CN117126962B - Cotton leaf wrinkling control gene GhZY, linkage SNP locus and application thereof - Google Patents
Cotton leaf wrinkling control gene GhZY, linkage SNP locus and application thereof Download PDFInfo
- Publication number
- CN117126962B CN117126962B CN202311394468.9A CN202311394468A CN117126962B CN 117126962 B CN117126962 B CN 117126962B CN 202311394468 A CN202311394468 A CN 202311394468A CN 117126962 B CN117126962 B CN 117126962B
- Authority
- CN
- China
- Prior art keywords
- cotton
- leaf
- snp locus
- wrinkled
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 229920000742 Cotton Polymers 0.000 title claims abstract description 146
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 91
- 238000009395 breeding Methods 0.000 claims abstract description 16
- 230000001488 breeding effect Effects 0.000 claims abstract description 16
- 210000000349 chromosome Anatomy 0.000 claims abstract description 12
- 239000000463 material Substances 0.000 claims description 83
- 239000002773 nucleotide Substances 0.000 claims description 23
- 125000003729 nucleotide group Chemical group 0.000 claims description 23
- 238000000034 method Methods 0.000 claims description 21
- 238000001976 enzyme digestion Methods 0.000 claims description 20
- 102000004169 proteins and genes Human genes 0.000 claims description 16
- 108020004414 DNA Proteins 0.000 claims description 14
- 238000012408 PCR amplification Methods 0.000 claims description 14
- 150000007523 nucleic acids Chemical class 0.000 claims description 11
- 241000196324 Embryophyta Species 0.000 claims description 10
- 108020004707 nucleic acids Proteins 0.000 claims description 10
- 102000039446 nucleic acids Human genes 0.000 claims description 10
- 239000000126 substance Substances 0.000 claims description 10
- 230000003321 amplification Effects 0.000 claims description 9
- 230000014509 gene expression Effects 0.000 claims description 9
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 9
- 108091008146 restriction endonucleases Proteins 0.000 claims description 9
- 239000002299 complementary DNA Substances 0.000 claims description 8
- 238000011144 upstream manufacturing Methods 0.000 claims description 8
- 238000012163 sequencing technique Methods 0.000 claims description 7
- 210000004027 cell Anatomy 0.000 claims description 6
- 230000009261 transgenic effect Effects 0.000 claims description 6
- 125000003275 alpha amino acid group Chemical group 0.000 claims description 5
- 102000053602 DNA Human genes 0.000 claims description 2
- 241000219146 Gossypium Species 0.000 claims 34
- 238000012216 screening Methods 0.000 abstract description 9
- 244000299507 Gossypium hirsutum Species 0.000 description 120
- 235000009429 Gossypium barbadense Nutrition 0.000 description 15
- 235000018322 upland cotton Nutrition 0.000 description 15
- 235000018102 proteins Nutrition 0.000 description 11
- 238000003752 polymerase chain reaction Methods 0.000 description 10
- 238000006243 chemical reaction Methods 0.000 description 9
- 230000002068 genetic effect Effects 0.000 description 8
- 239000003147 molecular marker Substances 0.000 description 8
- 238000003205 genotyping method Methods 0.000 description 7
- 238000010367 cloning Methods 0.000 description 5
- 239000012634 fragment Substances 0.000 description 5
- 238000000926 separation method Methods 0.000 description 5
- 238000012795 verification Methods 0.000 description 5
- 230000001276 controlling effect Effects 0.000 description 4
- 238000001514 detection method Methods 0.000 description 4
- 238000012257 pre-denaturation Methods 0.000 description 4
- 238000011160 research Methods 0.000 description 4
- 108091028043 Nucleic acid sequence Proteins 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 238000003776 cleavage reaction Methods 0.000 description 3
- 238000001962 electrophoresis Methods 0.000 description 3
- 230000007017 scission Effects 0.000 description 3
- 230000002194 synthesizing effect Effects 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 102000008682 Argonaute Proteins Human genes 0.000 description 2
- 108010088141 Argonaute Proteins Proteins 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 2
- 108010006785 Taq Polymerase Proteins 0.000 description 2
- 235000001014 amino acid Nutrition 0.000 description 2
- 150000001413 amino acids Chemical class 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 238000007796 conventional method Methods 0.000 description 2
- 210000000805 cytoplasm Anatomy 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 108091070501 miRNA Proteins 0.000 description 2
- 239000002679 microRNA Substances 0.000 description 2
- 230000001124 posttranscriptional effect Effects 0.000 description 2
- 230000001105 regulatory effect Effects 0.000 description 2
- 238000013519 translation Methods 0.000 description 2
- 201000002909 Aspergillosis Diseases 0.000 description 1
- 208000036641 Aspergillus infections Diseases 0.000 description 1
- 239000004215 Carbon black (E152) Substances 0.000 description 1
- 108091026890 Coding region Proteins 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108700024394 Exon Proteins 0.000 description 1
- WHUUTDBJXJRKMK-UHFFFAOYSA-N Glutamic acid Natural products OC(=O)C(N)CCC(O)=O WHUUTDBJXJRKMK-UHFFFAOYSA-N 0.000 description 1
- 108091092195 Intron Proteins 0.000 description 1
- KDXKERNSBIXSRK-UHFFFAOYSA-N Lysine Natural products NCCCCC(N)C(O)=O KDXKERNSBIXSRK-UHFFFAOYSA-N 0.000 description 1
- 239000004472 Lysine Substances 0.000 description 1
- 108700001094 Plant Genes Proteins 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 238000012268 genome sequencing Methods 0.000 description 1
- 239000004220 glutamic acid Substances 0.000 description 1
- 235000013922 glutamic acid Nutrition 0.000 description 1
