. The preservation number is CCTCC NO: m2011192 or CCTCC NO: candida tropicalis (Candida tropicalis) M203052 is available through the China Center for Type Culture Collection (CCTCC).

The preservation number is CCTCC NO: the CDS sequence of the SCT1 gene part of the Candida tropicalis of M2011192 is shown as SEQID NO: 16.

The preparation method of the dibasic acid production strain comprises the following steps: (1) preparing a homologous recombination template, wherein the homologous recombination template comprises a recombination template at the upper part and the lower part of a target site and a resistance screening marker gene HYG (hygromycin resistance gene), and then obtaining a complete recombination template by a PCR (polymerase chain reaction) overlapping extension method; (2) the complete recombinant template is transformed into competent cells, and strains containing the resistance marker are obtained by screening on a resistance medium containing hygromycin.

Preferably, the long-chain dibasic acid is at least one selected from long-chain dibasic acids with carbon chain lengths of C9-C22. Preferably, at least one of C9 to C18 long-chain dibasic acids includes sebacic acid or at least one of dodecanedioic acid (DC10), undecanedioic acid (DC11), dodecanedioic acid (DC12), tridecanedioic acid (DC13), tetradecanedioic acid (DC14), pentadecanedioic acid (DC15), hexadecanedioic acid (DC16), heptadecanedioic acid (DC17), and octadecanedioic acid (DC 18).

Preferably, the total content of diacyl glyceride and triacylglycerol in the obtained long-chain dibasic acid is 0.3ppm or less.

In a second aspect, the present invention provides a long-chain dibasic acid prepared by the method as described above, wherein the total content of diacylglyceride and triacylglycerol in the long-chain dibasic acid is 0.3ppm or less.

Preferably, when the long-chain dicarboxylic acid produced by fermentation is a twelve-carbon long-chain dicarboxylic acid, the total content of diacylglyceride and triacylglycerol in the obtained long-chain dicarboxylic acid is below 0.3 ppm; wherein the content of DAG impurity is lower than 0.1ppm, and the content of TAG impurity is lower than 0.2 ppm.

Preferably, when the diacylglyceride is C₃₉H₇₂O₅The triacylglycerol is C₅₇H₁₀₄O₆When C is in contact with₃₉H₇₂O₅And C₅₇H₁₀₄O₆The total content of (B) is 0.3ppm or less, preferably 0.25ppm or less.

Further, the content of impurities of diacylglyceride and triacylglycerol in the fermentation broth after the end of fermentation is reduced by at least 10%, preferably at least 20%, more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more, relative to the long-chain dicarboxylic acid producing strain before modification, of the microorganism in which the SCT1 gene is not knocked out, by fermenting to produce the long-chain dicarboxylic acid by the method of the present invention.

In a fourth aspect, the present invention provides a long chain dibasic acid product having a substantially reduced level of DAG and TAG impurities, as obtained by the above method, wherein the total level of diacyl glycerides and triacylglycerides in the long chain dibasic acid product is below 0.3 ppm.

By the technical scheme, the invention at least has the following advantages and beneficial effects:

by using the method, the concentration of the fermentation substrate in the fermentation broth is controlled to be 0.1-17% when the long-chain dicarboxylic acid is produced by fermentation, the mass ratio of DAG and TAG impurities in the finally obtained long-chain dicarboxylic acid product is obviously reduced, the total content of DAG and TAG impurities can be reduced to be below 0.3ppm, and the method has high fermentation efficiency. In addition, in the fermentation process, the engineering bacteria after genetic engineering is preferably used. The reduction of DAG and TAG impurity content further improves the purity of the fermentation product long-chain dibasic acid, so that the dibasic acid product can be used as an important raw material of products such as engineering plastics, synthetic perfumes, cold-resistant plasticizers, high-grade lubricating oil, polyamide hot melt adhesives and the like, is more beneficial to the production and manufacture of downstream products, and improves the quality of the downstream products. More importantly, the long-chain dibasic acid with low DAG and TAG impurity content greatly reduces the difficulty of the extraction and purification of the dibasic acid in the later period and the wastewater treatment process, simplifies the process and saves the energy consumption.

Drawings

FIG. 1 is a schematic flow chart of the method for knocking out a copy of SCT1 by homologous recombination in example 2 of the present invention.

FIG. 2 shows the alignment of amino acid sequences of 3-phosphoglycerate acyltransferase from different microbial species.

Detailed Description

Unless otherwise indicated, the examples follow conventional experimental conditions, such as, for example, the Molecular Cloning handbook of Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a L laboratory Manual,2001), or conditions as recommended by the manufacturer's instructions.

In the invention, the method for testing the contents of the dibasic acid, the alkane and the impurities can adopt a liquid chromatography-mass spectrometry combined technology.

Homologous genes refer to two or more gene sequences with 70% sequence similarity, including orthologous genes (also referred to as orthologous, or orthologous), transversely homologous genes (also referred to as paralogous, or paralogous), and/or heterologous homologous genes. The homologous gene of SCT1 in the invention can be the orthologous gene of SCT1 gene, and can also be the horizontal homologous gene or the heterologous homologous gene. In yeast cells, the first step of DAG assembly with TAG synthesis is catalyzed by the 3-phospho-glycerol acyltransferase SCT1(EC2.3.1.15), a key step in the entry of glycerol triphosphate into acylglycerol synthesis.

The results of amino acid sequence alignment of 3-phosphoglyceryl acyltransferase from different microbial species are shown in FIG. 2.

Sequence identity refers to the percentage of residues of a variant polynucleotide sequence that are identical to a non-variant sequence after alignment of the sequences and the introduction of gaps. In particular embodiments, a polynucleotide variant has at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.1%, at least about 99.2%, at least about 99.3%, 99.4%, at least about 99.5%, at least about 99.6%, 99.7%, at least about 99.8%, at least about 99.9%, at least about 99.91%, at least about 99.92%, at least about 99.93%, at least about 99.94%, at least about 99.95%, or at least about 99.96% polynucleotide or polypeptide homology to a polynucleotide described herein.

PCR overlap extension is also called SOE (gene splicing by overlap extension) PCR, and refers to a method for splicing different DNA fragments together by PCR amplification by designing primers with complementary ends.

The homologous recombination technology used in the present invention is not site-specific recombination, and the recombination is dependent on the intracellular DNA repair system.

The resistance marker is one of the selectable markers, which often carries the ability to confer survival to the transformant in the presence of antibiotics, and includes NPT, HYG, B L A, CAT, etc., which are resistant to kanamycin, hygromycin, ampicillin/carbenicillin, chloramphenicol, etc., respectively.

According to the common knowledge in the field of fermentation, the raw material adding amount of the fermentation medium is mass-volume ratio, namely w/v, and the percent represents g/100m L.

Optionally, the carbon source comprises one or more selected from glucose, sucrose and maltose; and/or the amount of the carbon source added is 1% to 10% (w/v), such as 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%.

Optionally, the nitrogen source comprises one or more selected from peptone, yeast extract, corn steep liquor, ammonium sulfate, urea and potassium nitrate; and/or the total amount of nitrogen sources added is 0.1% to 3% (w/v), such as 0.2%, 0.4%, 0.5%, 0.6%, 0.8%, 1.0%, 1.2%, 1.5%, 1.8%, 2.0%, 2.5%.

Optionally, the inorganic salt comprises one or more selected from potassium dihydrogen phosphate, potassium chloride, magnesium sulfate, calcium chloride, ferric chloride, copper sulfate; and/or the total amount of inorganic salts added is 0.1% to 1.5% (w/v), such as 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%.

Optionally, the trophic factors include one or more selected from vitamin B1, vitamin B2, vitamin C, biotin; and/or the total addition amount of the nutritional factors is 0-1% (w/v), such as 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%.

The OD value in the present invention is a value measured when the optical density of the bacterial cells is diluted 30-fold in each of the following embodiments and examples, which are not particularly described.

The production method of the long-chain dibasic acid comprises a thallus growth period and a fermentation conversion period (acid production period).

The invention provides a method for producing long-chain dicarboxylic acid by fermentation, which is preferably carried out under the following conditions when long-chain alkane is taken as a substrate: the fermentation temperature is 28-32 ℃, the air volume is 0.3-0.7 vvm, the pressure is 0.05-0.14 MPa, the pH value of the thallus in the growth period is 3.5-6.5, and the pH value of the thallus in the conversion period is 5.0-8.0.

In a preferred embodiment of the invention, the Dissolved Oxygen (DO) during the fermentative conversion is not less than 15%.

