CN111257567A - Composition for quantitatively analyzing mesenchymal stem cell membrane protein and method and application thereof - Google Patents
Composition for quantitatively analyzing mesenchymal stem cell membrane protein and method and application thereof Download PDFInfo
- Publication number
- CN111257567A CN111257567A CN202010085709.1A CN202010085709A CN111257567A CN 111257567 A CN111257567 A CN 111257567A CN 202010085709 A CN202010085709 A CN 202010085709A CN 111257567 A CN111257567 A CN 111257567A
- Authority
- CN
- China
- Prior art keywords
- cells
- composition
- membrane protein
- seq
- mesenchymal stem
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70585—CD44
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A composition for quantitatively analyzing mesenchymal stem cell membrane protein comprises an aptamer primer shown as SEQ ID No 1, an auxiliary primer shown as SEQ ID No 2, a circular DNA template shown as SEQ ID No 3 and a molecular beacon shown as SEQ ID No 4. The invention realizes the nondestructive analysis of the target cell membrane protein by recognizing the membrane protein of the cell through the DNA chain and obtaining the amplified fluorescent signal, can be customized according to the specific detection requirements of the target cell (such as mesenchymal stem cells and even membrane proteins on the surfaces of other different types of cells), meets the actual requirements of different analyses, and has good application potential.
Description
Technical Field
The invention relates to a composition for detection, in particular to a composition for quantitatively detecting protein, which realizes the nondestructive analysis of mesenchymal stem cell membrane protein.
Background
Mesenchymal cells (MSCs) originate from embryonic mesodermal stem cells and are widely present throughout the body. Among them, mesenchymal stem cells belong to a class of pluripotent stem cells of mesoderm, are mainly present in connective tissues and organ mesenchyme, are concentrated in bone marrow and adipose tissues, and have various potentials. Under certain conditions, it can be induced to differentiate into different types of cells in vivo and in vitro, such as: chondrocytes, osteoblasts, adipocytes, nerve cells, cardiac muscle cells, and the like. It is easy to separate and culture and has high in vitro amplification potential. Clinical experiments prove that the mesenchymal stem cell transplantation can be used for tissue repair and treatment of mesenchymal tissue genetic defect diseases, and is an attractive treatment tool. The CD44 protein is a group of membrane integrins which are widely distributed and have the molecular weight of (85-160) multiplied by 10kD in a multi-molecular form, mediates the interaction between cells and extracellular matrix, and has higher expression ratio of CD44 in various tumor cells than that of corresponding normal tissues, and is related to the tumorigenicity, invasiveness and lymphatic metastasis of the tumor cells. Therefore, the analysis of the mesenchymal stem cell membrane protein marker CD44 can provide a lot of important information for clinical judgment of various bone diseases, lung injuries, diabetes, nervous system diseases, autoimmune diseases and other diseases.
There are many methods for detecting CD44 protein, but they are all conventional methods such as Immunofluorescence (IF), immunoblotting (WB) and Mass Spectrometry (MS). Immunoblotting and mass spectrometry methods, while providing quantitative information about proteins, are destructive to cells and require lysis of cells and prior extraction of proteins. Immunofluorescence is a powerful immunochemical technique that allows the in situ, non-structurally destructive detection of a variety of membrane proteins by fluorophore-modified antibodies. However, this method requires irreversible labeling of the target protein with an antibody, which may unpredictably affect the activity of the membrane protein and the cells. DNA is short for deoxyribonucleic acid (deoxyribonic acid), and has unique advantage in the aspect of constructing a functional structure on a nanometer scale as a natural biological macromolecule. Since the DNA nanotechnology is proposed, the DNA nanotechnology has the characteristics of structural programmability, good biocompatibility and biostability, no obvious cytotoxicity and immunostimulation, capability of entering cells autonomously and the like, has attracted wide attention in the field of biomedicine, and is already used for imaging and detecting tumors.
Disclosure of Invention
One object of the present invention is to provide a composition containing a fluorescence-modified DNA strand for quantitative analysis for in situ imaging of target cell membrane proteins.
Another object of the present invention is to provide a composition comprising a fluorescence-modified DNA strand, which is bound to a membrane protein of a mesenchymal stem cell, such that the expression of the membrane protein and the activity of the cell are not affected, thereby achieving a non-destructive analysis.