- 229930195733 hydrocarbon Natural products 0.000 description 1
- 150000002430 hydrocarbons Chemical class 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000000415 inactivating effect Effects 0.000 description 1
- 230000004807 localization Effects 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 238000010839 reverse transcription Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 239000004753 textile Substances 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 210000003462 vein Anatomy 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
- 230000037303 wrinkles Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the technical field of cotton leaf variety breeding, and relates to a cotton wrinkling leaf control gene GhZY, a linkage SNP locus thereof and application thereof. The cotton wrinkled leaf control gene GhZY linkage SNP locus is positioned at 61394027 position on chromosome 12 of cotton D subgroup, and the base of the SNP locus is G or A. According to the invention, through screening and positioning the cotton wrinkled leaf trait genes, developing closely linked molecular markers thereof, and utilizing the SNP markers to perform initial screening of cotton wrinkled leaves/normal leaf varieties, the aim of molecular assisted breeding is fulfilled, the breeding period can be greatly shortened, the breeding efficiency is improved, and non-excellent resources for early wrinkled leaves removal are realized.
Description
Technical Field
The invention relates to the technical field of cotton leaf type variety breeding, in particular to a cotton leaf wrinkling control gene GhZY, a linkage SNP locus and application thereof.
Background
Cotton is one of important commercial crops, is not only a raw material of textile industry, but also an important strategic material, and plays an important role in national economic development. The release of the cotton whole genome sequence greatly promotes the research of cotton molecular biology and provides a solid foundation for molecular design assisted breeding. Further define gene functions, find key genes for controlling important traits of cotton, and are the primary content of cotton molecular biology at present.
The identification of genetic diversity of upland cotton cultivars by students at home and abroad finds that the genetic background of the main upland cotton cultivars is narrow nowadays, which brings great challenges to the cultivation of new cultivars. To a certain extent, the genetic diversity of cotton germplasm determines the difficulty and easiness of cultivating new varieties, so that the improvement of the genetic diversity of upland cotton cultivars is a primary task of cultivating new varieties of cotton. The construction of mutant libraries is an advantageous way to create new germplasm resources for cotton. Mutants are ideal materials for discovering new genes and revealing the functions of the genes. Functional genomics aims at identifying gene functions and aims at revealing the relationship between genes and traits. With the large-scale development of genome sequencing work, the acquisition of a large amount of nucleic acid sequence information, the research of gene functions by only mutants obtained by natural mutation, has far failed to meet the research demands of molecular biology.
The wrinkled leaf character of cotton is close connection among veins, so that the wrinkled leaf state is presented, leaves grow out in the wrinkled leaf area at the back, and the phenotype is similar to the cotton leaf curl character. The quality and yield of wrinkled cotton are inferior to that of normal cotton, which belongs to non-quality cotton germplasm resource. Normal She Canjian fig. 1A and crease She Canjian fig. 1B.
Cloning genes is one of the most important applications for finding molecular markers linked to a trait of interest. Map cloning (map based cloning) is to map a target trait and a molecular marker through genetic linkage by using a molecular genetic map, and locate the target gene between flanking markers which are very closely linked with the target trait and the molecular marker; the molecular marker linked to the target gene can also be obtained by a population separation analysis method (BSA method) or a near isogenic line method, and then mapped to a map by using a mapping population. These markers are then used to screen large DNA libraries, to identify clones associated with the markers, followed by subcloning and chromosome walking (Chromosome walking) to obtain cloned fragments containing the gene of interest, which are finally validated with the aid of transformation and complementation assays. At present, a large number of plant genes have been isolated by using a map-based cloning technology, but no report is found on successful cloning of genes controlling cotton leaf wrinkles.
Disclosure of Invention
Aiming at the defects of the prior art, one of the purposes of the invention is to provide a cotton leaf wrinkling control gene GhZY, a protein for controlling cotton leaf wrinkling characters, related materials and applications.
The second object of the invention is to provide a cotton leaf wrinkling control gene GhZY linkage SNP locus.
According to the SNP site, it is a third object of the present invention to provide a primer set for detecting a polymorphism or genotype of the above SNP site.
The fourth object of the present invention is to provide a substance for detecting polymorphism or genotype of SNP locus linked to cotton leaf wrinkling control gene GhZY.
The fifth object of the present invention is to provide uses of the above SNP site, primer pair and substance.
The sixth object of the present invention is to provide a method for identifying or aiding in the identification of wrinkled or normal leaves of cotton.