In a preferred embodiment of the invention, the concentration of the fermentation substrate is controlled between 0.1% and 17%, preferably between 0.1% and 15%, when the long-chain dicarboxylic acid is produced by fermentation. Preferably, the concentration of the fermentation substrate is controlled within any one of the ranges of 0.1% to 0.5%, 0.5% to 1%, 0.5% to 2%, 1% to 3%, 2% to 4%, 3% to 5%, 4% to 6%, 5% to 7%, 6% to 8%, 7% to 9%, 8% to 10%, 9% to 11%, 10% to 12%, 11% to 13%, 12% to 14%, 13% to 15%, 14% to 16%, or 15% to 17%, or within any combination of the endpoints of these ranges, such as within the range of 1% to 10% of the 1% and 10% of the 10% endpoint, or within the range of 2% to 12% of the 2% and 12% of the 12% endpoint. The substrate concentration refers to the volume concentration of the fermentation substrate in the fermentation broth. By controlling the substrate concentration is meant controlling the volume concentration of the fermentation substrate in the fermentation broth throughout the fermentation process. The concentration of the substrate can be controlled by adjusting the adding speed of the fermentation substrate in the fermentation process and detected by gas chromatography-mass spectrometry.

In a preferred embodiment of the invention, the fermentation substrate can be added in a batch or continuous feed.

In a preferred embodiment of the present invention, the process for producing the long-chain dicarboxylic acid may comprise the following processes:

the seed bottle culture process comprises the following steps:

inoculating the glycerol tube strain of the candida tropicalis into a seed bottle filled with a YPD liquid culture medium, and performing shake culture at 200-250 rpm for 1-2 days at the temperature of 28-32 ℃ under natural pH.

YPD medium, formula (w/v) is: 1-3% of peptone, 1-3% of glucose and 1-3% of yeast extract.

The seeding tank culture process comprises the following steps:

inoculating seeds obtained from a seed bottle into a seed tank filled with a seed culture medium, wherein the inoculation amount is 10-30% (v/v, relative to the initial volume of seed culture), the initial pH value of a fermentation system after inoculation is 6.0-6.8, the temperature is 28-32 ℃, the ventilation amount is 0.3-0.7 vvm, the tank pressure is 0.05-0.14 MPa, a certain stirring speed is kept to control the dissolved oxygen in the seed culture process to be not less than 10%, the culture is finished until the seeds are mature, and the standard of culturing mature seeds is OD after 30 times dilution₆₂₀≥0.5，OD₆₂₀Can be 0.5 to 1.0, and can be about 0.8.

The preferable formula (w/v) of the seed culture medium is 10-20 g/L of cane sugar, 3-8 g/L of yeast extract and 2-4 g/L of corn steep liquor for industrial fermentation₂PO₄4-12 g/L, and 0.5-4 g/L of urea (preferably sterilized separately at 115 ℃ for 20 min).

In some preferred embodiments of the invention, a fermentation substrate, preferably n-alkanes, including any one of n-decane to n-nonadecane, may be added to the initial seed medium.

Fermentation process of the fermentation tank:

inoculating the seed liquid obtained by culturing in a seed tank into a fermentation tank containing a fermentation medium, wherein the inoculum size is 10% ~ E30% (v/v, relative to the initial volume of fermentation), controlling the temperature of 28-32 ℃ in the fermentation process, controlling the ventilation quantity to be about 0.3-0.7 vvm, controlling the tank pressure (gauge pressure) to be about 0.05-0.14 MPa, keeping a certain stirring speed, and controlling the dissolved oxygen to be not less than 10%. Controlling the pH value of the thallus in the growth period to be 3.5-6.5 until the Optical Density (OD) of the thallus is reached₆₂₀) And when the pH value is more than 0.5, controlling the pH value in the conversion period to be 5.0-8.0 until the fermentation is finished, starting to add a fermentation substrate when the fermentation is performed for 10-20 hours, controlling the concentration of the fermentation substrate in the fermentation liquid in the whole fermentation process to be 0.1-17%, controlling the total addition amount of the fermentation substrate to be 300-500 m L/L (v/v, relative to the initial volume of the fermentation), and adjusting the pH value to be 5.0-8.0 by using 1N HCl and 1N NaOH in the fermentation process when the fermentation substrate is detected to be 0.

The preferable formula (w/v) of the fermentation medium is 10-40 g/L of sucrose, 1-5 g/L of corn steep liquor and 4-12 g/L0-3 g/L of yeast extract₃4～12g/L，KH₂PO₄4-12 g/L, and 0.5-3 g/L of urea (preferably sterilized separately at 115 ℃ for 20 min).

In a preferred embodiment of the invention, a fermentation substrate, preferably n-alkanes, including any of n-decane to n-nonadecane, may be added to the fermentation medium. Fermentation substrates may also be added during the fermentation process.

In some preferred embodiments of the invention, the strain may be inoculated in an amount of 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 22%, 24%, 25%, 27%, 29%.

Extraction of long-chain dibasic acid: and (4) separating and extracting fermentation liquor obtained after fermentation to obtain a long-chain dicarboxylic acid finished product. The extraction step comprises acidifying the fermentation liquor or fermentation treatment liquid, and separating to obtain long-chain dicarboxylic acid.

The fermentation treatment liquid can be a mixed solution obtained by alkalizing, decoloring, separating solid from liquid and the like. The fermentation treatment liquid may or may not include bacterial cells.

The acidification is to perform acidification treatment on the fermentation liquid or the fermentation treatment liquid, adjust the pH value of the fermentation liquid or the fermentation treatment liquid to 2-6.5, and preferably use inorganic acid such as sulfuric acid, hydrochloric acid, nitric acid or mixed acid thereof during acidification. Preferably the end point pH of the acidification is below 5.

In some specific embodiments of the present invention, the extracting step includes adjusting the pH of the long-chain dibasic acid fermentation solution to be 7 or more after the end of fermentation by adding alkali before acidification to obtain an alkali solution containing a long-chain dibasic acid salt or a fermentation treatment solution, and then performing solid-liquid separation. The solid-liquid separation includes filtration and/or centrifugal separation, and a commonly used solid-liquid separation apparatus may be used. For the alkalization treatment, sodium hydroxide, ammonia water or potassium hydroxide may be used.

In some embodiments of the present invention, the alkaline solution containing the long-chain dibasic acid salt is centrifuged by using a centrifugal device, and preferably, after centrifugation, the impurities containing the bacterial cells are continuously separated by using a filter membrane. Or treating the alkali solution containing the long-chain dibasic acid salt directly by using a filter membrane to separate impurities such as residual bacteria, large protein and the like from the solution. The filter membrane is preferably a ceramic membrane. When the ceramic membrane is used for membrane filtration, the pressure before the membrane is preferably 0.2-0.4 MPa; the pore diameter of the membrane core of the filtering membrane is preferably 0.05-0.2 micron.

Preferably, the step of extracting and purifying further comprises decoloring the fermentation liquor or fermentation treatment liquor containing the long-chain dibasic acid salt, adding activated carbon into the fermentation liquor or membrane clear liquid containing the long-chain dibasic acid salt for decoloring, filtering to remove the activated carbon after decoloring, wherein the decoloring step can further remove impurities in the long-chain dibasic acid solution. Preferably, the amount of activated carbon added is 0.1 to 10 wt%, preferably 1 to 8 wt% (relative to the amount of long chain dibasic acid contained in the solution). When the activated carbon is used for decoloring, the decoloring temperature is 60-100 ℃, and the decoloring time is 15-165 min.

Preferably, the obtained long-chain dicarboxylic acid precipitate is further purified, that is, the long-chain dicarboxylic acid precipitate is dissolved in an organic solvent, the long-chain dicarboxylic acid is crystallized by cooling, evaporation and dissolution, and then the crystal is separated, so that the purified long-chain dicarboxylic acid is obtained. The organic solvent comprises one or more of alcohol, acid, ketone and ester; wherein the alcohol comprises one or more of methanol, ethanol, isopropanol, n-propanol, and n-butanol; the acid comprises acetic acid or formic acid; the ketone comprises acetone; the esters include ethyl acetate and/or butyl acetate. Preferably, the purification conditions are: preserving the heat at 70-100 ℃ for 30-180 minutes, cooling for crystallization, and then carrying out solid-liquid separation.

In a preferred embodiment of the present invention, the long-chain dibasic acid product obtained by the present invention can be further subjected to extraction treatment by referring to the refining process in example 1 of CN 101985416 a.

Example 1 culture Medium, culture fermentation method, and Long-chain dicarboxylic acid detection method

1. YPD medium, formula (w/v) 2% peptone, 2% glucose and 1% yeast extract (OXOID, &. lTtT transfer = L "&. gTt L &. lTt/T &. gTt P0021).

2. The seed culture medium has the formula (w/v) of 10 g/L of sucrose, 3 g/L of yeast extract (total nitrogen content is 6.5wt percent), and 2 g/L of corn steep liquor for industrial fermentation (corn steep liquor for short, total nitrogen content is 2.5wt percent)₂PO₄4 g/L, urea 0.5 g/L (sterilized separately at 115 ℃ C. for 20 min).

3. The fermentation medium has the formula (w/v) of 10 g/L g of sucrose, 1 g/L g of corn steep liquor and 4 g/L g of yeast extract (the total nitrogen content is 6.5 wt%)₃4g/L，KH₂PO₄4 g/L, urea 0.5 g/L (sterilized separately at 115 ℃ C. for 20 min).

4. Extraction of long-chain dibasic acid:

(1) firstly, adjusting the pH value of the fermentation liquor to 8.5 by using a sodium hydroxide solution with the mass concentration of 30%, adding water to adjust the concentration of the long-chain dibasic acid to 8.5 wt%, heating to 50 ℃, and filtering the fermentation liquor by using a ceramic membrane with the pore diameter of 0.1 micrometer. The area of the ceramic membrane used was 0.84m²And setting the pressure before the membrane to be 0.3MPa, and collecting membrane clear liquid. (2) 7 wt% of powdered activated carbon was added to the collected membrane clear solution to decolorize at 60 ℃ for 1h, and filtered to obtain a clear liquid. (3) And adding sulfuric acid into the clear liquid, adjusting the pH value to 3.5, cooling to room temperature, filtering to obtain a wet solid, washing a filter cake with purified water with the weight of 3 times that of the wet solid, filtering, and drying to obtain a corresponding long-chain dicarboxylic acid primary product. (4) Adding 95% acetic acid into corresponding long-chain dicarboxylic acid product, heating to dissolve, addingAdding 1 wt% macroporous powder active carbon for decolorization, decolorizing at 85 deg.C for 1 hr, filtering to obtain clear liquid, cooling to 30 deg.C, washing with water to obtain wet solid, and oven drying to obtain long chain dicarboxylic acid product.

5. Liquid chromatography-mass spectrometry combined technology for detecting DAG (C)₃₉H₇₂O₅) And TAG (C)₅₇H₁₀₄O₆) Method for impurity content and acid yield

Liquid chromatograph Agilent 1290Infinity II L C (cat No. 54983)

Chromatographic column Agilent Elipse Plus-C18(2.1 × 50mm, 1.8. mu.M)

The method comprises the steps of heating to 230 ℃ at the initial temperature of 100 ℃ and 15 ℃/min, keeping for 2min, using hydrogen as carrier gas, keeping the injection port temperature at 280 ℃, keeping the FID temperature at 280 ℃, and keeping the injection amount at 4 mu L.

And (4) calculating the yield of the dibasic acid according to an internal standard method, and calculating the impurity content according to the peak area of the dibasic acid product and the peak area of the impurity.

The mass spectrum parameters are APCI and Negative in ion mode, 325 ℃ of gas temperature, 10L/min of drying gas flow, 40psig of atomizing gas, 350 ℃ of sheath gas, 12L/min of sheath gas flow, 4000V of capillary voltage, 150V of nozzle voltage and 3 times/s of scanning mode.

And calculating the purity and the impurity content of the product according to the peak area of the dibasic acid product and the peak area of the impurity.

Example 2 cloning of the SCT1 Gene

1. Total RNA extraction and transcriptome sequencing

M2011192 Candida tropicalis single colony is inoculated into a 2ml centrifuge tube containing 1ml YPD medium (containing 100 mg/L hygromycin B) described in example 1, shaking-cultured at 250rpm for 1 day at 30 ℃, the bacterial liquid is inoculated into a 500M L shaking flask containing 30ml seed medium (containing 100 mg/L hygromycin B) described in example 1, the inoculation amount is 3%, the bacterial liquid is cultured at 250rpm and 30 ℃ until the bacterial liquid is OD₆₂₀When the inoculation amount reaches 0.8, the seed liquid is inoculated into a 500m L shaking flask containing 15ml of the fermentation medium described in example 1, the inoculation amount is 20 percent, the fermentation is finished after the seed liquid is cultured for 36 hours at 30 ℃ and 250rpm, the seed liquid is centrifuged at 5000rpm for 5min (Joua BR4i, rotor AB50.10A) to collect the bacterial liquid, and the fermentation substrate in the fermentation medium is 400m L/L n-dodecane. And in the culture process, the pH value is adjusted to 7.5-7.6 by intermittently supplementing 1N HCl and 1N NaOH.

The transcriptome sequencing adopts Miseq (Illumina) platform and double-ended sequencing method to obtain 20M Read measured with the length of 2 × 251bp, removes linker, filters low-quality base and Reads with CutAdpt (v1.1.6), assembles with Trinity software (http:// trinitylnaseq. sf. net) to obtain Unigene, and performs functional annotation with NCBI's Non-Redundant protein database.

2. Bioinformatics analysis

The resulting Unigene was pooled using the local Blast (Blast +2.7.1) method and the candidate genes were searched for alignments by tblastn using known glycerol triphosphate acyltransferase genes from Saccharomyces cerevisiae (Saccharomyces cerevisiae), Candida tropicalis (Candida tropicalis MYA3404), Yarrowia lipolytica (Yarrowia lipolytica) and Candida albicans (Candida albicans) as the query. Finally, a candidate CtSCT1 gene is screened by analysis, and a partial CDS sequence is shown as SEQ ID NO. 16. The accession numbers of glycerol-3-phosphate acyltransferase genes in Genbank in different microorganisms are Saccharomyces cerevisiae (EWG87580), Candidatropicalis MYA3404 (XP-002548333), Yarrowia lipolytica (XP-501275) and Candidaalbicans (KGU30921), respectively.

EXAMPLE 3 preparation of homologous recombination templates

In this example, Takara was used for all DNA fragments

HS high fidelity DNA polymerase (Takara, R040A). The purified DNA fragment was recovered by an Axygen gel recovery kit (Axygen, AP-GX-250G) after electrophoresis in 1% agarose gel.

1. Amplification of upstream and downstream homology arms of SCT1 gene

Extracting yeast (strain preservation number: CCTCC NO: M2011192) genome DNA, adopting an Ezup yeast genome DNA rapid extraction kit (biological engineering (Shanghai) GmbH, product number 518257), and improving the wall breaking efficiency by a liquid nitrogen grinding method, adding 1 mu g of genome into each 50 mu L reaction system as a template to perform PCR amplification, and using primers for upstream homologous arm amplification as follows:

SCT_UP-F：

5’-GAGCGACCAAAGCGATTCAG-3’(SEQ ID NO:1)

SCT_UP-R:

5’-TTTGCCATCGTTCCAACAGC-3’(SEQ ID NO:2)

the primers used for the downstream homology arm amplification are as follows:

SCT_DOWN-F：

5’-ATGAGTGACGGGGTCTCCTT-3’(SEQ ID NO:3)

SCT_DOWN-R:

5’-ATGAGTGACGGGGTCTCCTT-3’(SEQ ID NO:4)

the PCR reaction conditions were as follows: 30s at 98 ℃; 30 cycles of 98 ℃ for 10s,55 ℃ for 10s, and 72 ℃ for 30 s; 5min at 72 ℃.

The obtained products are amplified into SCT _ UP and SCT _ DOWN which are proved to be error-free by sequencing, and the sequences are respectively shown as SEQ ID NO. 5 and SEQ ID NO. 6.

2. Amplification of the resistance selection marker (HYG, i.e., the hygromycin resistance gene), the amplification template being the vector pCIB2(SEQ ID NO:7), the primer sequences and PCR reaction conditions were as follows:

SCT_HYG-F：

5’-GCTGTTGGAACGATGGCAAAGCATGCGAACCCGAAAATGG-3’(SEQ ID NO:8)

SCT_HYG-R：

5’-AAGGAGACCCCGTCACTCATGCTAGCAGCTGGATTTCACT-3’(SEQ ID NO:9)

the PCR reaction conditions were as follows: 30s at 98 ℃; 10s at 98 ℃, 10s at 55 ℃, 1min at 72 ℃ for 50s, and 5 cycles; 10s at 98 ℃, 2min at 72 ℃ and 25 cycles; 5min at 72 ℃.

The obtained amplification product is called HYG, and the sequence of the HYG is shown in SEQ ID NO. 10 after being proved to be error-free by sequencing.

3. PCR overlap extension to obtain complete recombinant template

And (3) performing overlapping extension on the recovered and purified PCR fragments of 5, 6 and 10 of the SEQ ID NO to obtain a homologous recombination template, and recovering and purifying. The specific method comprises the following steps:

adding equimolar amount of SCT _ UP, SCT _ DOWN and HYG fragments as template, and primer of SCT _ UP-F and SCT _ Down-R

Performing PCR overlap extension by using HS high-fidelity DNA polymerase, wherein the PCR reaction conditions are as follows: 30s at 98 ℃; 10s at 98 ℃, 10s at 55 ℃, 2min at 72 ℃ for 30s, and 20 cycles; and 8min at 72 ℃.

The gel electrophoresis was followed by recovery and purification of a recombinant fragment of about 2.2Kb in size, the sequence of which is shown in SEQ ID NO 11.

Fig. 1 is a schematic flow chart of the process of knocking out a copy of SCT1 by homologous recombination.

Example 4 transformation of recombinant transformants

1. Preparation of Yeast electrotransformation competent cells

Yeast cells cultured overnight at 30 ℃ and 250rpm with shaking plates were inoculated in 100M L YPD medium of example 1 with CCTCC NO: M2011192 to OD₆₂₀Is 0.1. Cultured to OD under the same conditions₆₂₀At 1.3, cells were harvested by centrifugation at 3000g and 4 ℃ after washing the cells twice with ice-cold sterile water and harvesting, the cells were resuspended in 10ml of ice-precooled 1M sorbitol solution, the cells were harvested by centrifugation at 1500g and resuspended in 1ml of the above sorbitol solution, 100. mu. L cell suspension was aliquoted for genetic transformation.

2. Yeast competent electroporation transformation

Mu.g of recovered and purified DNA fragment SEQ ID NO 11 was added to the competent cells, and the cells were allowed to stand on ice for 5min and then rapidly transferred to a 0.2cm cuvette, transformed by electric shock (BioRad, Micropulser. TM. electroporation, transformation program SC2, 1.5kV, 25uFD, 200 ohms.) A mixture of 1M L YPD and 1M sorbitol (1:1, v/v) was rapidly added thereto, cultured at 30 ℃ and 200rpm for 2 hours, then the bacterial solution was collected and plated on YPD medium plates containing 100 mg/L hygromycin B, and cultured at 30 ℃ for 2 to 3 days until single colonies were grown.

Example 5 screening of recombinant transformants

Single colonies obtained in example 3 were picked and inoculated into 2ml centrifuge tubes containing 1ml YPD medium (containing 100 mg/L hygromycin B) from example 1, and cultured overnight at 30 ℃ at 250rpm for colony PCR identification the next day using the following primer sequences and PCR reaction conditions:

the primer sequences for identifying the SCT1 gene are as follows:

SCT-1F:5’-AAGATCCCCAGAGAGGGTCC-3’(SEQ ID NO:12)

SCT-1R:5’-ATGCACCCATCATCAGCCAA-3’(SEQ ID NO:13)

the primer sequences for identifying homologous recombination are as follows:

HYG-2F:5’-TGTGCTACCCACGCTTACT-3’(SEQ ID NO:14)

SCT1-Down-2R:5’-ACTGACTGTCCATTCTGTTCTCTC-3’(SEQ ID NO:15)

the PCR reaction conditions were as follows: 30s at 98 ℃; 30 cycles of 98 ℃ for 10s,55 ℃ for 10s, and 72 ℃ for 40 s; 5min at 72 ℃.

The two groups of PCR primers are amplified to obtain strains with fragments of about 500bp and 600bp respectively, namely a strain with one copy of the SCT1 gene knocked out, and the strain is named as 630.

EXAMPLE 6 production of twelve-carbon Long-chain dicarboxylic acid (DC12) by recombinant Strain Shake flask fermentation

Single colonies of strain 630 were picked and inoculated into 2ml centrifuge tubes containing 1ml YPD medium (100 mg/L hygromycin B) described in example 1, and shake-cultured at 30 ℃ and 250rpm for 1 day, and the above-mentioned bacterial solution was inoculated into 30ml of 500m L shake flasks containing seed medium (100 mg/L hygromycin B) described in example 1, at an inoculum size of 3%, and shake-cultured at 250rpm and 30 ℃ until OD₆₂₀And when the inoculation amount reaches 0.8, inoculating the seed solution into a 500m L shaking flask filled with 15ml of the fermentation medium described in the embodiment 1, wherein the inoculation amount is 20%, continuously shaking and culturing at 250rpm and 30 ℃ until the fermentation is finished, wherein a fermentation substrate in the fermentation medium is 400m L/L N-dodecane, and the pH value is adjusted to 7.5-7.6 in the culture process by intermittently supplementing 1N HCl and 1N NaOH.

Meanwhile, the strain CCTCC NO: m2011192 as a control: the cultivation and fermentation process was the same as above except that the medium did not contain hygromycin B. The results of the acid yield of DC12 in the fermentation broth are shown in table 1.

The method for extracting the dibasic acid product after the fermentation is finished is as described in step 4 of example 1. The content of DAG and TAG impurities in the finished diacid product is detected as described in example step 5, and the results are shown in Table 1.

TABLE 1

As can be seen from table 1, the total amount of impurities DAG and TAG in the strain in which one copy of SCT1 gene was knocked out was reduced by about 18.5% and the amount of acid produced was slightly increased, as compared to the control group.

EXAMPLE 7 Strain 630 Shake flask fermentation for production of undecanoic Long chain dibasic acid (DC11)

The fermentation conditions, extraction and purification, and DAG and TAG content detection methods were all the same as those in example 5, except that the fermentation substrate in the fermentation medium was 300m of L/L n-undecane.

The acid yield of DC11 in the fermentation liquid and the detection results of the contents of DAG and TAG as impurities in the finished product of the dibasic acid are shown in Table 2.

TABLE 2

Bacterial strains	CCTCC M 2011192	630
			Acid yield (mg/g) of DC11 in fermentation broth	121.1	122.3
DAG impurity content (C)39H72O5，ppm)	0.106	0.086
			TAG impurity content (C)57H104O6，ppm)	0.183	0.151
Total (DAG + TAG, ppm)	0.289	0.237

As can be seen from table 2, the total amount of impurities DAG and TAG in the strain in which one copy of SCT1 gene was knocked out was reduced by about 18.0% and the amount of acid produced was slightly increased, as compared to the control group.

EXAMPLE 8 production of hexadecane long chain dicarboxylic acid (DC16) by Strain 630 Shake flask fermentation

The fermentation conditions, extraction and purification, and DAG and TAG content detection methods were all the same as those in example 5 except that the fermentation substrate in the fermentation medium was 500m L/L n-hexadecane.

The acid yield of DC16 in the fermentation liquid and the detection results of the contents of DAG and TAG as impurities in the finished product of the dibasic acid are shown in Table 3.

TABLE 3

Bacterial strains	CCTCC NO：M 2011192	630
			Acid yield (mg/g) of DC16 in fermentation broth	136.7	138.2
DAG impurity content (C)39H72O5，ppm)	0.121	0.087
			TAG impurity content (C)57H104O6，ppm)	0.152	0.133
Total (DAG + TAG, ppm)	0.273	0.220

As can be seen from table 3, the total amount of impurities DAG and TAG in the strain in which one copy of SCT1 gene was knocked out was reduced by about 19.4% and the amount of acid produced was slightly increased, as compared to the control group.

From the above experimental results of examples 6, 7 and 8 for the production of long-chain dibasic acids by fermentation on different fermentation substrates in the shake flask stage, it can be seen that the acid yield was slightly increased under the same fermentation conditions for different fermentation substrates such as n-dodecane, n-undecane and n-hexadecane, and that the content of DAG as an impurity and TAG in the product after the extraction of the finished product of dibasic acid was reduced by at least 18% compared with the parent strain.

EXAMPLE 9 Strain 630 production of dodecanedioic acid (DC12) by fermentation at tank scale 10L

The glycerol tube strain of strain 630 was inoculated into a seed flask containing YPD liquid medium described in example 1, and shake-cultured at 28 ℃ and 200rpm for 1 day under a natural pH.

The shake flask seeds were inoculated into a seed tank containing the seed medium described in example 1 (containing 100 mg/L hygromycin B), the inoculum size was 10%, the initial pH of the inoculated fermentation system was 6.0, the aeration rate was 0.3vvm at 28 ℃ and the tank pressure was 0.14MPa, and a certain stirring speed was maintained to controlThe dissolved oxygen in the seed production process is not less than 10%, the seed is cultured for 15h until the seed is mature, and the OD is diluted by 30 times₆₂₀Is 0.8.

Inoculating the seed liquid obtained by culturing in a seed tank into a fermentation tank containing the fermentation culture medium described in example 1, wherein the fermentation starting volume after inoculation is 4L, the inoculation amount is 10% (v/v, relative to the fermentation starting volume), 30ml (v/v, relative to the fermentation starting volume) of n-dodecyl alkane is added at the beginning of fermentation, the fermentation process is controlled at 29 ℃, the ventilation amount is about 0.6vvm, the tank pressure (gauge pressure) is about 0.1MPa, a certain stirring speed is kept to control the dissolved oxygen not less than 10%, the pH of a fermentation system in the growth period of the thallus is controlled to be 4.4-4.6, and the Optical Density (OD) of the thallus is controlled₆₂₀) When the concentration of n-dodecyl alkane in the fermentation liquor is controlled to be 0.1-0.5%, 1-3%, 8-10% and 15-17% in the whole fermentation process, the total alkane addition is 400m L/L, the fermentation is finished when the alkane is detected to be 0, and the acid yield of DC12 in the fermentation liquor is shown in Table 4.

The extraction of the product after fermentation was as described in step 4 of example 1. The content of DAG and TAG as impurities in the finished diacid product is detected as described in step 5 of example 1, and the results are shown in Table 4.

TABLE 4

Substrate concentration (%)	0.1～0.5	1～3	8～10	15～17
					Acid yield (mg/g) of DC12 in fermentation broth	145.5	157.8	158.0	125.6
DAG content (C)39H72O5，ppm)	0.053	0.079	0.088	0.109
					TAG content (C)57H104O6，ppm)	0.084	0.118	0.135	0.184
Total (DAG + TAG, ppm)	0.137	0.197	0.223	0.293
					Fermentation time (hours)	188	164	167	177

As can be seen from Table 4, the lower the concentration of the fermentation substrate is controlled, the lower the DAG and TAG impurities are.

EXAMPLE 10 fermentation of Strain 630 at 10L Scale to produce undecanedioic acid (DC11)

The glycerol tube strain of strain 630 was inoculated into a seed flask containing YPD liquid medium described in example 1, and shake-cultured at 220rpm at 30 ℃ for 2 days with natural pH.

Inoculating the shake flask seeds into a seed tank filled with the seed culture medium (containing 100 mg/L hygromycin B) described in example 1, wherein the inoculation amount is 30%, the initial pH value of the inoculated fermentation system is 6.5, the ventilation rate is 0.3vvm at 30 ℃, the tank pressure is 0.14MPa, a certain stirring speed is kept, the DO in the seed culture process is controlled to be not less than 10%, the seeds are cultured for 20h, and the standard of culturing mature seeds is that the OD is obtained after the seeds are diluted by 30 times₆₂₀Is 1.0.

Inoculating the seed solution obtained by seed tank culture into a fermentation tank containing the fermentation medium described in example 1, wherein the initial fermentation volume after inoculation is 5L, the inoculation amount is 20% (v/v, relative to the initial fermentation volume), the fermentation process is controlled at 30 ℃, the ventilation rate is about 0.3vvm, the tank pressure (gauge pressure) is about 0.14MPa, a certain stirring speed is kept, the dissolved oxygen is controlled to be not less than 10%, the pH of the fermentation system in the growth period of the thallus is controlled to be 5.5, and the Optical Density (OD) of the thallus is controlled₆₂₀) When the concentration of the n-undecane is more than 0.5, the pH of the fermentation system in the conversion period is controlled to be 7.4-7.5 until the fermentation is finished, when the fermentation is started to 10 hours, the n-undecane is added, the volume concentration of the n-undecane in the fermentation liquid in the whole fermentation process is controlled to be within four concentration ranges of 0.1-0.5%, 1-3%, 8-10% and 15-17%, the total alkane addition is 300m L/L, when the alkane is detected to be 0, the fermentation is finished, and the result of the acid yield of DC11 in the fermentation liquid is shown in Table 5.

The extraction of the product after fermentation was as described in step 4 of example 1. The content of DAG and TAG as impurities in the finished diacid product is detected as described in step 5 of example 1, and the results are shown in Table 5.

TABLE 5

Substrate concentration (%)	0.1～0.5	1～3	8～10	15～17
					Acid yield (mg/g) of DC11 in fermentation broth	117.7	128.4	126.3	95.9
DAG impurity content (C)39H72O5，ppm)	0.042	0.077	0.083	0.110
					TAG impurity content (C)57H104O6，ppm)	0.089	0.110	0.116	0.175
Total (DAG + TAG, ppm)	0.131	0.187	0.199	0.285
					Fermentation time (hours)	178	156	163	173

As can be seen from Table 5, the lower the concentration of the fermentation substrate is controlled, the lower the DAG and TAG impurities are.

EXAMPLE 11 fermentation of Strain 630 at 10L Scale to produce hexadecanedioic acid (DC16)

Inoculating Candida tropicalis glycerol tube strain into seed bottle containing YPD liquid culture medium, and shake culturing at 250rpm at 32 deg.C for 2 days under natural pH.

Inoculating shake flask seeds into a seed tank filled with the seed culture medium (containing 100 mg/L hygromycin B) described in example 1, wherein the inoculation amount is 30%, the initial pH value of the inoculated fermentation system is 6.5, the ventilation rate is 0.7vvm at 32 ℃, the tank pressure is 0.1MPa, a certain stirring speed is kept to control the dissolved oxygen in the seed culture process to be not less than 10%, the seeds are cultured for 30 hours until the seeds are mature, and the OD is diluted by 30 times₆₂₀Is 0.9.

Inoculating the seed liquid obtained by culturing in a seed tank into a fermentation tank containing the fermentation culture medium described in example 1, wherein the initial fermentation volume after inoculation is 6L, the inoculation amount is 30% (v/v, relative to the initial fermentation volume), 10% (v/v, relative to the initial fermentation volume) of n-hexadecane is added at the beginning of fermentation, the temperature in the fermentation process is controlled at 32 ℃, the ventilation amount is about 0.7vvm, the tank pressure (gauge pressure) is about 0.05MPa, a certain stirring speed is kept, the dissolved oxygen is controlled to be not less than 10%, the pH of a fermentation system in the growth period of the thallus is controlled to be 6.4-6.5, and the Optical Density (OD) of the thallus is controlled₆₂₀) When the concentration of the n-hexadecane is higher than 0.5, controlling the pH value of a fermentation system in the conversion period to be 7.5-7.6 until the fermentation is finished, starting to add the n-hexadecane when the fermentation is finished for 20 hours, controlling the volume concentration of the n-hexadecane in the fermentation liquor in the whole fermentation process to be in four concentration ranges of 0.1-0.5%, 1-3%, 8-10% and 15-17%, wherein the total alkane addition is 500m L/L, and when the alkane is detected to be 0, the fermentation is finished, and the result of the acid yield of DC16 in the fermentation liquor is shown in Table 6.

The extraction of the product after fermentation was as described in step 4 of example 1. The content of DAG and TAG as impurities in the finished diacid product is detected as described in step 5 of example 1, and the results are shown in Table 6.

TABLE 6

Substrate concentration (%)	0.1～0.5	1～3	8～10	15～17
					Acid yield (mg/g) of DC16 in fermentation broth	129.7	141.5	143.0	129.5
DAG impurity content (C)39H72O5，ppm)	0.045	0.077	0.084	0.108
					TAG impurity content (C)57H104O6，ppm)	0.085	0.113	0.124	0.169
Total (DAG + TAG, ppm)	0.130	0.190	0.208	0.277
					Fermentation time (hours)	190	168	170	178

As can be seen from Table 6, the lower the concentration of the fermentation substrate is controlled, the lower the DAG and TAG impurities are.

From the experimental results in tables 4-6, it can be known that, when the concentration of the fermentation substrate is controlled to be too low, for example, 0.1% -0.5%, the content of impurities is low, but under the condition of the same total alkane addition, the fermentation time is relatively long, and the fermentation efficiency is reduced; when the concentration of the fermentation substrate is controlled within the range of 0.5-15%, the effects in the aspects of reducing the impurity content, ensuring the fermentation efficiency and acid yield are better; when the concentration of the fermentation substrate is controlled within the range of 15-17%, the acid production amount is reduced, and the acid production of cells can be inhibited if the concentration is too high, such as more than 15%.

EXAMPLE 12 construction of other recombinant strains and production of Dodecanedioic acid by Shake flask fermentation (DC12)

The 2.2Kb recombinant DNA fragment (SEQ ID NO:11) described in example 3 was constructed into Candida tropicalis (CCTCC NO: M203052) using the homologous recombination method, which was the same as in example 3. The method for transforming and screening the recombinant was the same as in examples 4 and 5, and the recombinant obtained by screening was named 631.

The method for producing the twelve-carbon long-chain dicarboxylic acid (DC12) by the shake flask fermentation of the recombinant strain 631 is the same as that in example 6, and the control strain is CCTCC NO: m203052. The results showed that the content of DAG and TAG as impurities in the dibasic acid product was measured in the same manner as in step 5 of example 1 in the case of the strain 631 as compared with the parent strain, and the results are shown in Table 7. The total content of DAG and TAG impurities was reduced by about 23.6% compared to the control group.

TABLE 7

Bacterial strains	CCTCC NO：M203052	631
			Acid yield (mg/g) of DC12 in fermentation broth	136.4	137.7
DAG content (C)39H72O5，ppm)	0.118	0.091
			TAG content (C)57H104O6，ppm)	0.187	0.142
Total (DAG + TAG, ppm)	0.305	0.233

Example 12 shows that an engineered bacterium obtained by knocking out a copy of the SCT1 gene in the genome of another Candida tropicalis (Candida tropicalis) by homologous recombination can significantly reduce the mass ratio of DAG to TAG impurities in a fermentation broth after the end of fermentation, as compared with a long-chain dibasic acid-producing strain before the engineering bacterium is engineered.

Example 13 Pre-engineering strains fermentation to produce dodecanedioic acid at 10L tank scale

The glycerol tube strain of the original strain (CCTCC NO: M2011192) before transformation is inoculated into a seed bottle filled with YPD liquid culture medium described in example 1, the pH is natural, and the strain is subjected to shake culture at the temperature of 28 ℃ and the rpm of 200 for 1 day.

The culture methods of the seeding tank and the fermentation tank are the same as that in the example 9, in the fermentation process, n-dodecyl alkane is added in batches when the fermentation is carried out for 15 hours, the volume concentration of the n-dodecyl alkane in the fermentation liquid in the whole fermentation process is controlled to be in four concentration ranges of 0.1-0.5%, 1-3%, 8-10% and 15-17%, the total alkane addition is 400m L/L, the fermentation is finished when the alkane is detected to be 0, and the acid yield of DC12 in the fermentation liquid is shown in Table 8.

The extraction of the product after fermentation was as described in step 4 of example 1. The content of DAG and TAG as impurities in the finished diacid product is detected as described in step 5 of example 1, and the results are shown in Table 8.

TABLE 8

Substrate concentration (%)	0.1～0.5	1～3	8～10	15～17
					Acid yield (mg/g) of DC12 in fermentation broth	141.3	154.8	155.0	123.3
DAG content (C)39H72O5，ppm)	0.064	0.099	0.112	0.124
					TAG content (C)57H104O6，ppm)	0.099	0.136	0.183	0.215
Total (DAG + TAG, ppm)	0.163	0.235	0.295	0.339
					Fermentation time (hours)	190	168	170	179

As can be seen from Table 8, the lower the concentration of the fermentation substrate is, the lower the contents of DAG and TAG are, but the fermentation time is relatively longer, while the concentration of the fermentation substrate is controlled to be 0.5% -15%, so that the effect is relatively better in the aspects of reducing the impurity content, ensuring the fermentation efficiency and the acid yield. Comparing the results of example 13 with those of example 9, it is clear that the modified strain obtained lower levels of impurities. The reduction of the impurity content reduces the difficulty and the production cost of the later extraction and purification process on one hand, and is more beneficial to the production and the manufacture of downstream nylon, plastic, polyamide hot melt adhesive and other products, and the product quality is improved on the other hand.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Shanghai Kaiser Biotechnology research and development center, Inc

CATHAY INDUSTRIAL BIOTECH Ltd.

<120> method for reducing content of acylglyceride impurities in long-chain dicarboxylic acid

<130>PA18045CN1

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gagcgaccaa agcgattcag 20

<210>2

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tttgccatcg ttccaacagc 20

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgagtgacg gggtctcctt 20

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgagtgacg gggtctcctt 20

<210>5

<211>271

<212>DNA

<213> Candida tropicalis (Candida tropicalis)

<400>5

gagcgaccaa agcgattcag gttggtcatt tacgactgct tgctctggct cttgtcagtg 60

atatttgatt gttttttcag agagatcaga ccgagagggg cgtttaagat ccccagagag 120

ggtccggtgatctttgttgc cgccccccat cataatcagt ttgttgatcc catcgtgttg 180

atgaaccagg tgaaaagaga agcaaaccga agaatatcat tcttgattgc ggccaagtca 240

tatcaattga aagctgttgg aacgatggca a 271

<210>6

<211>267

<212>DNA

<213> Candida tropicalis (Candida tropicalis)

<400>6

atgagtgacg gggtctcctt attaaactca gataattctt tgacaaatct cccaatgttt 60

tcggattacg tgttgcacaa gaacgcaaag aacccggact tggagcttga tccccaatct 120

ttggcggcat cgagagtcaa ttcgatggtc aacatacctc atgcttctca tggcgttaat 180

acgccatcac cgtcaacttc aagacgccca ccattgaccg aaaccgcctc gtcggagcat 240

atggaattga actttgggtc tggagcc 267

<210>7

<211>5873

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 60

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 120

cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 180

tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg aattcggtct 240

agtatgattg tcaataatga tgggtcatcg tttcctgatt cgacgttccc tgtggtgtcg 300

ttaaatagcc tgtctgaaat ctcctccatg attgtgttgg tgtgtgttgt ttgactttcc 360

caattgctta catttttttc ttcaaggatt cgctccaaaa tagacagaaa ttatcgcgac 420

aagtcagacg aacgtcgcac gaggcgaacc aaattcttta gaagcatacg aaaactcact 480

ttatttccat tagaagtatt aaattaacaa atatataata tacaggatac aaagtaaaag 540

cacgcttaag caaccaaagc ggaagcggta gcggattcgt atttccagtt aggtggcaag 600

acagcgacgg ttctgtagta tctggccaat ctgtggattc tagattcaat caaaatcaat 660

ctgaacttgg agtccttgtc ctttctgttt ctttccaagt gctttctgac agagacagcc 720

ttcttgatca agtagtacaa gtcttctggg atttctggag ccaaaccgtt ggatttcaag 780

attctcaaga tcttgttacc agtgacaacc ttggcttggg aaacaccgtg agcatctctc 840

aagataacac caatttgaga tggagtcaaa ccctttctgg cgtacttgat gacttgttca 900

acaacttcgt cagaagacaa cttgaaccaa gatggagcgt ttcttgagta tggaagagcg 960

gaggaggaaa tacctttacc ctaaaataac aagagctaat gttagtaatt tgaaaaaaaa 1020

gacgttgagc acgcacaccc catccacccc acaggtgaaa cacatcaaac gtagcaagaa 1080

caatagttgg ccctcccgtc aagggggcag gtaattgtcc aagtacttta gaaaagtatg 1140

tttttaccca taagatgaac acacacaaac cagcaaaagt atcaccttct gcttttcttg 1200

gttgaggttc aaattatgtt tggcaataat gcagcgacaa tttcaagtac ctaaagcgta 1260

tatagtaaca attctaggtc tgtatagtcg accgtaggtg aatcgtttac tttaggcaag 1320

accttgtccc tgataaagcc aggttgtact ttctattcat tgagtgtcgt ggtggtggta 1380

gtggtggttg attgggctgt tgtggtagta gtagtggttg tgatttggaa catacagatg 1440

aatgcatacg acccatgatg actgatttgt ttctttattg agttgatggt aagaaagaga 1500

agaagaggag gtaaaaaggt ggtagagtga aaaatttttt tctcttaaaa gtgagagaga 1560

gaaagagaaa aatttcactg cgaaacaaat ggttggggac acgacttttt tcaggaattt 1620

ttactcgaag cgtatatgca ggaaagttgt tgttagggaa tatggagcca caagagagct 1680

gcgaattcga gctcggtacc cggggatcct ctagagtcga cctgcaggca tgcgaacccg 1740

aaaatggagc aatcttcccc ggggcctcca aataccaact cacccgagag agagaaagag 1800

acaccaccca ccacgagacg gagtatatcc accaaggtaa gtaactcagg gttaatgata 1860

caggtgtaca cagctccttc cctagccatt gagtgggtat cacatgacac tggtaggtta 1920

caaccacgtt tagtagttat tttgtgcaat tccatgggga tcaggaagtt tggtttggtg 1980

ggtgcgtcta ctgattcccc tttgtctctg aaaatctttt ccctagtgga acactttggc 2040

tgaatgatat aaattcacct tgattcccac cctcccttct ttctctctct ctctgttaca 2100

cccaattgaa ttttcttttt ttttttactt tccctccttc tttatcatca aagataagta 2160

agtttatcaa ttgcctattc agaatgaaaa agcctgaact caccgcgacg tctgtcgaga 2220

agtttctcat cgaaaagttc gacagcgtct ccgacctcat gcagctctcg gagggcgaag 2280

aatctcgtgc tttcagcttc gatgtaggag ggcgtggata tgtcctccgg gtaaatagct 2340

gcgccgatgg tttctacaaa gatcgttatg tttatcggca ctttgcatcggccgcgctcc 2400

cgattccgga agtgcttgac attggggaat tcagcgagag cctcacctat tgcatctccc 2460

gccgtgcaca gggtgtcacg ttgcaagacc tccctgaaac cgaactcccc gctgttctcc 2520

agccggtcgc ggaggccatg gatgcgatcg ctgcggccga tcttagccag acgagcgggt 2580

tcggcccatt cggaccgcaa ggaatcggtc aatacactac atggcgtgat ttcatatgcg 2640

cgattgctga tccccatgtg tatcactggc aaactgtgat ggacgacacc gtcagtgcgt 2700

ccgtcgcgca ggctctcgat gagctcatgc tttgggccga ggactgcccc gaagtccggc 2760

acctcgtgca cgcggatttc ggctccaaca atgtcctcac ggacaatggc cgcataacag 2820

cggtcattga ctggagcgag gcgatgttcg gggattccca atacgaggtc gccaacatct 2880

tcttctggag gccgtggttg gcttgtatgg agcagcagac gcgctacttc gagcggaggc 2940

atccggagct tgcaggatcg ccgcggctcc gggcgtatat gctccgcatt ggtcttgacc 3000

aactctatca gagcttggtt gacggcaatt tcgatgatgc agcttgggcg cagggtcgat 3060

gcgacgcaat cgtccgatcc ggagccggga ctgtcgggcg tacacaaatc gcccgcagaa 3120

gcgcggccgt ctggaccgat ggctgtgtag aagtactcgc cgatagtgga aaccgacgcc 3180

ccagcactcg tccgagggca aaggaatagt gtgctaccca cgcttactcc accagagcta 3240

ttaacatcag aaatatttat tctaataaat aggatgcaaa aaaaaaaccc cccttaataa 3300

aaaaaaaaga aacgattttt tatctaatga agtctatgta tctaacaaat gtatgtatca 3360

atgtttattc cgttaaacaa aaatcagtct gtaaaaaagg ttctaaataa atattctgtc 3420

tagtgtacac attctcccaa aatagtgaaa tccagctgct agcgtgtaag cttggcactg 3480

gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt 3540

gcagcacatc cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct 3600

tcccaacagt tgcgcagcct gaatggcgaa tggcgcctga tgcggtattt tctccttacg 3660

catctgtgcg gtatttcaca ccgcatatgg tgcactctca gtacaatctg ctctgatgcc 3720

gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg acgggcttgt 3780

ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag 3840

aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg gcctcgtgat acgcctattt 3900

ttataggtta atgtcatgat aataatggtt tcttagacgt caggtggcac ttttcgggga 3960

aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat gtatccgctc 4020

atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt 4080

caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct 4140

cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt 4200

tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt 4260

tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtattgac 4320

gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac 4380

tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct 4440

gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg 4500

aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg 4560

gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca 4620

atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa 4680

caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt 4740

ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc 4800

attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg 4860

agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt 4920

aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaaaactt 4980

catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc 5040

ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct 5100

tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta 5160

ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc 5220

ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac 5280

ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct 5340

gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat 5400

aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg 5460

acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa 5520

gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg 5580

gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga 5640

cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc 5700

aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct 5760

gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct 5820

cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga aga 5873

<210>8

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gctgttggaa cgatggcaaa gcatgcgaac ccgaaaatgg 40

<210>9

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

aaggagaccc cgtcactcat gctagcagct ggatttcact 40

<210>10

<211>1776

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gctgttggaa cgatggcaaa gcatgcgaac ccgaaaatgg agcaatcttc cccggggcct 60

ccaaatacca actcacccga gagagataaa gagacaccac ccaccacgag acggagtata 120

tccaccaagg taagtaactc agagttaatg atacaggtgt acacagctcc ttccctagcc 180

attgagtggg tatcacatga cactggtagg ttacaaccac gtttagtagt tattttgtgc 240

aattccatgg ggatcaggaa gtttggtttg gtgggtgcgt ctactgattc ccctttgtct 300

ctgaaaatct tttccctagt ggaacacttt ggctgaatga tataaattca ccttgattcc 360

caccctccct tctttctctc tctctctgtt acacccaatt gaattttctt ttttttttta 420

ctttccctcc ttctttatca tcaaagataa gtaagtttat caattgccta ttcagaatga 480

aaaagcctga actcaccgcg acgtctgtcg agaagtttct catcgaaaag ttcgacagcg 540

tctccgacct catgcagctc tcggagggcg aagaatctcg tgctttcagc ttcgatgtag 600

gagggcgtgg atatgtcctc cgggtaaata gctgcgccga tggtttctac aaagatcgtt 660

atgtttatcg gcactttgca tcggccgcgc tcccgattcc ggaagtgctt gacattgggg 720

aattcagcga gagcctcacc tattgcatct cccgccgtgc acagggtgtc acgttgcaag 780

acctccctga aaccgaactc cccgctgttc tccagccggt cgcggaggcc atggatgcga 840

tcgctgcggc cgatcttagc cagacgagcg ggttcggccc attcggaccg caaggaatcg 900

gtcaatacac tacatggcgt gatttcatat gcgcgattgc tgatccccat gtgtatcact 960

ggcaaactgt gatggacgac accgtcagtg cgtccgtcgc gcaggctctc gatgagctca 1020

tgctttgggc cgaggactgc cccgaagtcc ggcacctcgt gcacgcggat ttcggctcca 1080

acaatgtcct cacggacaat ggccgcataa cagcggtcat tgactggagc gaggcgatgt 1140

tcggggattc ccaatacgag gtcgccaaca tcttcttctg gaggccgtgg ttggcttgta 1200

tggagcagca gacgcgctac ttcgagcgga ggcatccgga gcttgcagga tcgccgcggc 1260

tccgggcgta tatgctccgc attggtcttg accaactcta tcagagcttg gttgacggca 1320

atttcgatga tgcagcttgg gcgcagggtc gatgcgacgc aatcgtccga tccggagccg 1380

ggactgtcgg gcgtacacaa atcgcccgca gaagcgcggc cgtctggacc gatggctgtg 1440

tagaagtact cgccgatagt ggaaaccgac gccccagcac tcgtccgagg gcaaaggaat 1500

agtgtgctac ccacgcttac tccaccagag ctattaacat cagaaatatt tattctaata 1560

aataggatgc aaaaaaaaaa ccccccttaa taaaaaaaaa agaaacgatt ttttatctaa 1620

tgaagtctat gtatctaaca aatgtatgta tcaatgttta ttccgttaaa caaaaatcag 1680

tctgtaaaaa aggttctaaa taaatattct gtctagtgta cacattctcc caaaatagtg 1740

aaatccagct gctagcatga gtgacggggt ctcctt 1776

<210>11

<211>2274

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gagcgaccaa agcgattcag gttggtcatt tacgactgct tgctctggct cttgtcagtg 60

atatttgatt gttttttcag agagatcaga ccgagagggg cgtttaagat ccccagagag 120

ggtccggtga tctttgttgc cgccccccat cataatcagt ttgttgatcc catcgtgttg 180

atgaaccagg tgaaaagaga agcaaaccga agaatatcat tcttgattgc ggccaagtca 240

tatcaattga aagctgttgg aacgatggca agcatgcgaa cccgaaaatg gagcaatctt 300

ccccggggcc tccaaatacc aactcacccg agagagataa agagacacca cccaccacga 360

gacggagtat atccaccaag gtaagtaact cagagttaat gatacaggtg tacacagctc 420

cttccctagc cattgagtgg gtatcacatg acactggtag gttacaacca cgtttagtag 480

ttattttgtg caattccatg gggatcagga agtttggttt ggtgggtgcg tctactgatt 540

cccctttgtc tctgaaaatc ttttccctag tggaacactt tggctgaatg atataaattc 600

accttgattc ccaccctccc ttctttctct ctctctctgt tacacccaat tgaattttct 660

tttttttttt actttccctc cttctttatc atcaaagata agtaagttta tcaattgcct 720

attcagaatg aaaaagcctg aactcaccgc gacgtctgtc gagaagtttc tcatcgaaaa 780

gttcgacagc gtctccgacc tcatgcagct ctcggagggc gaagaatctc gtgctttcag 840

cttcgatgta ggagggcgtg gatatgtcct ccgggtaaat agctgcgccg atggtttcta 900

caaagatcgt tatgtttatc ggcactttgc atcggccgcg ctcccgattc cggaagtgct 960

tgacattggg gaattcagcg agagcctcac ctattgcatc tcccgccgtg cacagggtgt 1020

cacgttgcaa gacctccctg aaaccgaact ccccgctgtt ctccagccgg tcgcggaggc 1080

catggatgcg atcgctgcgg ccgatcttag ccagacgagc gggttcggcc cattcggacc 1140

gcaaggaatc ggtcaataca ctacatggcg tgatttcata tgcgcgattg ctgatcccca 1200

tgtgtatcac tggcaaactg tgatggacga caccgtcagt gcgtccgtcg cgcaggctct 1260

cgatgagctc atgctttggg ccgaggactg ccccgaagtc cggcacctcg tgcacgcgga 1320

tttcggctcc aacaatgtcc tcacggacaa tggccgcata acagcggtca ttgactggag 1380

cgaggcgatg ttcggggatt cccaatacga ggtcgccaac atcttcttct ggaggccgtg 1440

gttggcttgt atggagcagc agacgcgcta cttcgagcgg aggcatccgg agcttgcagg 1500

atcgccgcgg ctccgggcgt atatgctccg cattggtctt gaccaactct atcagagctt 1560

ggttgacggc aatttcgatg atgcagcttg ggcgcagggt cgatgcgacg caatcgtccg 1620

atccggagcc gggactgtcg ggcgtacaca aatcgcccgc agaagcgcgg ccgtctggac 1680

cgatggctgt gtagaagtac tcgccgatag tggaaaccga cgccccagca ctcgtccgag 1740

ggcaaaggaa tagtgtgcta cccacgctta ctccaccaga gctattaaca tcagaaatat 1800

ttattctaat aaataggatg caaaaaaaaa acccccctta ataaaaaaaa aagaaacgat 1860

tttttatcta atgaagtcta tgtatctaac aaatgtatgt atcaatgttt attccgttaa 1920

acaaaaatca gtctgtaaaa aaggttctaa ataaatattc tgtctagtgt acacattctc 1980

ccaaaatagt gaaatccagc tgctagcatg agtgacgggg tctccttatt aaactcagat 2040

aattctttga caaatctccc aatgttttcg gattacgtgt tgcacaagaa cgcaaagaac 2100

ccggacttgg agcttgatcc ccaatctttg gcggcatcga gagtcaattc gatggtcaac 2160

atacctcatg cttctcatgg cgttaatacg ccatcaccgt caacttcaag acgcccacca 2220

ttgaccgaaa ccgcctcgtc ggagcatatg gaattgaact ttgggtctgg agcc 2274

<210>12

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

aagatcccca gagagggtcc 20

<210>13

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

atgcacccat catcagccaa 20

<210>14

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gtgtgctacc cacgcttact 20

<210>15

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

actgactgtc cattctgttc tctc 24

<210>16

<211>2217

<212>DNA

<213> Candida tropicalis (Candida tropicalis)

<400>16

cttaagtacg agcgaccaaa gcgattcagg ttggtcattt acgactgctt gctctggctc 60

ttgtcagtga tatttgattg ttttttcaga gagatcagac cgagaggggc gtttaagatc 120

cccagagagg gtccggtgat ctttgttgcc gccccccatc ataatcagtt tgttgatccc 180

atcgtgttga tgaaccaggt gaaaagagaa gcaaaccgaa gaatatcatt cttgattgcg 240

gccaagtcat atcaattgaa agctgttgga acgatggcaa aatgtcagtt gtcaattcct 300

gttatccgcc cacaagactg tttgaccaaa ggtagtggta agatatttgt ggactttgac 360

aaagatccgt taaaagttat cggcaagaat accaaattca cgaccgaatg tatggtcaag 420

ggcttaattg cattgccaca atctttgggt gcctctgagg tggctgaaat cgtctcggat 480

accgagttgc ttatccgtaa agagttcaaa cccctggaga aagttaagga attgttgagc 540

caaggaacct ccttcaagcg tgctgataag gtcgaccaaa agcaagtcta tcaaatggtc 600

tttgaccact tggctgatga tgggtgcatt gggatctttc ccgaaggcgg gtctcacgat 660

cggccagact tattgccctt gaaagcaggc gttgctgtga tggctcttgg cgccatggac 720

aaaaatccaa attgcaatat caagattgtt ccatgtggta tgaactattt cagtgctcac 780

aagtttagaa gcagagccgt tgttgagttt ggcgatccaa ttgaaattcc aaaggagcta 840

gtgaagaaat acgcgaaccc ggagaccaac cgtgaagcgg ttaaggattt actagacacc 900

atcactactg gtttgaaagc agttaccgtt acctgcgagg actacgagac gttaatgtta 960

atacaggcgg caagacgttt gtatgctggt aacttcgcac agcaattgcc cttgccgttg 1020

attgtggaaa tgaacaggag attggtcatc ggctacgaac acttcaaaaa cgtgccaaaa 1080

gtgcaagagc tcaaggaaaa agtgttggcg tataatgagt ttctcaaaac tttgcattta 1140

ccagatcacc acgtcgagag ttgcaacgac aagacacaca agatagcttt gattccaaca 1200

tttttcataa gactttttga ggttatcttt ttgtttattt tggctttgcc aggagctgtg 1260

ttgttttcgc ccgtctttat ttcaagcaaa ttgatatccc gcaggaaggc aaaggaagcg 1320

ttagcgaact ccgtagtcaa gatccaagca aacgatgtga tcgcgacgtg gaaaatatta 1380

gttgctatgg gtatcgcgcc ggtcgtttat tctttctatg caagtattgg aacgtattac 1440

tgttctgcac ataaatattt cctgcattgg cgattgtttt gggtttgggt gtttttgtac 1500

atctgtgggg tcttggttac ttattcggca ttggtgactg gggaacaagg catggacttg 1560

ttgaaatcga ttcggccgtt gtacttgtcc atcacttcag ggtcgtcgat taaggagttg 1620

aagcgaatgc gagcggagct tagtgaagaa attaccgact tggtcaacac atatggccca 1680

cagttgtatc caaaagactt taatttgtta gagttgcaaa aatcgttgaa catcaatggc 1740

gatgttaatt atgttgacag tgacgaggaa gaagaattga aaaccgagga gttgcgtcaa 1800

agacgtttgg caaggcgcag ggcagagaag aaggccaccg atgcagatga cgaatctgaa 1860

ttgaaacatt catcttctat gagtgacggg gtctccttat taaactcaga taattctttg 1920

acaaatctcc caatgttttc ggattacgtg ttgcacaaga acgcaaagaa cccggacttg 1980

gagcttgatc cccaatcttt ggcggcatcg agagtcaatt cgatggtcaa catacctcat 2040

gcttctcatg gcgttaatac gccatcaccg tcaacttcaa gacgcccacc attgaccgaa 2100

accgcctcgt cggagcatat ggaattgaac tttgggtctg gagccaggac aaggaaatcg 2160

aatttgaggg acaaaatcaa actgaaactc agagagaaca gaatggacag tcagtct 2217

Claims (10)

1. A method for reducing the content of acylglyceride impurities in long-chain dibasic acid is characterized in that the concentration of a fermentation substrate in fermentation broth is controlled to be 0.1-17% when the long-chain dibasic acid is produced by fermentation.

2. The method of claim 1, wherein the fermentation substrate for the fermentative production of the long-chain dibasic acid comprises a long-chain alkane, a fatty acid derivative, or a mixture thereof;

preferably, the fermentation substrate is n-alkane with carbon chain length of C9-C22.

3. The method of any one of claims 1-2, wherein the acyl glycerides comprise di-and triacylglycerides;

preferably, the diacylglyceride is C₃₉H₇₂O₅The triacylglycerol isC₅₇H₁₀₄O₆。

4. The method according to any one of claims 1 to 3, wherein the long-chain dicarboxylic acid-producing engineered bacteria used in the fermentation are selected from the group consisting of species of Corynebacterium (Corynebacterium), Geotrichum (Geotrichum), Candida (Candida), Pichia (Pichia), Rhodotorula (Rhodotorula), Saccharomyces (Saccharomyces), Yarrowia (Yarrowia); preferably a Candida species; more preferably Candida tropicalis (Candida tropicalis) or Candida sake (Candida sake).

5. The method as claimed in any one of claims 1 to 4, wherein the engineering bacteria for producing the long-chain dicarboxylic acid used in the fermentation is obtained by knocking out a copy of SCT1 gene or its homologous gene in the genome of the engineering bacteria for producing the long-chain dicarboxylic acid by genetic engineering means.

6. The method according to any one of claims 1 to 5, wherein the long-chain dicarboxylic acid-producing engineered bacteria used in the fermentation are obtained by knocking out a copy of SCT1 gene or its homologous gene in the genome of Candida tropicalis (Candida tropicalis) or Candida sake (Candida sake) which is an engineered bacteria producing long-chain dicarboxylic acid by homologous recombination.

7. The method according to any one of claims 1 to 6, wherein the long-chain dibasic acid is at least one selected from the group consisting of long-chain dibasic acids having a carbon chain length of from C9 to C22;

preferably, the long-chain dibasic acid comprises one or more of dodecanedioic acid, undecanedioic acid, dodecanedioic acid, tridecanedioic acid, tetradecanedioic acid, pentadecanedioic acid, hexadecanedioic acid, heptadecanedioic acid or octadecanedioic acid.

8. The method according to any one of claims 1 to 7, wherein the total content of diacylglycerides and triacylglycerides in the obtained long-chain dibasic acid is 0.3ppm or less.

9. The method according to any one of claims 1 to 8, wherein when the diacylglyceride is C₃₉H₇₂O₅The triacylglycerol is C₅₇H₁₀₄O₆When C is in contact with₃₉H₇₂O₅And C₅₇H₁₀₄O₆The total content of (B) is 0.3ppm or less.

10. A long-chain dibasic acid prepared by a biological method, which is characterized in that the total content of diacylglyceride and triacylglycerol in the long-chain dibasic acid is below 0.3 ppm.

Images