It is yet another object of the present invention to provide a cellular method of analysis that allows for quantitative analysis of in situ imaging of the target cell membrane protein CD44 in a sample.
It is still another object of the present invention to provide a kit for quantitative analysis of in situ imaging of target cell membrane protein CD44 in a sample.
The target cell of the present invention is a generic term for the cell to be detected contained in the sample, such as: but are not limited to, somatic cells, stem cells, cancer cells, and the like.
A composition comprising
An aptamer primer (Apt-Pri) shown as SEQ ID No. 1, wherein a red fluorescent group (such as Cy5) is marked at the 5' end of the aptamer primer;
an auxiliary primer (Ass-Pri) shown as SEQ ID No. 2;
a circular DNA template (LOOP) shown as SEQ ID No. 3;
the 5 'end and the 3' end of the Molecular Beacon (MB) shown by SEQIDNo 4 are respectively modified with a green fluorescent group FAM and a quenching group BHQ.
The various compositions of the present invention further comprise chlorpromazine hydrochloride (CPM), 1mg/mL BSA, 10 v/v% Fetal Bovine Serum (FBS), 4.5g/L glucose, 5mM MgCl2And DMEM medium, etc., which are used alone and in combination in the present invention.
The present invention provides various compositions further comprising:
DNA polymerase (Klenow Fragment, 3 '→ 5' exo)-) For amplification and extension of the 3' end,
a DNA polymerase buffer, and
dNTP。
in the composition, the sequence of the oligodeoxynucleotide Apt-Pri is as follows:
5′-ccaaggcctgcaagggaaccaaggacacagacctcacgaccattctgc；
in the composition of the invention, the sequence of the oligodeoxynucleotide Ass-Pri is as follows:
ctaacaattatcactgggtcgtgaggt；
in the composition of the present invention, the sequence of oligodeoxynucleotide LOOP is:
gtacggcagaatcagtgataattgttagaagaaaaaaaaatcccaacccgccctaccct；
in the composition of the present invention, the sequence of oligodeoxynucleotide MB is:
cgctctcccaacccgccctagagcg。
according to the composition, the detected target cell is mesenchymal stem cell, and the membrane protein is CD 44.
The composition can also be used for ectopic fluorescence quantitative analysis of the mesenchymal stem cell membrane protein CD44, and the method comprises the following steps:
firstly, a mixture of Apt-Pri, Ass-Pri and Loop is heated for 5 minutes at 95 ℃ in a buffer solution (such as Phosphate Buffered Saline (PBS)) to denature the mixture, and then the mixture is cooled to room temperature to complement the mixture into a DNA three-body complex structure;
thereafter, to prevent endocytosis of the aptamer, 100 μ M chlorpromazine hydrochloride (CPM) was added to the medium and incubated with the cells in a carbon dioxide thermostated cell incubator for 30 minutes;
next, the CPM-containing medium was gently washed twice with buffer, and then 100. mu.L of RCA reaction buffer containing 150 nmRNA trisomy complex (i.e., 2. mu.L of 10mM dNTPs, 2. mu.L of 5U/. mu.L DNA polymerase, 10. mu.L of 10 XPase reaction buffer, 5. mu.L of 10. mu.M molecular beacon, and 81. mu.L of DMEM) and the cells were incubated for 2 hours;
and finally, collecting the supernatant to detect the intensity of the fluorescence signal, thereby realizing the ectopic fluorescence quantitative analysis of the target cell membrane protein.
The composition is used for performing nondestructive analysis on the mesenchymal stem cell membrane protein CD44, and the method comprises the following steps:
firstly, a mixture of Apt-Pri, Ass-Pri and Loop is heated for 5 minutes at 95 ℃ in a buffer solution (such as Phosphate Buffered Saline (PBS)) to denature the mixture, and then the mixture is cooled to room temperature to complement the mixture into a DNA three-body complex structure;
thereafter, to prevent endocytosis of the aptamer, 100 μ M chlorpromazine hydrochloride (CPM) was added to the medium and incubated with the cells in a carbon dioxide thermostated cell incubator for 30 minutes;
then, incubating the aptamer-protein binding buffer containing 150nM DNA trisomy complex and the cells at 37 ℃ for 60 minutes to realize qualitative analysis of in-situ imaging of target cell membrane proteins;
then, washing off the aptamer-protein binding buffer solution by using PBS, adding RCA reaction buffer solution and incubating the cells for 2 hours, and collecting the supernatant to detect the intensity of a fluorescence signal so as to realize quantitative analysis of ectopic fluorescence of the target cell membrane protein;
finally, the analyzed cells were subjected to Western blotting (Western Blot) and CCK-8(CellCounting Kit-8) to detect changes in membrane protein expression and cell activity.
Finally, the target cell membrane protein is analyzed without damage.
The technical scheme of the invention has the following beneficial effects:
the detection composition disclosed by the invention realizes in-situ imaging qualitative and ectopic fluorescence quantitative analysis on target cells in a sample by adopting a signal amplification system mediated by Rolling Circle Amplification (RCA) and combined with a trisomy complex formed by DNA complementation and a target membrane protein.
The detection composition can select aptamers of different target cell membrane proteins according to detection requirements, and can be applied to analysis and detection of different target cell membrane proteins by selecting the membrane proteins with characteristics, so that the detection composition has good universality.
The composition is convenient to operate, can realize complete lossless analysis of cells and membrane proteins thereof, and can be widely applied to the fields of clinical diagnosis, disease monitoring and the like.
Drawings
FIG. 1 is a schematic diagram of the principle of the composition of the present invention for non-destructive analysis of mesenchymal stem cell membrane proteins;
FIG. 2 is an image of different cells under a confocal laser scanning microscope;
FIG. 3 shows the quantification of membrane proteins for different cell number assays;
FIG. 4 is a graph showing the results of protein expression measurement by Western blotting;
FIG. 5 is a diagram showing the results of the measurement of cell activity by the CCK-8 method.
Detailed Description
The technical scheme of the invention is described in detail in the following with reference to the accompanying drawings. Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the spirit and scope of the invention as defined in the appended claims.
Example 1 qualitative detection of mesenchymal Stem cell Membrane proteins
The aptamer primers (Apt-Pri) were denatured by heating at 95 ℃ for 5 minutes, and then cooled to room temperature to form a DNA secondary structure. In the glass bottom confocal culture dish, the culture dish is 1 multiplied by 105The individual cells were seeded. For better adherent growth of cells, the cells were cultured in a carbon dioxide incubator at 37 ℃ for 24 hours. To prevent endocytosis of the aptamer, 150 μ L of 100 μ M chlorpromazine hydrochloride was added to the medium and incubated with the cells for 30 minutes in a carbon dioxide thermostated cell incubator.
The medium containing chlorpromazine hydrochloride was removed by washing twice with 1 XPBS, and then 150. mu.L of aptamer-protein binding buffer (containing 1mg/mL Bovine Serum Albumin (BSA), 10 v/v% Fetal Bovine Serum (FBS), 4.5g/L glucose and 5mM magnesium chloride (MgCl) containing 150nM aptamer primer (Apt-Pri) was added2) Serum-free double-antibody-containing high-sugar medium (DMEM) and carbon dioxide at 37 ℃ of cellsIncubators for 60 minutes. The medium containing aptamer-protein binding buffer was removed by washing twice with 1 × PBS and 1mL of PBS was added. Finally, imaging under a confocal laser scanning microscope to realize qualitative analysis of in-situ imaging of target cell membrane proteins, as shown in fig. 2.
Example 2 quantitative detection of mesenchymal Stem cells
The principle of analyzing mesenchymal stem cell membrane protein with the composition (e.g., Apt-Pri, etc.) provided in this example is shown in FIG. 1. The specific implementation mode is as follows:
a mixture of aptamer primers (Apt-Pri), helper primers (Ass-Pri), and circular DNA template (LOOP) was denatured by heating at 95 ℃ for 5 minutes, and then slowly cooled to room temperature to complement it into a DNA triplet complex structure. 1X 10 per culture dish in 24-well plates4The cells were inoculated and cultured in a carbon dioxide incubator at 37 ℃ for 24 hours for better adherent growth. To prevent endocytosis of the aptamer, 150 μ L of 100 μ M chlorpromazine hydrochloride (CPM) was added to the medium and incubated with the cells for 30 minutes in a carbon dioxide thermostated cell incubator. The CPM-containing medium (e.g., DMEM medium) was removed by gentle two washes with 1 XPBS, and then 100. mu.L of Rolling Circle Amplification (RCA) reaction buffer containing 150NM DNA trisome complex, containing 2. mu.L of 10mM deoxyribonucleoside triphosphates (dNTPs), 2. mu.L of 5U/. mu.LDNA polymerase, 10. mu.L of 10 XPase reaction buffer, 5. mu.L of 10. mu.M Molecular Beacon (MB) and 81. mu.L of High Glucose medium (DMEM, High Glucose) containing 10% Fetal Bovine Serum (FBS) and diabodies, and the cells were incubated for 2 hours. And finally, collecting the RCA reaction buffer solution, and detecting the intensity of a fluorescence signal by using a fluorescence spectrophotometer to realize the ectopic fluorescence quantitative analysis of the target cell membrane protein. As can be seen in fig. 3, the detection limit is 10 cells.