The cotton wrinkling leaf control gene GhZY linkage SNP locus is positioned at 61394027 nucleotide (or SNP locus is positioned at 1734 position in sequence 6 of a sequence table) on chromosome 12 of a D subgroup of a cotton reference genome, and the base of the cotton wrinkling leaf control gene GhZY linkage SNP locus is G or A. Aiming at the SNP locus, the invention provides the following technical schemes:
in a first aspect, the invention provides a primer pair for detecting polymorphism or genotype of cotton leaf wrinkling control gene GhZY linked SNP locus located at nucleotide 61394027 of chromosome 12 of subgroup D of cotton reference genome Ghir.ZJU (https:// cottonfgd.net/abatvout/download/assembly/genome.Ghir.ZJU. Fa.gz), the cotton leaf wrinkling control gene GhZY linked SNP locus having a base of G or A.
Further, the primer pair includes:
the nucleotide sequence of the upstream primer ZY-F is as follows (1) or (2):
(1) As shown in a sequence 1 (AGCCTTTGGGTGAGGGTCTA) in the sequence table,
(2) A sequence having the same function as the sequence 1 obtained by substituting, deleting or adding one or more nucleotides in the sequence 1;
the nucleotide sequence of the downstream primer TM-1-R is as follows (3) or (4):
(3) As shown in a sequence 2 (ACCTTCACACGATCAGCATCAG) in the sequence table,
(4) A sequence having the same function as sequence 2 obtained by substituting, deleting or adding one or more nucleotides in sequence 2.
The expression of (2) in the upstream primer ZY-F is that 1, 2 or 3 of the nucleotide sequences of the sequence 1 are substituted or deleted with other nucleotides, or that a novel sequence obtained by adding 1, 2 or 3 nucleotides to the sequence 1 can still be used for amplifying the SNP site.
The expression of (2) in the downstream primer TM-1-R is that 1, 2 or 3 of the nucleotide sequences of the sequence 2 are substituted or deleted with other nucleotides, or that a new sequence obtained by adding 1, 2 or 3 nucleotides to the sequence 1 can still be used for amplifying the SNP site.
In a second aspect, the present invention provides a substance for detecting a polymorphism or genotype of a cotton leaf wrinkling control gene GhZY-linked SNP site, the substance comprising:
the primer pair and XbaI restriction enzyme;
the cotton wrinkled leaf control gene GhZY linkage SNP locus is located at 61394027 nucleotide on chromosome 12 of D subgroup of cotton reference genome Ghir.ZJU, and the base of the cotton wrinkled leaf control gene GhZY linkage SNP locus is G or A.
In a third aspect, the present invention provides the use of a primer pair as defined above or a substance as defined above in one of the following aspects:
(a) Identification or assisted identification of cotton wrinkled leaves or normal leaves;
(b) The application in preparing products for identifying or assisting in identifying whether cotton is wrinkled or not;
(c) The application of removing wrinkled leaf varieties in cotton breeding.
In the application of the third aspect, the product may typically be, but is not limited to, a reagent or kit containing a primer pair or substance, and may also contain other commonly used reagents for PCR or cleavage.
In the application of the third aspect, the primer pair of the first aspect or the substance of the second aspect is used for detecting the genotype of the SNP locus linked to the cotton leaf wrinkling control gene GhZY to identify or assist in identifying cotton leaf wrinkling or normal leaves, when the genotype of the SNP locus is G, cotton is leaf wrinkling, when the genotype of the SNP locus is A: A, cotton is normal leaf, and when the genotype of the SNP locus is A: G, cotton is normal leaf.
In a fourth aspect, the present invention provides a method for identifying or aiding in the identification of wrinkled or normal leaves of cotton, comprising the steps of:
detecting the genotype of an SNP locus in a genome of the cotton to be detected, wherein the cotton is wrinkled leaves when the genotype of the SNP locus is G, the cotton is normal leaves when the genotype of the SNP locus is A, and the cotton is normal leaves when the genotype of the SNP locus is A G, wherein the SNP locus is positioned at 61394027 nucleotide on chromosome 12 of a D subgroup of a cotton reference genome Ghir ZJU.
In the method of the fourth aspect, further, the method for detecting the genotype of the SNP site in the genome of the cotton to be tested comprises the following (1) or (2):
(1) The sequencing is carried out directly, the sequence is carried out,
(2) And carrying out PCR amplification by using the cotton genome to be detected as a template and using a primer pair capable of amplifying the SNP locus to obtain an amplified product, then carrying out enzyme digestion on the amplified product by using restriction enzyme, analyzing the size of the enzyme digestion product, and determining the genotype of the SNP locus in the cotton genome to be detected according to the size of the enzyme digestion product.
Still further, the primer pair capable of amplifying a SNP site is the primer pair of the first aspect, and the restriction enzyme is XbaI restriction enzyme.
Furthermore, when the size of the enzyme digestion product is 316bp, the genotype of the SNP locus in the genome of the cotton to be detected is G, and the cotton is wrinkled leaves; when the size of the enzyme digestion product is 344bp, the genotype of the SNP locus in the genome of the cotton to be detected is A, and the cotton is a normal leaf; when the sizes of the enzyme digestion products are 344bp and 316bp, the genotype of SNP loci in the genome of cotton to be detected is A to G, and the cotton is normal leaf.
Preferably, the conditions for the PCR amplification are in the following order: pre-denaturation at 94 ℃ for 15 min; denaturation at 94℃for 30s, annealing at 57℃for 30s, extension at 72℃for 1min, and repeating 35 times; the temperature is maintained at 72 ℃ for 4min, so that the product is completely extended.
In a fifth aspect, the present invention provides a protein for controlling cotton leaf wrinkling, which has the amino acid sequence of (P1) or (P2) as follows:
(P1) is shown as a sequence 3 in a sequence table;
(P2) a sequence having 85% or more identity with the amino acid sequence of sequence 3 and having the same function as sequence 3.
The protein can be synthesized artificially or obtained by synthesizing the coding gene and then biologically expressing.
The term "identity" as used herein includes a nucleotide sequence having 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of a protein consisting of the amino acid sequence shown in the coding sequence 3 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.
The 85% or more identity may be 85%, 90% or 95% or more identity.
In a sixth aspect, the present invention provides a material related to the above protein, which is any one of the following (A1) to (A6):
(A1) Nucleic acid molecules encoding the above proteins;
(A2) An expression cassette comprising the nucleic acid molecule of (A1);
(A3) A recombinant vector comprising the nucleic acid molecule of (A1);
(A4) A transgenic plant cell line comprising the nucleic acid molecule of (A1);
(A5) A transgenic plant cell line comprising the expression cassette of (A2);
(A6) A transgenic plant cell line comprising the recombinant vector of (A3).
Further, the nucleic acid molecule is a cDNA molecule which codes the protein and is shown as a sequence 4 in a sequence table or a genome DNA molecule which is shown as a sequence 5 in the sequence table.
In a seventh aspect, the present invention provides the use of the above protein or above material for identifying or aiding in the identification of wrinkled or normal leaves of cotton, or for removing wrinkled varieties in cotton breeding.
The cotton to be detected can be cotton of any variety, in particular upland cotton mutant material ZY and hybrid seeds with other varieties, more particularly hybrid offspring of upland cotton mutant material ZY and upland cotton control material TM-1.
The normal leaves of the invention can be the leaf character of the upland cotton control material TM-1, namely the leaf surface is flat.
The invention has the beneficial effects that:
the invention takes upland cotton mutant material ZY and upland cotton control material TM-1 as parents to construct F2 separation group, and the separation ratio of wrinkled leaves and normal leaf plants is found to be in accordance with 3:1, the normal leaf and the wrinkled leaf are a pair of relative characters, are regulated by a single gene, and are recessive characters. Screening and positioning 8 candidate genes through BSA sequencing, and determining according to gene function annotation and F2 population material sequencing verificationGH_D12G2960The candidate gene is the most important member of the AGO protein family, is mainly combined with miRNA (a non-coding single-stranded RNA molecule with the length of about 22 nucleotides coded by an endogenous gene), inhibits the expression of the target gene at the post-transcriptional level by cutting the target mRNA or mediating translation in cytoplasm, is named GhZY, and the applicant designs CAPS markers according to the difference between mutant materials and wild SNP, can distinguish wrinkled leaf materials and normal materials, and lays a molecular foundation for screening different leaf type materials of cotton. According to the invention, through screening and positioning the cotton leaf wrinkling character gene, developing the closely linked molecular marker, and utilizing the SNP marker to perform initial screening of cotton leaf wrinkling varieties, the aim of molecular assisted breeding is fulfilled, the breeding period can be greatly shortened, the breeding efficiency is improved, and the non-excellent resource of removing leaf wrinkling in the early stage of cotton cultivation is realized. In addition, the localization of the gene can lay a foundation for solving the problem of the aspergillosis.
Drawings
FIG. 1 is a graph comparing normal leaves and wrinkled leaves of cotton, wherein A is the normal leaves and B is the wrinkled leaves.
FIG. 2 is a diagram of a screening and positioning process of cotton leaf wrinkling control gene GhZY, wherein: a is delta SNP-index value of chromosome 12 of upland cotton D subgroup; b: candidate gene function annotation.
FIG. 3 is an electrophoretogram of a portion of the PCR product of cotton under test after cleavage.
Detailed Description
The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below may be used as a basis for further modifications and applications by those of ordinary skill in the art and are not intended to limit the scope of the invention in any way.
The experimental methods in the following examples are conventional methods, and may be carried out according to techniques or conditions described in the literature in the field or according to the specifications of the products unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available from conventional sources unless otherwise specified.
Sources of cotton varieties used in the present invention:
upland cotton mutant material ZY: TM-1 seeds are treated by EMS with the concentration of 2% in the laboratory for 2 hours, the treated seeds are planted in the field according to a conventional method, and upland cotton mutant materials ZY with the leaf wrinkling character are screened out through observation.
Upland cotton material control material TM-1: is obtained from the application of germplasm resource library of cotton research institute of China academy of agricultural sciences.
The DNA extraction referred to in the examples below was performed using the root plant genomic DNA extraction kit.
And observing whether the cotton variety to be detected is wrinkled leaves or normal leaves by naked eyes.
Example 1 acquisition of cotton leaf wrinkling control Gene GhZY and linked SNP molecular markers
1. Screening and positioning method for cotton leaf wrinkling control gene GhZY
The invention uses upland cotton mutant materialZY and upland cotton control material TM-1 are used as parents, F2 separation groups are constructed, 153 plants are added, and the separation ratio of wrinkled leaves to normal leaves is found to be in accordance with 3:1, the normal leaf and the wrinkled leaf are a pair of relative characters, are regulated by a single gene, and are recessive characters. By BSA sequencing, the candidate region Δ (SNP-index) of chromosome 12 of subgroup D was found to be 0.6 or more, see FIG. 2A. Screening and positioning 8 candidate genes, and determining according to gene function annotation (see figure 2B) and F2 population material sequencing verificationGH_D12G2960Is a candidate gene, the most important member of the AGO protein family, and mainly binds to miRNAs (a type of non-coding single-stranded RNA molecules with the length of about 22 nucleotides encoded by endogenous genes), inhibits target gene expression at post-transcriptional level by cleaving target mRNA or mediating translation in cytoplasm, and is named asGhZY。
2. Acquisition of cotton leaf wrinkling control gene GhZY full-length DNA and linked SNP molecular markers
The extraction of cotton genome DNA adopts CTAB method, uses cotton material genome DNA of test wrinkling leaf material (ZY)/normal material (TM-1) as template, and usesGhZYThe gene full-length PCR amplification is respectively carried out on the upstream primer and the downstream primer of the gene full-length amplification to obtainGhZYGene total length of gene on wrinkled leaf material (ZY)/normal material (TM-1) cotton material is 6287bp, and the total length is wrinkled leaf material (ZY)GhZYThe nucleotide sequence of the gene is shown as sequence 5 in a sequence table, and the normal material (TM-1) is shown as the sequence 5GhZYThe nucleotide sequence of the gene was changed from A to G only at the 1734 th base in the sequence 5. Use of DNAMAN software for the preparation of wrinkled leaf Material (ZY)/Normal Material (TM-1) Cotton MaterialGhZYThe whole length of the gene was compared and analyzed to find out between the wrinkled leaf material (ZY)/normal material (TM-1) cotton materialGhZYThere is a SNP at position 1734 of the gene, the base in normal material is G, and the base in the leaf material is A, which is due to the difference in base at this point in normal/leaf material, resulting in a difference in amino acid coding and thus a difference in function. The SNP can be used as a molecular marker closely linked with a wrinkled leaf material and applied to cotton leaf type material breeding.
For PCR amplification of wrinkled leaf material (ZY)GhZYPrimer pair of geneThe method comprises the following steps:
f1: ATGGGTAGGAAGAAGAGAAG (sequence 6 in the sequence Listing)
R1: ACTATCCTGGACTTGCCGAGAA (sequence 7 in the sequence table);
the PCR reaction procedure was: pre-denaturation at 94℃for 3min;94℃for 30s,55℃for 30s and 72℃for 3min, for a total of 35 cycles.
For PCR amplification of Normal Material (TM-1)GhZYThe primer pair of the gene is as follows:
f2: TGGTGGGACTGTAAACAACTGG (sequence 8 in the sequence Listing)
R2: TTAACAGTAGAACATAACACGCTT (sequence 9 in the sequence table)
The PCR reaction procedure was: pre-denaturation at 95℃for 3min;94℃for 30s,55℃for 30s and 72℃for 3min, for a total of 35 cycles.
The reaction system (20. Mu.L) for PCR amplification reaction using the two primer sets described above contained: 25ng of template DNA, 0.5. Mu.M upstream primer, 0.5. Mu.M downstream primer, 0.2mM dNTP mix;0.5U Taq DNA polymerase, 1 XPCR Buffer (Fermentas) 2. Mu.L, ddH 2 O was made up to 20. Mu.L.
3. cDNA and protein sequence identification analysis of cotton multi-wrinkled leaf control gene GhZY
Extracting total RNA by using a leaf wrinkling material (ZY)/normal material (TM-1) cotton material, respectively selecting young leaf tissues, carrying out reverse transcription to synthesize a first strand (cDNA) of mRNA, carrying out PCR (polymerase chain reaction) amplification by using a full-length amplification upstream primer and a full-length amplification downstream primer of a GhZY gene by using the first strand of the mRNA as a template, respectively obtaining the full length of the cDNA (mRNA) sequences in the leaf wrinkling material (ZY)/normal material (TM-1) cotton material, wherein the cDNA sequences of the gene GhZY of the leaf wrinkling material (ZY) are shown as a sequence 4 in a sequence table, and the amino acid sequence of the protein GhZY of a leaf wrinkling material (ZY) control leaf wrinkling material is shown as a sequence 3 in the sequence table; the cDNA sequence of the gene GhZY of the normal material (TM-1) is only that the 1087bp base of the sequence 4 is changed from A to G. The whole length of the GhZY gene of the wrinkled leaf/normal material is compared and analyzed by DNAMAN software, and the gene is found to have 21 exons and 20 introns in the wrinkled leaf material (ZY)/normal material (TM-1) cotton material, but the base of the normal material at the 1087bp position of the cDNA sequence is G, the base of the wrinkled leaf material is A, and the difference of amino acid codes is caused by the difference of the base in the wrinkled leaf material (ZY)/normal material (TM-1) cotton material, and glutamic acid of the normal material (TM-1) is changed into lysine of the wrinkled leaf material (ZY), so that the leaf shape character is changed.
Primer pairs for PCR amplification are:
f3: ATGGGTAGGAAGAAGAGA (sequence 10 in the sequence Listing)
R3: TTAACAGTAGAACATAACAC (sequence 11 in the sequence table)
The PCR reaction procedure was: pre-denaturation at 94℃for 3min;94℃for 30s,55℃for 30s and 72℃for 3min, for a total of 35 cycles.
Example 2 functional verification of cotton leaf wrinkling control Gene GhZY
Material to be measured: taking cotton material of wrinkled leaf material (ZY)/normal material (TM-1) as parent, constructing F2 genetic group, randomly selecting 153 single plants from the genetic group, and identifying wrinkled leaf and normal leaf of cotton. Planting seeds of the materials to be tested in a river-north gallery farm base, extracting genome DNA of each material to be tested from seedlings by adopting a CTAB method after a first true leaf appears, carrying out PCR amplification on the GhZY genes by using each genome DNA as a template and using an upstream primer F: TGCCTTCTGACTGGTAATGGGT (sequence 12)/R: ACCTTCACACGATCAGCATCAG (sequence 2) in a sequence table), sequencing PCR products, and finally confirming that 40 seedlings in the 153 materials to be tested have GhZY genes shown by ZY materials, wherein the leaf types of the 40 materials are in field expression of wrinkled leaves. Therefore, the identification of the gene level is consistent with the field phenotype, and the GhZY protein shown in the sequence 3 is proved to control the leaf wrinkling character of cotton. The PCR amplification system of this example is described in the second section of example 1, with the amplification conditions in the following order: maintaining at 94 ℃ for 30 seconds to denature the template, then reducing the temperature to 57 ℃ for 30 seconds to fully anneal the primer and the template; the reaction was kept at 72℃for 1 minute (1 kb fragment was amplified) to extend the primer on the template, thereby synthesizing DNA, and one cycle was completed. This cycle was repeated 35 times to accumulate a large amount of amplified DNA fragments. Finally, the product is kept at 72 ℃ for 4min to extend completely, and the product is stored at 4 ℃.
Example 3 application of SNP locus and dCAPS marker to identification of whether cotton is wrinkled leaf
Further population verification was performed on the molecular markers developed in example 1.
According to dCAPs primer, online designing website http:// helix. Wust. Edu/dCAPs/dCAPs html, developing and designing dC A P s molecular marker closely linked with GhZY gene, wherein forward and reverse amplification primers are respectively shown as sequence 1 and sequence 2 in a sequence table.
153 parts of cotton and 20 parts of cotton material transformed by normal leaf backcross in the F2 population in the example 1 are selected as verification materials, PCR amplification is carried out by using the specific primers (sequence 1 and sequence 2), xbaI restriction enzyme digestion is carried out on the amplified products, and genotyping of SNP loci of cotton varieties to be detected is determined according to electrophoresis results of enzyme digestion products, so that the accuracy of the SNP molecular markers linked with the cotton leaf wrinkling control gene GhZY applied to identifying cotton leaf wrinkling varieties or auxiliary breeding is verified.
The PCR reaction was performed on a Hydrocarbon water bath PCR apparatus.
The PCR amplification system is as follows: 25ng of template DNA, 0.5. Mu.M upstream primer, 0.5. Mu.M downstream primer, 0.2mM dNTP mix;0.5U Taq DNA polymerase, 1 XPCR Buffer (Fermentas) 2. Mu.L, ddH 2 O was made up to 20. Mu.L.
The amplification conditions were in order: maintaining at 94 ℃ for 30 seconds to denature the template, then reducing the temperature to 57 ℃ for 30 seconds to fully anneal the primer and the template; the reaction was kept at 72℃for 1 minute (1 kb fragment was amplified) to extend the primer on the template, thereby synthesizing DNA, and one cycle was completed. This cycle was repeated 35 times to accumulate a large amount of amplified DNA fragments. Finally, the product is kept at 72 ℃ for 4min to extend completely, and the product is stored at 4 ℃.
The enzyme digestion method of PCR amplification products comprises the following steps: the cleavage system (30. Mu.l) contained: 10. Mu.l of PCR amplification product, 2. Mu.l of 10 XBuffer R (from Thermo Co.) and 1.0. Mu.l of XbaI (from Thermo Co.) were added to 30. Mu.l of sterilized double distilled water. The enzyme digestion reaction procedure is as follows: stage 1: incubating at 65 ℃ for 10 hours; stage 2: inactivating at 80 ℃ for 20 min; stage 3: preserving at 4 ℃.
Comparing the genotyping result of each material with the actually observed cotton leaf type, when the size of the enzyme cutting product is 316bp, the genotype of the SNP locus in the cotton genome to be detected is G, if the cotton is wrinkled leaf, the detection result is accurate, otherwise, the identification result is considered to be inaccurate; when the size of the enzyme digestion product is 344bp, the genotype of the SNP locus in the genome of the cotton to be detected is A, if the cotton is a normal leaf, the detection result is accurate, otherwise, the identification result is considered to be inaccurate; when the size of the enzyme digestion product is 344bp and 316bp, the genotype of the SNP locus in the genome of the cotton to be detected is A to G, if the cotton is normal leaf, the detection result is accurate, otherwise, the identification result is considered to be inaccurate.
Gel electrophoresis is carried out after enzyme digestion, partial electrophoresis results are shown in fig. 3, the sizes of enzyme digestion products of partial materials are shown in table 1, and genotyping results are shown in table 1.
The genotyping result of each material is compared with the actually observed cotton leaf shape, and the consistency rate of the genotyping result and the actually observed cotton leaf shape is 100%, which indicates that the accuracy of SNP molecular marker detection is 100%, and the genotyping method can be applied to cotton molecular marker assisted selection breeding.
Table 1 genotyping results and actual observed cotton leaf patterns for 20 of the test materials
。
Claims (10)
1. The primer pair is used for detecting polymorphism or genotype of cotton wrinkling leaf control gene GhZY linkage SNP locus, and is characterized in that the cotton wrinkling leaf control gene GhZY linkage SNP locus is positioned at 61394027 nucleotide on chromosome 12 of D subgroup of cotton reference genome Ghir.ZJU, and the base of the cotton wrinkling leaf control gene GhZY linkage SNP locus is G or A; the primer pair comprises:
the nucleotide sequence of the upstream primer ZY-F is shown as a sequence 1 in a sequence table,
the nucleotide sequence of the downstream primer TM-1-R is shown as a sequence 2 in a sequence table.
2. A substance for detecting polymorphism or genotype of SNP locus linked to cotton leaf wrinkling control gene GhZY, characterized by comprising:
the primer pair of claim 1, and an XbaI restriction enzyme;
the cotton wrinkled leaf control gene GhZY linkage SNP locus is located at 61394027 nucleotide on chromosome 12 of D subgroup of cotton reference genome Ghir.ZJU, and the base of the cotton wrinkled leaf control gene GhZY linkage SNP locus is G or A.
3. Use of the primer pair of claim 1 or the substance of claim 2 in one of the following aspects:
(a) Identification or assisted identification of cotton wrinkled leaves or normal leaves;
(b) The application in preparing products for identifying or assisting in identifying whether cotton is wrinkled or not;
(c) Application of removing wrinkled leaf varieties in cotton breeding;
detecting polymorphism or genotype of cotton leaf wrinkling control gene GhZY linked SNP locus with the primer set of claim 1 or the substance of claim 2 to identify or assist in identifying cotton leaf wrinkling or normal leaf:
when the genotype of the SNP site is G: G, the cotton is wrinkled leaves, when the genotype of the SNP site is A: A, the cotton is normal leaves, and when the genotype of the SNP site is A: G, the cotton is normal leaves.
4. A method for identifying or aiding in the identification of wrinkled or normal leaves of cotton comprising the steps of:
detecting the genotype of an SNP locus in a genome of the cotton to be detected, wherein the cotton is wrinkled leaves when the genotype of the SNP locus is G, the cotton is normal leaves when the genotype of the SNP locus is A, and the cotton is normal leaves when the genotype of the SNP locus is A G, wherein the SNP locus is positioned at 61394027 nucleotide on chromosome 12 of a D subgroup of a cotton reference genome Ghir ZJU.
5. The method according to claim 4, wherein the method for detecting the genotype of SNP locus in the genome of cotton to be tested comprises the following (M1) or (M2):
(M1) direct sequencing,
and (M2) taking the cotton genome to be detected as a template, carrying out PCR amplification by using a primer pair capable of amplifying the SNP locus to obtain an amplification product, then carrying out enzyme digestion on the amplification product by using restriction enzyme, analyzing the size of the enzyme digestion product, and determining the genotype of the SNP locus in the cotton genome to be detected according to the size of the enzyme digestion product.
6. The method according to claim 5, wherein the primer pair capable of amplifying SNP site is the primer pair of claim 1, and the restriction enzyme is XbaI restriction enzyme;
when the size of the enzyme digestion product is 316bp, the genotype of the SNP locus in the genome of the cotton to be detected is G, and the cotton is wrinkled leaves; when the size of the enzyme digestion product is 344bp, the genotype of the SNP locus in the genome of the cotton to be detected is A, and the cotton is a normal leaf; when the sizes of the enzyme digestion products are 344bp and 316bp, the genotype of SNP loci in the genome of cotton to be detected is A to G, and the cotton is normal leaf.
7. A protein for controlling cotton leaf wrinkling character has an amino acid sequence shown as a sequence 3 in a sequence table.
8. A material related to the protein of claim 7, which is any one of the following (A1) to (A6):
(A1) A nucleic acid molecule encoding the protein of claim 7;
(A2) An expression cassette comprising the nucleic acid molecule of (A1);
(A3) A recombinant vector comprising the nucleic acid molecule of (A1);
(A4) A transgenic plant cell line comprising the nucleic acid molecule of (A1);
(A5) A transgenic plant cell line comprising the expression cassette of (A2);
(A6) A transgenic plant cell line comprising the recombinant vector of (A3).
9. The material according to claim 8, wherein the nucleic acid molecule is a cDNA molecule encoding the protein of claim 7 as shown in sequence 4 in the sequence table or a genomic DNA molecule as shown in sequence 5 in the sequence table.
10. Use of a protein according to claim 7 or a material according to claim 8 or 9 for the identification or assisted identification of wrinkled or normal cotton leaves or for the removal of wrinkled leaves varieties in cotton breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311394468.9A CN117126962B (en) | 2023-10-26 | 2023-10-26 | Cotton leaf wrinkling control gene GhZY, linkage SNP locus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311394468.9A CN117126962B (en) | 2023-10-26 | 2023-10-26 | Cotton leaf wrinkling control gene GhZY, linkage SNP locus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117126962A CN117126962A (en) | 2023-11-28 |
| CN117126962B true CN117126962B (en) | 2024-02-02 |
Family
ID=88851132
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311394468.9A Active CN117126962B (en) | 2023-10-26 | 2023-10-26 | Cotton leaf wrinkling control gene GhZY, linkage SNP locus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117126962B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107129998A (en) * | 2009-06-10 | 2017-09-05 | 淡马锡生命科学研究院有限公司 | The virus induced gene silencing (VIGS) analyzed for gene function in cotton |
| CN112226533A (en) * | 2020-11-24 | 2021-01-15 | 石河子大学 | Molecular marker related to cotton leaf rolling character and application thereof |
| CN113121664A (en) * | 2020-01-15 | 2021-07-16 | 华中农业大学 | Method for identifying, selecting and generating disease resistant crops |
| CN116004712A (en) * | 2022-12-01 | 2023-04-25 | 郑州大学 | Application of RH2 gene in regulation and control of cotton leaf stretching/shrinking character |
-
2023
- 2023-10-26 CN CN202311394468.9A patent/CN117126962B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107129998A (en) * | 2009-06-10 | 2017-09-05 | 淡马锡生命科学研究院有限公司 | The virus induced gene silencing (VIGS) analyzed for gene function in cotton |
| CN113121664A (en) * | 2020-01-15 | 2021-07-16 | 华中农业大学 | Method for identifying, selecting and generating disease resistant crops |
| CN112226533A (en) * | 2020-11-24 | 2021-01-15 | 石河子大学 | Molecular marker related to cotton leaf rolling character and application thereof |
| CN116004712A (en) * | 2022-12-01 | 2023-04-25 | 郑州大学 | Application of RH2 gene in regulation and control of cotton leaf stretching/shrinking character |
Non-Patent Citations (1)
| Title |
|---|
| 棉花形态性状质量遗传分析与基因定位研究进展;臧新山;耿延会;裴文锋;吴嫚;李兴丽;张金发;于霁雯;;棉花学报(第06期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117126962A (en) | 2023-11-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sandal et al. | A genetic linkage map of the model legume Lotus japonicus and strategies for fast mapping of new loci | |
| CN108165554B (en) | Corn leaf width control gene ZmNL4 and application thereof | |
| CN111172294B (en) | Co-dominant SSR marker closely linked with tobacco nicotine synthesis major regulatory gene nic1 and application thereof | |
| CN111172173B (en) | Method for reducing plant height of corn or delaying flowering | |
| CN110904266B (en) | Identification of maize stalk lodging resistance QTL and development and application of molecular marker | |
| CN112094935B (en) | SNP molecular marker for identifying specific strength and micronaire value of cotton fiber and application | |
| CN106755465B (en) | Molecular marker closely linked with wheat flag leaf length QTL QFLL | |
| CN110628930B (en) | dCAPS molecular marker for identifying panicle length character of rice and application thereof | |
| CN117126962B (en) | Cotton leaf wrinkling control gene GhZY, linkage SNP locus and application thereof | |
| CN104711254B (en) | The low-phosphorous responsive genes ZmARF31 of corn INDEL molecular labelings and its application | |
| KR102429219B1 (en) | Marker composition for discrimination of soybean cultivar resistant or susceptible to Phytophthora sojae and uses thereof | |
| CN105925587B (en) | Early rice chloroplast development gene subjected to low-temperature response and detection method and application thereof | |
| KR102154701B1 (en) | Novel genetic markers for selection of watermelon dwarf entities and use thereof | |
| KR102081973B1 (en) | SNP marker for selecting rice cultivars resistant to bakanae disease of rice and use thereof | |
| CN106995846A (en) | The detection and application of a kind of Henan south aromatic rice Badh2 gene functions mark | |
| CN116970734B (en) | SNP locus linked with cotton multi-ventricular control gene GaMV and application thereof | |
| CN108642199B (en) | SNP (Single nucleotide polymorphism) marker related to growth of millet flag leaves as well as detection primer and application thereof | |
| CN112662687A (en) | Method, kit and gene for postponing maize florescence | |
| CN111334597A (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN112094940B (en) | Indel marker linked with cucumber long hypocotyl gene lh1 as well as primer, kit and application thereof | |
| CN116218887B (en) | Application of amidase protein gene OsAMID in improving rice yield | |
| CN114736979B (en) | Molecular marker closely linked with watermelon complete leaf shape gene ClLL and application thereof | |
| KR102081964B1 (en) | SNP marker for selecting rice cultivars resistant to bakanae disease of rice and use thereof | |
| CN112646013B (en) | Corn flowering phase gene and application thereof | |
| KR102141619B1 (en) | A new floury endosperm gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |