CN111304355A

CN111304355A - InDel molecular marker closely linked with rice heading stage gene and application

Info

Publication number: CN111304355A
Application number: CN202010280591.8A
Authority: CN
Inventors: 宣宁; 柳絮; 张华�; 姚方印; 赵倩倩
Original assignee: Biotechnology Research Center of Shandong Academy of Agricultural Sciences
Current assignee: Biotechnology Research Center of Shandong Academy of Agricultural Sciences
Priority date: 2020-04-10
Filing date: 2020-04-10
Publication date: 2020-06-19
Anticipated expiration: 2040-04-10
Also published as: NL2026532B1; NL2026532A; CN111304355B

Abstract

The invention discloses an InDel molecular marker closely linked with a rice heading stage gene and application thereof, wherein an upstream primer sequence of the molecular marker IN2 is SEQ ID NO.2, and a downstream primer sequence is SEQ ID NO. 3; the application of an InDel molecular marker IN2 IN genetic analysis and gene fine positioning of rice heading stage; the upstream primer sequence of the molecular marker IN10 is SEQ ID NO.6, and the downstream primer sequence is SEQ ID NO. 7; the application of the InDel molecular marker IN10 IN genetic analysis and gene fine positioning of rice heading stage.

Description

InDel molecular marker closely linked with rice heading stage gene and application

Technical Field

The invention relates to an InDel molecular marker closely linked with a rice heading stage gene and application thereof, in particular to an InDel (insertion-deletion polymorphism) molecular marker and application thereof in genetic analysis and fine positioning of the rice heading stage gene, belonging to the technical field of DNA molecular markers and molecular biology.

Background

Insertion-deletion polymorphism (InDel) molecular markers are molecular markers developed based on the insertion or deletion of nucleotide fragments occurring in homologous sequences in genomes of different individuals, i.e., a certain number of nucleotide insertions or deletions are present in the genome of one genotype relative to the genome of another genotype. The InDel marker has the characteristics of Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphism (SNPs) variation, and is a co-dominant marker. As an important component of Structural Variations (SVs), the structural variations exist widely in the genome, the distribution density of the structural variations is only one SNPs per 268bp, and on average, one InDel site per 953bp is higher than that of SSRs. Compared with SNP markers, the InDel marker is simpler to design and detect. Meanwhile, the InDel marker is used as a novel co-dominant molecular marker, has the advantages of various genetic markers, and has the advantages of wide distribution in a genome, high density, high accuracy, stable variation, unique site, easiness in detection and the like. At present, InDel markers are applied to multiple aspects of high-density molecular marker genetic map construction and gene positioning of important crops (including rice), genetic diversity analysis, hybrid progeny identification and the like.

The rice is an important grain crop in China, and the hybrid rice makes great contribution to the grain safety of China and even the world with obvious yield advantage. The popularization and the application of the new rice variety play an important role in guaranteeing the grain supply and meeting the diversified demands of people. Rice has become a model plant of gramineae and monocotyledon because of its advantages of small genome, perfect genetic transformation system, and better commonality with other gramineae plants. At present, a large number of InDel markers have been developed according to the sequencing result of rice genomes, but the development of the rice InDel markers is not saturated yet.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides an InDel molecular marker closely linked with a rice heading stage gene and application thereof.

In view of the important role of rice in grain safety and agricultural sustainable development, the development of a new specific rice InDel marker is of great significance for constructing high-density genetic maps and fingerprint maps of varieties.

The chromosome fragment introduction line CSSL41 is a BC4F4 population which is obtained by hybridizing the parent 9311 and the Saint Rice 16, backcrossing the F1 generation with the recurrent parent Saint Rice 16 for 4 generations and then selfing the 4 generations. The heading date of CSSL41 is about 83 days, while that of Shengdao 16 is about 112 days. CSSL41 is hybridized with Saint rice 16, and F1 generation selfing is carried out to obtain F2 secondary segregation population (F2 population for short). According to statistics of field heading stage survey results, the heading stage distribution of 2164 effective individuals of the F2 population shows a remarkable bimodal trend. The heading stage of 113 days is taken as a boundary, and the population is divided into an early heading population and a late heading population, wherein the number of the early heading population is 1634, and the number of the late heading population is 530. Chi shape²＝0.15<P_0.05The segregation ratio of the early heading to the late heading of the population is 3.84, which basically accords with 3:1, and shows that segregation at the heading stage is controlled by a pair of alleles, the early heading is dominant and the late heading is recessive.

The parent CSSL41 and the Saint rice 16 are amplified by using about 600 SSR markers randomly on a rice chromosome set, a polyacrylamide gel selects markers with polymorphism between the two parents, and the markers are used for amplifying plants with extremely early heading and extremely late heading, and the sixth chromosome replacement segment RM527-RM541-PSM136 of a chromosome segment introduction line CSSL41 is preliminarily determined to be related to the heading stage.

The technical scheme of the invention is as follows:

the nucleotide sequence of the InDel molecular marker IN2 closely linked with the rice heading stage gene is SEQ ID NO. 1;

SEQ ID NO.1：ACAAAATGCAG。

preferably, the molecular marker IN2 is located on the sixth chromosome of rice and is the nucleotide sequence of the insert.

Preferably, the molecular marker IN2 is an insertion mutation IN the genomic sequence of Nipponbare of the rice variety at position 10008107-10008117 on the sixth chromosome of Nipponbare of the rice variety.

The upstream primer sequence of the molecular marker IN2 is SEQ ID NO.2, and the downstream primer sequence is SEQ ID NO. 3;

SEQ ID NO.2：CAACAAGGGAAGAACAACAGA；

SEQ ID NO.3：TGGATGCTACCGCCAAGAAG。

according to the invention, the amplification region of the molecular marker IN2 primer pair is preferably located at position 10008072-10008239 on the sixth chromosome of Nipponbare of the rice variety, the sequence of which is SEQ ID NO.4

SEQ ID NO.4：CAACAAGGGAAGAACAACAGAGAGCCGAATAAACAACAAAATGCAGGCGTTAAGTTCAAGAGAAAGACTTAAGCAGAGAAAGCAACTGGATTTGGAAGACAAATTTATTTATTTAAGAGCTTCCTAATGTTAGATCTGTCCATATTAACTTCTTGGCGGTAGCATCCA。

The molecular marker IN2 is applied to genetic analysis and gene fine positioning of rice heading stage genes.

The primer pair of the molecular marker IN2 is applied to genetic analysis and gene fine positioning of rice heading stage genes.

The nucleotide sequence of the InDel molecular marker IN10 closely linked with the rice heading stage gene is SEQ ID NO. 5;

SEQ ID NO.5：GGCTGATT。

preferably, the molecular marker IN10 is located on the sixth chromosome of rice and is the nucleotide sequence of the insert.

Preferably, the molecular marker IN10 is located between the positions 10027614 and 10027621 of the sixth chromosome of Nipponbare, an insertion mutation IN the genomic sequence of Nipponbare.

The upstream primer sequence of the molecular marker IN10 is SEQ ID NO.6, and the downstream primer sequence is SEQ ID NO. 7;

SEQ ID NO.6：TTCTGTGGGTGTTGGGGGT；

SEQ ID NO.7：TGCTGCGTTTGCATTGCTC。

preferably, the amplification region of the primer pair for the molecular marker IN10 is located at position 10027555-10027676 of the sixth chromosome of Nipponbare of the rice variety, the sequence of which is SEQ ID NO.8

SEQ ID NO.8：TTCTGTGGGTGTTGGGGGTGGAAATCCTGGGGGCTTCGCCGACAAGGACACGCCTGATTGGCTGATTTAGGAAACATCGCCGTCACCTGGCAGGCTGGCACCGGAGCAATGCAAACGCAGCA。

The molecular marker IN10 is applied to genetic analysis and gene fine positioning of rice heading stage genes.

The primer pair of the molecular marker IN10 is applied to genetic analysis and gene fine positioning of rice heading stage genes.

The molecular marker IN2 and the molecular marker IN10 are applied to genetic analysis and gene fine positioning of rice heading stage genes together.

The molecular marker IN2 primer pair and the molecular marker IN10 primer pair are applied to genetic analysis and gene fine positioning of rice heading stage genes together.

The technical scheme of the invention has the beneficial effects

1. The invention provides InDel molecular markers IN2 and IN10 which are closely linked with a rice heading date QTL for the first time, and provides a primer pair for amplifying the InDel molecular marker IN 2; and a primer pair for amplifying the InDel molecular marker IN 10; and experiments prove that the rice heading stage gene Hd6(t) is positioned between InDel molecular markers IN2 and IN10 of the sixth chromosome, and the physical distance is 19.3 kb.

2. The primer pairs of InDel molecular markers IN2 and IN10, which are related by the invention, amplify the genome DNA of a rice parent rice chromosome fragment substitution line CSSL41 (hereinafter referred to as CSSL41) and Sandalo 16 and the parent exchange strain, and detect by 6% polyacrylamide gel electrophoresis, the amplified product has obvious banding patterns and has good polymorphism among varieties, the InDel molecular markers IN2 and IN10, which are related by the invention, and the corresponding primer pairs can carry out genetic analysis and fine positioning on the rice heading stage genes, and can be used for constructing high-density genetic maps and variety fingerprints of rice.

Drawings

FIG. 1 is a photograph showing the results of screening the parent polymorphism of SSR markers for rice and polyacrylamide gel electrophoresis detection

In the figure: a is CSSL41, b is Shengdao 16, 1 is PSM136 parent polymorphism screening polyacrylamide gel electrophoresis detection result, 2 is RM541 parent polymorphism screening polyacrylamide gel electrophoresis detection result, and 3 is RM3330 parent polymorphism screening polyacrylamide gel electrophoresis detection result.

FIG. 2 shows the rice SSR markers PSM388, RM527 amplified parents and F₂A photo of the result of polyacrylamide gel electrophoresis detection of late heading individuals in the population;

in the figure:

a is the amplification of CSSL41, St.oryzae 16 and F using primer pair of PSM388₂The genotype detection result of late heading individuals in the population is F in 1-20₂Population individuals, P1 is CSSL41, P2 is Saint rice 16;

b is the amplification of CSSL41, St.oryzae 16 and F with primer pair RM527₂The genotype detection result of late heading individuals in the population is F in 1-20₂Population individuals, P1 is CSSL41 and P2 is Saint rice 16.

FIG. 3 shows the amplified parents and F of rice SSR markers Ha30 and Ha36₂A photo of the result of polyacrylamide gel electrophoresis detection of the population cross;

in the figure: c is the amplification of CSSL41, Saint Rice 16 and F using the primer pair of Ha30₂As a result of genotyping of the population crossovers, A1-A24 was F₂The cross-over detected by the border primers of PSM388 and RM527 in the population, P1 is CSSL41, and P2 is Saint rice 16;

d is the amplification of CSSL41, Saint Rice 16 and F using the primer pair of Ha36₂As a result of genotyping of the population crossovers, A1-A24 was F₂The cross-over detected by the border primers of PSM388 and RM527 in the population, P1 is CSSL41, and P2 is Saint rice 16;

FIG. 4 shows rice InDel molecular markers IN2 and IN10 amplified parents and F₂A photo of the result of polyacrylamide gel electrophoresis detection of the population cross;

e is the amplification of CSSL41, St.oryzae 16 and F with primer pairs of IN2₂As a result of genotyping of the population crossovers, A1-A24 was F₂The cross-over detected by the border primers of PSM388 and RM527 in the population, P1 is CSSL41, and P2 is Saint rice 16;

f is a primer set for amplifying CSSL41, Saint Rice 16 and F using IN10₂As a result of genotyping of the population crossovers, A1-A24 was F₂The cross-over detected by the border primers of PSM388 and RM527 in the population, P1 is CSSL41, and P2 is Saint rice 16;

FIG. 5 is a molecular linkage diagram of the heading stage gene on the sixth chromosome of rice.

Detailed Description

The technical solution of the present invention is further described with reference to the following examples, but the scope of the present invention is not limited thereto.

Source of biological material

The rice chromosome fragment substitution line CSSL41 is constructed by a laboratory, and the construction method comprises the steps of hybridizing a parent 9311 and the Saint rice 16, backcrossing the F1 generation with the recurrent parent Saint rice 16 for 4 generations, and then selfing the BC4F4 population of the 4 generations. The heading stage survey results show that the heading stage of CSSL41 is 27-34 days shorter than that of Sheng rice 16.

The Sheng rice 16 is constructed by the rice institute of agriculture academy of Shandong province (Chenfeng, etc., breeding and cultivation technology of Sheng rice 16, a new variety of rice, Shandong agricultural science, 2009, 10: 107-.

The enzyme, the molecular reagent, the kit and the like related to the technical scheme of the invention are all common products sold in the market.

The primers mentioned in the examples were synthesized by Biotechnology engineering (Shanghai) GmbH.

Microsyringe: common commercial products, available from Shanghai medical laser Instrument factories.

Example 1

Design of InDel molecular marker detection primer closely linked with rice heading period QTL

1.1 primer design method:

in the chromosome segment needing to develop InDel marker, the design of molecular marker is carried out based on the sequencing result of japonica rice (Nipponbare) and indica rice (9311) genome. The sequences of The Nipponbare PAC/BAC clones in this area were downloaded from The TIGR website (The Institute of Genome Research) (http:// www.tigr.org/tdb/rice). The desired PAC/BAC clones were selected and each clone was divided into small, 2kb contiguous fragments. Then, these 2kb sequences are used to carry out sequence alignment with indica rice variety 9311, and the sequences with 7-12bp insertion/deletion base numbers are selected as candidate sequences. Based on a Japanese sunny genome sequence, primers are designed in the lengths of 200bp on both sides of the screened InDel locus. Primer designPrimer3 plus: (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) And follows the following rules: the primer length is 18-25bp, the product length is between 150 and 350bp, the GC content is about 50 percent, the annealing temperature is about 55 ℃, and mismatch, dimer and hairpin structures do not exist.

A direct physical positioning method is adopted to construct a physical map of a molecular marker according to a pseudo chromosome model (Pseudomolecules) of Nipponbare published by IRGSP, namely the molecular marker with polymorphism between two parents is directly marked, and the specific method is as follows:

and carrying out BLAST search on the amplification primer sequence of each molecular marker on the genome sequence of Nipponbare to obtain the specific position of each molecular marker on the chromosome.

Based on the results of the molecular marker analysis, individuals with the parental bands of CSSL41 and san rice 16 were scored as 1 and 3, respectively, and individuals with the parental bands (heterozygous bands) were scored as 2. And (3) performing linkage analysis on the heading stage phenotype data of the positioned population and the segregation data of the banding markers by using MAPMAKER/EXP.version3.0 software according to the banding pattern analysis result, converting the recombination rate into genetic distance (cM) by using a Kosambi function, and constructing a physical linkage map of the target gene.

Similarly, the physical location of the clone in which the new primer is located is determined, integrated into the genetic map, and the physical location between the two markers is calculated.

2.2 application of SSR molecular marker and InDel molecular marker primer of rice in accurate positioning of rice heading stage gene Hd6(t)

Polymorphic screening is carried out by published SSR primers, and a gene for controlling the heading stage of rice is positioned in a region between two markers of a rice 6 th chromosome RM527 and a PSM388 (see a figure 2), and the specific steps are as follows:

according to published SSR primers shown in Table 1, polymorphic screening was performed between the replacement line CSSL41 and the

Saint Rice

16, and 5 SSR primers RM527, PSM388, RM541, PSM136 and RM3330 were found to have polymorphisms between the two parents (see FIG. 1 and FIG. 2).

Based on the results of the molecular marker analysis, analysis of molecular data was performed using MAPMAKER (EXP3.0b) software, and the genetic distance between markers was calculated. The heading stage gene Hd6(t) is located on chromosome 6, the genetic distance between the microsatellite markers RM527 and Hd6(t) on one side of the heading stage QTL is 1.0cM, and the genetic distances between the microsatellite markers PSM388, RM541, PSM136 and Hd6(t) on the other side are 5.2cM, 11.2cM and 16.5cM respectively, as shown in FIG. 5.

TABLE 1 SSR markers on single fragment replacement lines

F represents a forward primer, R represents a reverse primer

All recessive trait (late panicle) individuals of the F2 secondary segregating population were screened using RM527 and PSM388 as boundary markers to obtain 24 crossovers, which were named A1-A24.

In order to further locate the target gene, a microsatellite sequence is searched on a BAC sequence between RM527 and PSM388, new SSR marker primers are designed as shown in Table 2, recombinant strains are amplified, wherein Ha2, Ha15, Ha30, Ha36 and Ha1 have polymorphisms between two parents, 5 pairs of primers are used for amplifying the recombinant strains between RM527 and PSM388, the electrophoresis detection results of the amplification of the rice SSR markers Ha30 and Ha36 are shown in figure 3, the genotypes and the phenotypes of the recombinant strains are analyzed, and the heading stage gene Hd6(t) is located between Ha30 and Ha36, the physical distance is 121kb, and is shown in figure 5.

TABLE 2

F represents a forward primer, R represents a reverse primer

In order to further accurately locate the target gene, a polymorphic marker needs to be further developed between Ha30 and Ha36, and since no SSR marker with good polymorphism exists between Ha30 and Ha36, 7 pairs of InDel markers are developed in the interval between Ha30 and Ha36 markers on the basis of Japanese sunny genome sequences, and primers of the 7 pairs of InDel molecular markers are shown in Table 3. The markers with polymorphisms were selected from the developed InDel markers, and were IN1, IN2, IN10 and IN 7. By further analysis of the remaining recombinant strains between Ha30 and Ha 36. The crossover strain A9 was found to be a hybrid at the positions of the molecular markers IN1 and IN2, indicating that the target gene was at the right of the molecular markers IN1 and IN2, the crossover strains A18 and A24 were heterozygous at the molecular markers IN10 and IN7, and indicating that the target gene was at the left of the primers IN10 and IN 7. It was confirmed that the gene of interest Hd6(t) was 19.315KB between the markers IN2 and IN 10.

The InDel molecular marker IN2 is located at positions 10008107-10008117 on the sixth chromosome of Nipponbare of a rice variety, and the nucleotide sequence of the insert is SEQ ID NO. 1: ACAAAATGCAG are provided.

The molecular marker IN10 is located at the position 10027614-10027621 on the sixth chromosome of Nipponbare of the rice variety, and the nucleotide sequence of the insert is SEQ ID NO. 5: GGCTGATT.

The nucleotide sequence of the upstream primer of the InDel molecular marker IN2 is SEQ ID NO.2 (namely IN2F), and the nucleotide sequence of the downstream primer is SEQ ID NO.3 (namely IN 2R); the nucleotide sequence of the upstream primer of the InDel molecular marker IN10 is SEQ ID NO.6 (namely IN10F), and the nucleotide sequence of the downstream primer is SEQ ID NO.7 (namely IN10R), as shown IN Table 3.

The amplification region of the molecular marker IN2 primer pair is located at position 10008072-10008239 on the sixth chromosome of Nipponbare of rice variety, and the sequence is SEQ ID NO.4

The amplification region of the molecular marker IN10 primer pair is located at position 10027555-10027676 on the sixth chromosome of Nipponbare, a rice variety, and the sequence is SEQ ID NO.8

TABLE 3

F represents a forward primer, R represents a reverse primer

Example 2

Primer application of InDel molecular markers IN2 and IN10 IN rice gene

2.1 extraction of genomic DNA from Rice

CSSL41,

san Dioscorea rice

16, and 24 crossstocks (A1-A24) screened against all F2 recessive (late heading) populations, with RM527 and PSM388 as boundary markers.

The method for extracting the total DNA of the rice genome by adopting an improved TPS simple method comprises the following specific steps:

2.1.1, taking 1-2 young leaves on the upper part of each single plant in the tillering stage, and storing the young leaves in a refrigerator at minus 80 ℃ for later use;

2.1.2, putting 2-4 cm long rice leaves into a 1.5ml centrifugal tube when extracting DNA, putting liquid nitrogen into the centrifugal tube, grinding the rice leaves, adding 900ml of TPS extract, and carrying out water bath at 75 ℃ for 30-60 min;

centrifuging at 12000rpm for 10min at 2.1.3, sucking supernatant about 500ml, and transferring into new 1.5ml centrifuge tube;

2.1.4, adding pre-cooled isopropanol or absolute ethyl alcohol, adding the mixture to the mixture, standing overnight at 4 ℃, and centrifuging for 10min at 12000 rpm;

2.1.5, discarding the supernatant, drying the precipitate, adding 150. mu.l of sterilized water, and keeping at 4 ℃.

The TPS extract comprises the following components: 100mM Tris-HCl (pH8.0), 10mM EDTA (pH8.0), 1M KCL.

2.2PCR amplification

PCR amplification was performed in a PE9700 thermal cycler, and 20. mu.l of the reaction system consisted of:

2 XHifi PCR Mix 10. mu.l, 50-100 ng DNA template 1. mu.l, forward primer 1. mu.l, reverse primer 1. mu.l, ddH₂O7. mu.l, 20. mu.l of total reaction system.

The primers are InDel molecular markers IN2 and IN 10.

The PCR reaction program is:

pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 1min, annealing at 55 ℃ for 1min, extension at 72 ℃ for 1min, and 35 cycles; extension at 72 ℃ for 5 min.

2.3 Polyacrylamide gel electrophoresis separation and polymorphism detection

The PCR product is electrophoresed by polyacrylamide gel with the mass percent of 6 percent, and the basic operation comprises the following three steps:

preparing glue: weighing 9.6g of urea, adding 45ml of distilled water and 8ml of 10 XTBE buffer solution, stirring by using a glass rod to completely dissolve the urea, then adding 12ml of 40% acrylamide solution, stirring uniformly, adding 0.8ml of 10% ammonium persulfate and 35 mul TEMED, pouring into a glass plate sealed by agarose gel immediately after stirring uniformly, and flattening after filling to enable the glass plate to form an inclination angle of about 10 degrees with a table top. Inserting a comb, and standing for 1-2 h to solidify the glue.

The composition of the above 10 × TBE buffer was as follows:

dissolving 108g of Tris-HCl, 55g of boric acid and 7.44g of EDTA in distilled water, and fixing the volume to 1000 ml;

the above 40 wt% acrylamide solution had the following composition:

adding water into 38g of acrylamide and 2g N, N' -methylene bisacrylamide to reach a constant volume of 100 ml;

sample application: after the glue is completely solidified, carefully pulling out the comb, and keeping the spot holes as complete as possible. Fixing the glass plate on a vertical electrophoresis tank, and adding a proper amount of 1 xTBE electrophoresis buffer solution; repeatedly washing the sample application hole with electrophoresis buffer solution, and removing redundant substances without solidification; and (3) taking PCR amplification products, adding 4 mu l of sample loading buffer solution into each tube of PCR products, uniformly mixing, and then using a microsyringe to take 3-4 mu l of sample loading buffer solution to inject into a sample hole.

The sample loading buffer solution comprises the following components in percentage by weight:

0.25% bromophenol blue, 0.25% xylene cyanide, 50% glycerin, and the balance water.

Electrophoresis: adjusting the voltage to 250V, and the electrophoresis time is about 3-4 h.

After electrophoresis, the glass plate is detached from the electrophoresis tank, the gel is taken out, and the gel is distilledRinsing twice in water; transfer to 0.1 wt% AgNO₃Dyeing in the solution, and shaking gently on a shaking table for 10 min; then transferring the gel into distilled water to rinse twice; transferring into color developing solution for color development, transferring into tap water for storage after coloring, and recording tape type result or gel imaging (see FIG. 4).

The color developing liquid comprises the following components:

6g of sodium hydroxide, 0.076g of sodium tetraborate and 1.6ml of formaldehyde, and adding water to a constant volume of 400 ml.

As can be seen from the above experimental results IN FIG. 4, the amplified products of the primers of InDel molecular markers IN2 and IN10 IN the rice gene have obvious banding patterns and have good polymorphism among varieties. The primers of InDel molecular markers IN2 and IN10 designed by the invention are used for amplifying the F2 secondary segregation population, and the dominant heading stage gene is positioned between InDel molecular markers IN2 and IN10 of rice chromosome 6, and the physical distance is 19.3 kb. Gene prediction and functional analysis were performed on a 19.3kb chromosomal region between IN2 and IN10 by rice genome annotation system (ricegas), IN which 3 ORFs (open Reading frame) were found, wherein ORF1 belongs to protein kinase class Proteins (PK) and has a serine-threonine/tyrosine protein kinase catalytic domain; ORF2 contains a Phosphatidylinositol 3-/4-kinase catalytic domain (Phosphatidylinositol 3-/4-kinase, PI3Ks/PI4Ks) belonging to the Phosphatidylinositol kinase-like Proteins (PIKs); ORF3 is a short peptide of unknown function. The primers of InDel molecular markers IN2 and IN10 designed by the invention are used for genetic analysis and fine positioning of the rice heading stage genes, and can also be used for constructing a high-density genetic map and a variety fingerprint map of rice.

The use of IN2 and IN10 IN combination will make it possible to locate the QTL of interest IN the region between IN2 and IN10, which can improve the accuracy of accurate location.

SEQUENCE LISTING

<110> center for researching biotechnology of academy of agricultural sciences of Shandong province

<120> InDel molecular marker closely linked with rice heading stage gene and application

<160>8

<170>PatentIn version 3.5

<210>1

<211>11

<212>DNA

<213> Artificial sequence

<400>1

acaaaatgca g 11

<210>2

<211>21

<212>DNA

<213> Artificial sequence

<400>2

caacaaggga agaacaacag a 21

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<400>3

tggatgctac cgccaagaag 20

<210>4

<211>168

<212>DNA

<213> Artificial sequence

<400>4

caacaaggga agaacaacag agagccgaat aaacaacaaa atgcaggcgt taagttcaag 60

agaaagactt aagcagagaa agcaactgga tttggaagac aaatttattt atttaagagc 120

ttcctaatgt tagatctgtc catattaact tcttggcggt agcatcca 168

<210>5

<211>8

<212>DNA

<213> Artificial sequence

<400>5

ggctgatt 8

<210>6

<211>19

<212>DNA

<213> Artificial sequence

<400>6

ttctgtgggt gttgggggt 19

<210>7

<211>19

<212>DNA

<213> Artificial sequence

<400>7

tgctgcgttt gcattgctc 19

<210>8

<211>122

<212>DNA

<213> Artificial sequence

<400>8

ttctgtgggt gttgggggtg gaaatcctgg gggcttcgcc gacaaggaca cgcctgattg 60

gctgatttag gaaacatcgc cgtcacctgg caggctggca ccggagcaat gcaaacgcag 120

ca 122

Claims

1. The InDel molecular marker IN2 closely linked with the rice heading stage gene is characterized IN that the nucleotide sequence of the molecular marker IN2 is SEQ ID NO. 1.

2. The InDel molecular marker IN2 of claim 1, wherein the molecular marker IN2 is located on the sixth chromosome of rice and is the nucleotide sequence of an insert;

preferably, the molecular marker IN2 is located at position 10008107-10008117 on the sixth chromosome of Nipponbare, a rice variety, and is an insertion mutation on the genome sequence of Nipponbare.

3. The pair of amplification primers for the InDel molecular marker IN2 of claim 1, wherein the upstream primer sequence of the amplification molecular marker IN2 is SEQ ID No.2, and the downstream primer sequence is SEQ ID No. 3;

preferably, the amplified region of the molecular marker IN2 primer pair is located at positions 10008072-10008239 on the sixth chromosome of Nipponbare of the rice variety, and has the sequence of SEQ ID NO. 4.

4. The use of the InDel molecular marker IN2 IN rice heading stage genetic analysis and gene fine mapping according to claim 1.

5. The application of the amplification primer pair of the InDel molecular marker IN2 IN rice heading stage genetic analysis and gene fine positioning is disclosed IN claim 3.

6. The InDel molecular marker IN10 closely linked with the rice heading stage gene is characterized IN that the nucleotide sequence of the molecular marker IN10 is SEQ ID NO. 5.

7. The InDel molecular marker IN10 of claim 6, wherein the molecular marker IN10 is located on the sixth chromosome of rice and is the nucleotide sequence of the insert;

preferably, the molecular marker IN10 is located between the positions 10027614-10027621 of the sixth chromosome of Nipponbare, a rice variety, and is an insertion mutation on the genome sequence of Nipponbare.

8. The pair of amplification primers for the InDel molecular marker IN10 of claim 6, wherein the upstream primer sequence of the amplification molecular marker IN10 is SEQ ID No.6, and the downstream primer sequence is SEQ ID No. 7;

preferably, the amplified region of the primer pair of the molecular marker IN10 is located at the position 10027555-10027676 on the sixth chromosome of Nipponbare, a rice variety, and the sequence is SEQ ID NO. 8.

9. The use of the InDel molecular marker IN10 IN rice heading stage genetic analysis and gene fine positioning according to claim 6;

preferably, the application of the amplification primer pair of the InDel molecular marker IN10 IN rice heading stage genetic analysis and gene fine positioning is disclosed IN claim 8.

10. The use of the InDel molecular marker IN2 of claim 1 and the InDel molecular marker IN10 of claim 6 together IN genetic analysis and gene fine localization at heading stage of rice;

preferably, the application of the amplification primer pair of the InDel molecular marker IN2 of claim 3 and the amplification primer pair of the InDel molecular marker IN10 of claim 8 IN genetic analysis and gene fine positioning of rice heading stage.