Example 3 non-destructive analysis of mesenchymal Stem cell Membrane proteins
Three groups of mesenchymal stem cells, three groups of HepG2 and L02 cells were prepared, and the CD44 protein of the three cells of the first group was assayed by a Western blotting (Western Blot) experiment. The second set of three cells was then subjected to the first round of analysis as described in example 2 above, and the cells after the analysis were subjected to western blot assay. Then, the first round of analysis was performed on the three cells of the second group by the same method as in example 2, the cells after the analysis were placed in a carbon dioxide constant temperature cell incubator and cultured for 2 hours, and after the cells became stable, the second round of analysis was continued by the same method as in example 2, and the cells after the analysis were subjected to western blotting experimental determination. The results are shown in FIG. 4: compared with the group which is not analyzed, the expression amount of the cell membrane protein which is analyzed in the first round and the second round is not obviously changed, which shows that the analysis method adopting the composition of the embodiment does not influence the expression of the cell membrane protein.
Example 4 non-destructive analysis of mesenchymal Stem cell Membrane proteins Effect on cellular Activity
Three groups of mesenchymal stem cells, HepG2 and L02 were prepared, and the cells were divided into 1X 10 cells4The cells were seeded in 96-well plates at a density of one cell per well and were cultured for 24 hours in a carbon dioxide incubator at 37 ℃ for better adherent growth. Medium (Ab) without any reagent addition and medium with cells (Ac) were used as blank and control, respectively. The medium containing the cells and subjected to the total nondestructive analysis was used As an experimental group (As). After 48 hours of culture, the first group of three cells was assayed by the CCK-8 method (Cell Counting Kit-8). The second set of three cells was then subjected to the first round of analysis as described in example 2 above, and the cells after the end of the analysis were subjected to the CCK-8 assay. The cells of the second group were subjected to the first round of analysis by the same method as in example 2, the cells after the analysis were placed in a carbon dioxide-isothermal cell incubator and cultured for 2 hours, and after the cells were stabilized, the second round of analysis was carried out by the same method as in example 2, and the cells after the analysis were measured by the CCK-8 method. The results are shown in FIG. 5: the cell activities of the first and second rounds of analysis did not change significantly compared to the non-analyzed group, indicating that the assay using the composition of this example did not affect the cell activities.
The CCK-8 method comprises the following steps: 10 μ LCCK-8 reagent was added to each well and cells were incubated continuously for 2h at 37 ℃. Finally, the OD value was assessed by absorbance measurement at 450nm by a microplate reader. The assay was repeated three times and the cell viability was calculated as follows:
cell viability (%) - [ (As-Ab)/(Ac-Ab) ] × 100%.
Sequence listing
<110> official business
CHINA STEM CELL GROUP SHANGHAI BIOTECHNOLOGY Co.,Ltd.
CHONGQING STEM CELL TECHNOLOGY Co.,Ltd.
CHINA STEM CELL GROUP HAINAN BOAO AFFILIATED STEM CELL HOSPITAL Co.,Ltd.
SHANGHAI STEM CELL TECHNOLOGY Co.,Ltd.
SHAANXI STEM CELL TECHNOLOGY Co.,Ltd.
SOOCHOW STEM CELL TECHNOLOGY Co.,Ltd.
SANYA STEM CELL TECHNOLOGY Co.,Ltd.
<120> composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof
<141>2020-02-03
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>48
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ccaaggcctg caagggaacc aaggacacag acctcacgac cattctgc 48
<210>2
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ctaacaatta tcactgggtc gtgaggt 27
<210>3
<211>59
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gtacggcaga atcagtgata attgttagaa gaaaaaaaaa tcccaacccg ccctaccct 59
<210>4
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cgctctccca acccgcccta gagcg 25
Claims (10)
1. A composition characterized by comprising:
the aptamer primer shown in SEQ ID No 1, wherein the 5' end of the aptamer primer is marked with a fluorescent group;
an auxiliary primer shown as SEQ ID No. 2;
a circular DNA template shown as SEQ ID No. 3;
the 5 'end and the 3' end of the molecular beacon shown in SEQ ID No. 4 are respectively modified with a green fluorescent group FAM and a quenching group BHQ.
2. Composition according to claim 1, characterized in that it further comprises chlorpromazine hydrochloride.
3. The composition of claim 1, wherein said oligodeoxyribonucleotide strand is conjugated to a membrane protein CD 44.
4. The composition of claim 1, wherein the fluorophore is Cy 5.
5. Use of a composition according to any one of claims 1 to 4 in a quantitative assay for in situ imaging of target cells.
6. Use of the composition of any one of claims 1 to 4 in quantitative analysis of mesenchymal stem cell membrane protein CD 44.
7. Use of a composition according to any one of claims 1 to 4 in the non-destructive analysis of mesenchymal stem cells.
8. A kit characterized by comprising the composition of any one of claims 1 to 4.
9. A method of performing a qualitative analysis of a target cell using the composition of any one of claims 1 to 4, comprising the steps of:
firstly, the mixture of aptamer primer, auxiliary primer and circular DNA template is put into buffer solution, heated for 5 minutes at 95 ℃ to denature the mixture, and then cooled to room temperature to complement the mixture into a DNA trisome complex structure;
thereafter, to prevent endocytosis of the aptamer, 100 μ M chlorpromazine hydrochloride was added to the medium and incubated with the cells in a carbon dioxide thermostated cell incubator for 30 minutes;
then, the medium containing chlorpromazine hydrochloride was removed by gently washing twice with a buffer solution, and then 100. mu.L of RCA reaction buffer containing 150 nmRNA trisomy complex and cells were incubated for 2 hours;
finally, collecting the supernatant to detect the intensity of the fluorescence signal, and realizing the ectopic fluorescence quantitative analysis of the target cell membrane protein;
the RCA reaction buffer contained 5. mu.L of 10. mu.M molecular beacon.
10. The method of claim 11, wherein said RCA reaction buffer further comprises 2 μ L of 10mM dNTPs, 2 μ L of 5U/μ L DNA polymerase, 10 μ L of 10x polymerase reaction buffer and 81 μ L of DMEM.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310241143.0A CN116148480A (en) | 2020-02-10 | 2020-02-10 | Compositions and methods for quantitative analysis of mesenchymal stem cell protein CD44 |
| CN202010085709.1A CN111257567B (en) | 2020-02-10 | 2020-02-10 | Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010085709.1A CN111257567B (en) | 2020-02-10 | 2020-02-10 | Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310241143.0A Division CN116148480A (en) | 2020-02-10 | 2020-02-10 | Compositions and methods for quantitative analysis of mesenchymal stem cell protein CD44 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111257567A true CN111257567A (en) | 2020-06-09 |
| CN111257567B CN111257567B (en) | 2023-05-30 |
Family
ID=70949236
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310241143.0A Pending CN116148480A (en) | 2020-02-10 | 2020-02-10 | Compositions and methods for quantitative analysis of mesenchymal stem cell protein CD44 |
| CN202010085709.1A Active CN111257567B (en) | 2020-02-10 | 2020-02-10 | Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310241143.0A Pending CN116148480A (en) | 2020-02-10 | 2020-02-10 | Compositions and methods for quantitative analysis of mesenchymal stem cell protein CD44 |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN116148480A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090117549A1 (en) * | 2006-07-18 | 2009-05-07 | Weihong Tan | Aptamer-based methods for identifying cellular biomarkers |
| US20130040837A1 (en) * | 2009-12-01 | 2013-02-14 | Brigham And Women's Hospital, Inc. | Aptamer cell compositions |
| CN106011235A (en) * | 2016-05-16 | 2016-10-12 | 南京大学 | Membrane protein analysis method based on DNA molecule cascade signal amplification |
| CN107929751A (en) * | 2017-11-20 | 2018-04-20 | 三峡大学 | A kind of foundation of medicine-carried system and synthetic method |
-
2020
- 2020-02-10 CN CN202310241143.0A patent/CN116148480A/en active Pending
- 2020-02-10 CN CN202010085709.1A patent/CN111257567B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090117549A1 (en) * | 2006-07-18 | 2009-05-07 | Weihong Tan | Aptamer-based methods for identifying cellular biomarkers |
| US20130040837A1 (en) * | 2009-12-01 | 2013-02-14 | Brigham And Women's Hospital, Inc. | Aptamer cell compositions |
| CN106011235A (en) * | 2016-05-16 | 2016-10-12 | 南京大学 | Membrane protein analysis method based on DNA molecule cascade signal amplification |
| CN107929751A (en) * | 2017-11-20 | 2018-04-20 | 三峡大学 | A kind of foundation of medicine-carried system and synthetic method |
Non-Patent Citations (2)
| Title |
|---|
| WANLING ZHANG 等: "A dual-functional microfluidic chip for on-line detection of interleukin-8 based on rolling circle amplification", 《BIOSENSORS AND BIOELECTRONICS》 * |
| 郭晓华 等: "识别多种种属来源间充质干细胞核酸适配体的筛选及鉴定", 《军事医学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116148480A (en) | 2023-05-23 |
| CN111257567B (en) | 2023-05-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Brooks et al. | Ex vivo human adipose tissue derived mesenchymal stromal cells (ASC) are a heterogeneous population that demonstrate rapid culture-induced changes | |
| JP2021175415A (en) | Methods of preparing primary cell sample | |
| US10018633B2 (en) | Multi-aptamer-based, cell-specific, one-step tumor cell detection assays | |
| Lai et al. | A sensitive flow cytometric method for multi-parametric analysis of microRNA, messenger RNA and protein in single cells | |
| CN108430336A (en) | Circulating cells, the internal collection of protein and nucleic acid and Local Quantitative and signature analysis | |
| da Silva Meirelles et al. | The gene expression profile of non-cultured, highly purified human adipose tissue pericytes: Transcriptomic evidence that pericytes are stem cells in human adipose tissue | |
| Young et al. | Muscle injury induces a transient senescence‐like state that is required for myofiber growth during muscle regeneration | |
| EP2460876B1 (en) | Method for identifying senescent mesenchymal stem cells | |
| CN111304312B (en) | Marker for identifying or assisting in identifying vascular cells and/or vascular cell senescence degree and application thereof | |
| KR101828812B1 (en) | Kit for Detecting Senescence of Stem cells | |
| CN111257567B (en) | Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof | |
| CN111239089B (en) | Method for nondestructive analysis of mesenchymal stem cell membrane protein | |
| CN111235155B (en) | Composition, method and application for qualitative analysis of mesenchymal stem cell membrane protein | |
| KR101704828B1 (en) | Method for diagnosing inflammatory diseases through analysis of protein or gene of extracellular vesicle in a body fluid | |
| JPWO2019240073A1 (en) | Quantitative PCR probe | |
| WO2011049439A1 (en) | Method for selecting bone forming mesenchymal stem cells | |
| CN113684256B (en) | Method for detecting multiple targets by multiple positioning based on green solvent and programmable oligonucleotide probe | |
| CN110408620B (en) | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof | |
| EP3009521B1 (en) | Marker for detecting proliferation and treatment capacities of adipose-derived stem cell cultured in medium containing egf or bfgf, and use thereof | |
| JP2019007759A (en) | Method for evaluating aging degree and kit for evaluating aging degree | |
| CN113567402A (en) | Application of cAMP fluorescent probe G-flash 1 | |
| JP2008524985A (en) | Stem cells, purification methods, identification methods and uses | |
| CN112063719B (en) | Marker for detecting or assisting in detecting retinal cone cells and application thereof | |
| Matsushita et al. | Multi-omics analysis in developmental bone biology | |
| KR101699105B1 (en) | A method for the diagnosis of pancreatic cancer using ALPPL2 protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |