CN111257567B - Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof - Google Patents
Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof Download PDFInfo
- Publication number
- CN111257567B CN111257567B CN202010085709.1A CN202010085709A CN111257567B CN 111257567 B CN111257567 B CN 111257567B CN 202010085709 A CN202010085709 A CN 202010085709A CN 111257567 B CN111257567 B CN 111257567B
- Authority
- CN
- China
- Prior art keywords
- cells
- seq
- membrane protein
- composition
- cell membrane
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70585—CD44
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A composition for quantitatively analyzing mesenchymal stem cell membrane protein comprises an aptamer primer shown as SEQ ID No. 1, an auxiliary primer shown as SEQ ID No. 2, a circular DNA template shown as SEQ ID No. 3 and a molecular beacon shown as SEQ ID No. 4. The invention recognizes the membrane protein of the cell through the DNA chain and obtains the amplified fluorescent signal, thereby realizing the nondestructive analysis of the target cell membrane protein, and the invention can also be customized according to the specific detection requirement of the target cell (such as mesenchymal stem cells and even other membrane proteins on the surface of different cell types), meets the actual requirement of different analysis, and has good application potential.
Description
Technical Field
The invention relates to a composition for detection, in particular to a composition for quantitatively detecting protein, which realizes nondestructive analysis of mesenchymal stem cell membrane protein.
Background
Mesenchymal cells (Mesenchymal stem cells, MSCs) originate from embryonic mesoderm stem cells and are widely found throughout the body. Among them, mesenchymal stem cells belong to a class of pluripotent stem cells of mesoderm, mainly exist in connective tissue and organ interstitium, concentrate in bone marrow and adipose tissue, and have various potential. Under specific conditions, it can be induced to differentiate into different types of cells in vivo and in vitro, such as: chondrocytes, osteoblasts, adipocytes, neural cells, cardiomyocytes, and the like. It is easy to separate and culture and has high in vitro amplification potential. Clinical experiments prove that the mesenchymal stem cell transplantation can be used for tissue repair and treatment of mesenchymal tissue genetic defect diseases, and is an attractive treatment tool. CD44 protein is a widely distributed group of membrane-integrated proteins in a multi-molecular form with the molecular weight of (85-160) multiplied by 10kD, mediates the interaction between cells and extracellular matrix, and CD44 is expressed in a plurality of tumor cells higher than corresponding normal tissues and is related to the tumorigenicity, invasiveness and lymphometastasis of the tumor cells. Therefore, analysis of the mesenchymal stem cell membrane protein marker CD44 can provide a lot of important information for clinical judgment of various diseases such as bone diseases, lung injury, diabetes, nervous system diseases, autoimmune diseases and the like.
There are various methods for detecting CD44 protein, but conventional Immunofluorescence (IF), immunoblotting (WB) and Mass Spectrometry (MS) methods are used. Immunoblotting and mass spectrometry methods, while providing quantitative information on proteins, are destructive to cells and require lysis of the cells and prior extraction of the protein. Immunofluorescence technology is a powerful immunochemical technology that allows in situ non-structural destructive detection of a variety of membrane proteins by fluorophore-modified antibodies. However, this method requires irreversible labelling of the target protein with antibodies, which may unpredictably affect the activity of the membrane proteins and cells. DNA is an abbreviation of deoxyribonucleic acid (deoxyribonucleic acid), which is a natural biological macromolecule with unique advantages in terms of constructing functional structures on the nanometer scale. Since the DNA nanotechnology has been proposed, the DNA nanotechnology has been widely focused in the biomedical field due to its structural programmability, good biocompatibility and biostability, no obvious cytotoxicity and immune-stimulating property, and the ability to enter cells autonomously, and has been used for imaging and detecting tumors.
Disclosure of Invention
It is an object of the present invention to provide a composition comprising fluorescence modified DNA strands for performing in situ imaging quantitative analysis of target cell membrane proteins.
It is another object of the present invention to provide a composition comprising fluorescence modified DNA strands which, when bound to membrane proteins of mesenchymal stem cells, allow the membrane protein expression and cellular activity to be unaffected, allowing for non-destructive analysis.
It is a further object of the present invention to provide an analytical cellular method for performing quantitative in situ imaging of the target cell membrane protein CD44 in a sample.
It is yet another object of the present invention to provide a kit for performing quantitative in situ imaging of the target cell membrane protein CD44 in a sample.
The target cells referred to in the present invention are collectively referred to as cells to be detected contained in a sample, for example: but are not limited to, somatic cells, stem cells, cancer cells, and the like.
A composition comprises
An aptamer primer (Apt-Pri) shown in SEQ ID No. 1, wherein a red fluorescent group (such as Cy 5) is marked at the 5' -end of the aptamer primer;
auxiliary primer (Ass-Pri) shown in SEQ ID No. 2;
a circular DNA template (LOOP) shown in seq id no 3;
the green fluorescent group FAM and the quenching group BHQ are respectively modified at the 5 'end and the 3' end of the Molecular Beacon (MB) shown in SEQ ID No. 4.
The various compositions of the invention further comprise chlorpromazine hydrochloride (CPM), 1mg/mL BSA, 10v/v% Fetal Bovine Serum (FBS), 4.5g/L glucose, 5mM MgCl 2 And DMEM medium, etc., which are used in the present invention alone and in combination.
The invention provides various compositions, further comprising:
DNA polymerase (Klenow Fragment,3 '. Fwdarw.5' exo) - ) For amplification and extension of the 3' end,
DNA polymerase buffer, and
dNTP。
the sequence of the oligodeoxynucleotide Apt-Pri of the composition of the invention is:
5′-ccaaggcctgcaagggaaccaaggacacagacctcacgaccattctgc；
the sequence of the oligodeoxynucleotide Ass-Pri of the composition of the invention is:
ctaacaattatcactgggtcgtgaggt；
the sequence of the oligodeoxynucleotide LOOP of the composition of the invention is as follows:
gtacggcagaatcagtgataattgttagaagaaaaaaaaatcccaacccgccctaccct；
the sequence of the oligodeoxynucleotide MB of the composition of the present invention is:
cgctctcccaacccgccctagagcg。
in the composition of the invention, the detected target cells are mesenchymal stem cells, and the membrane protein is CD44.
The composition of the invention can also be used for carrying out ectopic fluorescent quantitative analysis on the mesenchymal stem cell membrane protein CD44, and the method comprises the following steps:
firstly, a mixture of Apt-Pri, ass-Pri and Loop is heated for 5 minutes at 95 ℃ in a buffer solution (such as phosphate buffer solution PBS) to denature the mixture, and then the mixture is cooled to room temperature to complement the mixture into a DNA three-body complex structure;
thereafter, to prevent endocytosis of the aptamer, 100 μm chlorpromazine hydrochloride (CPM) was added to the medium and incubated with the cells in a carbon dioxide thermostatic cell incubator for 30 minutes;
next, the CPM-containing medium was gently washed twice with buffer, and then 100. Mu.L of RCA reaction buffer containing 150nM DNA triplex complex (i.e., 2. Mu.L of 10mM dNTPs, 2. Mu.L of 5U/. Mu.L of DNA polymerase, 10. Mu.L of 10 Xpolymerase reaction buffer, 5. Mu.L of 10. Mu.M molecular beacon and 81. Mu.L of DMEM) and cells were incubated for 2 hours;
finally, collecting the supernatant to detect the fluorescence signal intensity, thereby realizing the ectopic fluorescence quantitative analysis of the target cell membrane protein.
The composition is used for carrying out nondestructive analysis on the mesenchymal stem cell membrane protein CD44, and the method comprises the following steps:
firstly, a mixture of Apt-Pri, ass-Pri and Loop is heated for 5 minutes at 95 ℃ in a buffer solution (such as phosphate buffer solution PBS) to denature the mixture, and then the mixture is cooled to room temperature to complement the mixture into a DNA three-body complex structure;
thereafter, to prevent endocytosis of the aptamer, 100 μm chlorpromazine hydrochloride (CPM) was added to the medium and incubated with the cells in a carbon dioxide thermostatic cell incubator for 30 minutes;
then, incubating an aptamer-protein binding buffer containing 150nM DNA trisomy complex and cells at 37 ℃ for 60 minutes to realize qualitative analysis of in situ imaging of target cell membrane proteins;
then, washing off an aptamer-protein binding buffer solution by using PBS, adding an RCA reaction buffer solution and incubating cells for 2 hours, and collecting supernatant to detect the fluorescence signal intensity so as to realize quantitative analysis of ectopic fluorescence of target cell membrane proteins;
finally, the analyzed cells were subjected to Western blotting (Western Blot) and CCK-8 (Cell Counting Kit-8) assays to detect changes in membrane protein expression and cell activity.
Finally, the target cell membrane protein is subjected to full-nondestructive analysis.
The technical scheme of the invention has the beneficial effects that:
the detection composition adopts a three-body complex formed by DNA complementation and target membrane protein combination, and a Rolling Circle Amplification (RCA) mediated signal amplification system to realize in-situ imaging qualitative and ectopic fluorescent quantitative analysis of target cells in a sample.
The detection composition can select the aptamer of different target cell membrane proteins according to the detection requirement, and can be applied to the analysis and detection of different target cell membrane proteins by selecting the characteristic membrane proteins, so that the detection composition has good universality.
Based on the composition provided by the invention, the experimental operation is convenient, the full nondestructive analysis of cells and membrane proteins thereof can be realized, and the composition can be widely applied to the fields of clinical diagnosis, disease monitoring and the like.
Drawings
FIG. 1 is a schematic diagram of the principle of the composition of the present invention for non-destructive analysis of mesenchymal stem cell membrane proteins;
FIG. 2 is a graph of different cells imaged under a confocal laser scanning microscope;
FIG. 3 shows the quantitative results of membrane proteins analyzed by cell number;
FIG. 4 is a graph showing the results of protein expression measurements by Western blotting;
FIG. 5 is a graph showing the results of measurement of cell activity by CCK-8 method.
Detailed Description
The technical scheme of the present invention is described in detail below with reference to the accompanying drawings. The embodiments of the present invention are only for illustrating the technical scheme of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalents may be made thereto without departing from the spirit and scope of the technical scheme of the present invention, which is intended to be covered by the scope of the claims of the present invention.
EXAMPLE 1 qualitative detection of mesenchymal Stem cell membrane proteins
The aptamer primer (Apt-Pri) was denatured by heating at 95℃for 5 minutes, and then cooled to room temperature to form a DNA secondary structure. 1X 10 of each dish was performed in a glass bottom confocal dish 5 Individual cells were seeded. For better adherent growth of cells, it was incubated in a carbon dioxide incubator at 37℃for 24 hours. To prevent endocytosis of the aptamer, 150 μl of 100 μM chlorpromazine hydrochloride was added to the medium and incubated with the cells in a carbon dioxide incubator for 30 minutes.
The chlorpromazine hydrochloride-containing medium was removed by washing twice with 1 XPBS, then 150. Mu.L of an aptamer-protein binding buffer (containing 1mg/mL Bovine Serum Albumin (BSA), 10v/v% Fetal Bovine Serum (FBS), 4.5g/L glucose and 5mM magnesium chloride (MgCl) containing 150nM aptamer primer (Apt-Pri) 2 ) Serum-free double antibody-containing high sugar medium (D)MEM, high Glucose)) and cells were incubated in a carbon dioxide incubator at 37 ℃ for 60 minutes. The medium containing the aptamer-protein binding buffer was removed by washing twice with 1 XPBS, and 1mL of PBS was added. Finally, imaging under a confocal laser scanning microscope, and realizing qualitative analysis of target cell membrane protein in-situ imaging, wherein the qualitative analysis is shown in fig. 2.
Example 2 quantitative detection of mesenchymal Stem cells
The principle of analyzing mesenchymal stem cell membrane protein by using the composition provided in the embodiment (such as Apt-Pri and the like) is shown in figure 1. The specific implementation mode is as follows:
the mixture of the aptamer primer (Apt-Pri), the auxiliary primer (Ass-Pri) and the circular DNA template (LOOP) was denatured by heating at 95℃for 5 minutes, and then cooled slowly to room temperature to complement it into a DNA three-dimensional complex structure. 1X 10 per Petri dish in 24 well plate 4 The individual cells were inoculated and incubated in a carbon dioxide incubator at 37℃for 24 hours in order to allow better anchorage of the cells. To prevent endocytosis of the aptamer, 150 μl of 100 μΜ chlorpromazine hydrochloride (CPM) was added to the medium and incubated with the cells in a carbon dioxide incubator for 30 minutes. CPM-containing medium (e.g., DMEM medium) was gently washed twice with 1 XPBS, and then 100. Mu.L of Rolling Circle Amplification (RCA) reaction buffer containing 150nM DNA triplex complexes, containing 2. Mu.L of 10mM deoxyribonucleoside triphosphates (dNTPs), 2. Mu.L of 5U/. Mu.LDNA polymerase, 10. Mu.L of 10 XPolymer reaction buffer, 5. Mu.L of 10. Mu.M Molecular Beacon (MB) and 81. Mu.L of 10% Fetal Bovine Serum (FBS) and double-resistant High-sugar medium (DMEM, high Glucose) and cells were incubated for 2 hours. Finally, the RCA reaction buffer solution is collected, and fluorescence signal intensity is detected by a fluorescence spectrophotometer, so that ectopic fluorescence quantitative analysis of target cell membrane proteins is realized. As can be seen from FIG. 3, the detection limit was 10 cells.
EXAMPLE 3 nondestructive analysis of mesenchymal Stem cell membrane proteins
First, three groups of mesenchymal stem cells, three groups of HepG2 and L02 were prepared, and the CD44 protein of the three cells of the first group was measured by Western Blot (Western Blot) assay. A first round of analysis was then performed on the second set of three cells according to the method described in example 2 above, and the cells after the end of the analysis were subjected to Western blot experiments. Then, the first round of analysis was performed on the second set of three cells by the means of example 2, and the cells after the analysis were placed in a carbon dioxide constant temperature cell incubator for continuous culture for 2 hours, and after the state was stabilized, the second round of analysis was performed by the method of example 2, and the cells after the analysis were subjected to western blotting test. The results are shown in FIG. 4: the cell membrane protein expression levels after the first and second rounds of analysis did not change significantly compared to the non-analyzed group, indicating that the analysis methods using the compositions of this example did not affect membrane protein expression.
EXAMPLE 4 influence of non-destructive analysis of mesenchymal Stem cell membrane proteins on cell Activity
Preparation of three groups of mesenchymal Stem cells, hepG2 and L02 cells, and 1×10 cells 4 The individual cells/well density was seeded in 96-well plates and, in order to allow better adherent growth of the cells, it was incubated for 24 hours in a carbon dioxide incubator at 37 ℃. Medium without any added reagent (Ab) and medium with cells (Ac) served as blank and control, respectively. The medium containing cells and subjected to total non-destructive analysis was used As an experimental group (As). After 48 hours of incubation, the first group of three cells was assayed using the CCK-8 method (Cell Counting Kit-8). A first round of analysis was then performed on the second set of three cells according to the method described in example 2 above, and the cells after the end of the analysis were assayed by CCK-8. Then, the first round of analysis was performed on the second set of three cells by the means of example 2, and the cells after the analysis were placed in a carbon dioxide constant temperature cell incubator for continuous culture for 2 hours, and after the state was stabilized, the second round of analysis was performed by the method of example 2, and the cells after the analysis were measured by the CCK-8 method. The results are shown in FIG. 5: the cell activity after the first and second rounds of analysis did not change significantly compared to the non-analyzed group, indicating that the assay method using the composition of this example did not affect cell activity.
The CCK-8 method comprises the following measurement steps: mu.LCCK-8 reagent was added to each well and cells were incubated continuously for 2h at 37 ℃. Finally, the OD value was assessed by absorbance measurement at 450nm by means of a microplate reader. The measurements were repeated three times and the cell viability was calculated as follows:
cell viability (%) = [ (As-Ab)/(Ac-Ab) ]x100%.
Sequence listing
<110> Zhang Yi
CHINA STEM CELL GROUP SHANGHAI BIOTECHNOLOGY Co.,Ltd.
CHONGQING STEM CELL TECHNOLOGY Co.,Ltd.
CHINA STEM CELL GROUP HAINAN BOAO AFFILIATED STEM CELL HOSPITAL Co.,Ltd.
SHANGHAI STEM CELL TECHNOLOGY Co.,Ltd.
SHAANXI STEM CELL TECHNOLOGY Co.,Ltd.
SOOCHOW STEM CELL TECHNOLOGY Co.,Ltd.
SANYA STEM CELL TECHNOLOGY Co.,Ltd.
<120> composition for quantitative analysis of mesenchymal stem cell membrane protein, method and application
<141> 2020-02-03
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 48
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
ccaaggcctg caagggaacc aaggacacag acctcacgac cattctgc 48
<210> 2
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
ctaacaatta tcactgggtc gtgaggt 27
<210> 3
<211> 59
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gtacggcaga atcagtgata attgttagaa gaaaaaaaaa tcccaacccg ccctaccct 59
<210> 4
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cgctctccca acccgcccta gagcg 25
Claims (4)
1. A method for quantitatively analyzing a target cell by a composition comprising the steps of:
firstly, heating a mixture of an aptamer primer, an auxiliary primer and a circular DNA template in buffer solution at 95 ℃ for 5 minutes to denature the mixture, and then cooling the mixture to room temperature to complement the mixture into a DNA three-body complex structure;
thereafter, to prevent endocytosis of the aptamer, 100 μm chlorpromazine hydrochloride was added to the medium and incubated with the cells in a carbon dioxide thermostatic cell incubator for 30 minutes;
next, the medium containing chlorpromazine hydrochloride was removed by washing gently with the buffer twice, and then 100. Mu.L of RCA reaction buffer containing 150nM DNA trisomy complex and cells were incubated for 2 hours;
finally, collecting the supernatant to detect the fluorescence signal intensity, so as to realize the ectopic fluorescence quantitative analysis of the target cell membrane protein;
the RCA reaction buffer contains 5. Mu.L of 10. Mu.M molecular beacon;
the composition comprises:
the aptamer primer shown in SEQ ID No. 1, the 5' -end of which is marked with a fluorescent group;
an auxiliary primer shown in SEQ ID No. 2;
a circular DNA template shown in SEQ ID No 3;
the 5 'and 3' ends of the molecular beacon shown in SEQ ID No. 4 are respectively modified with a green fluorescent group FAM and a quenching group BHQ.
2. The method of claim 1, wherein the fluorophore is Cy5.
3. The method of claim 1, wherein the RCA reaction buffer further comprises 2. Mu.L of 10mM dNTPs, 2. Mu.L of 5U/. Mu.L DNA polymerase, 10. Mu.L of 10 Xpolymerase reaction buffer and 81. Mu.L of DMEM.
4. Use of the method according to claim 1 for quantitative analysis of mesenchymal stem cell membrane protein CD44.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310241143.0A CN116148480A (en) | 2020-02-10 | 2020-02-10 | Compositions and methods for quantitative analysis of mesenchymal stem cell protein CD44 |
| CN202010085709.1A CN111257567B (en) | 2020-02-10 | 2020-02-10 | Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010085709.1A CN111257567B (en) | 2020-02-10 | 2020-02-10 | Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310241143.0A Division CN116148480A (en) | 2020-02-10 | 2020-02-10 | Compositions and methods for quantitative analysis of mesenchymal stem cell protein CD44 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111257567A CN111257567A (en) | 2020-06-09 |
| CN111257567B true CN111257567B (en) | 2023-05-30 |
Family
ID=70949236
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310241143.0A Pending CN116148480A (en) | 2020-02-10 | 2020-02-10 | Compositions and methods for quantitative analysis of mesenchymal stem cell protein CD44 |
| CN202010085709.1A Active CN111257567B (en) | 2020-02-10 | 2020-02-10 | Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310241143.0A Pending CN116148480A (en) | 2020-02-10 | 2020-02-10 | Compositions and methods for quantitative analysis of mesenchymal stem cell protein CD44 |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN116148480A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011235A (en) * | 2016-05-16 | 2016-10-12 | 南京大学 | Membrane protein analysis method based on DNA molecule cascade signal amplification |
| CN107929751A (en) * | 2017-11-20 | 2018-04-20 | 三峡大学 | A kind of foundation of medicine-carried system and synthetic method |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090117549A1 (en) * | 2006-07-18 | 2009-05-07 | Weihong Tan | Aptamer-based methods for identifying cellular biomarkers |
| WO2011068909A2 (en) * | 2009-12-01 | 2011-06-09 | Brigham And Women's Hospital, Inc. | Aptamer cell compositions |
-
2020
- 2020-02-10 CN CN202310241143.0A patent/CN116148480A/en active Pending
- 2020-02-10 CN CN202010085709.1A patent/CN111257567B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011235A (en) * | 2016-05-16 | 2016-10-12 | 南京大学 | Membrane protein analysis method based on DNA molecule cascade signal amplification |
| CN107929751A (en) * | 2017-11-20 | 2018-04-20 | 三峡大学 | A kind of foundation of medicine-carried system and synthetic method |
Non-Patent Citations (2)
| Title |
|---|
| A dual-functional microfluidic chip for on-line detection of interleukin-8 based on rolling circle amplification;Wanling Zhang 等;《Biosensors and Bioelectronics》;20180415;第102卷;第652-660页 * |
| 识别多种种属来源间充质干细胞核酸适配体的筛选及鉴定;郭晓华 等;《军事医学》;20170331;第41卷(第3期);第178-183、198页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111257567A (en) | 2020-06-09 |
| CN116148480A (en) | 2023-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2367280T3 (en) | METHODS TO EVALUATE PATHOLOGICAL STATES USING EXTRACELLULAR RNA. | |
| US10369162B2 (en) | Pharmaceutical composition including migratory factor for guiding pluripotent stem cells to damage | |
| JP5190654B2 (en) | Method for identifying mesenchymal stem cells using molecular markers and use thereof | |
| US10018633B2 (en) | Multi-aptamer-based, cell-specific, one-step tumor cell detection assays | |
| CN108430336A (en) | Circulating cells, the internal collection of protein and nucleic acid and Local Quantitative and signature analysis | |
| Young et al. | Muscle injury induces a transient senescence‐like state that is required for myofiber growth during muscle regeneration | |
| RU2760573C1 (en) | Set of oligonucleotide primers and fluorescently labelled probes for identifying the epigenetic markers of cervical cancer | |
| CN111257567B (en) | Composition for quantitatively analyzing mesenchymal stem cell membrane protein, method and application thereof | |
| CN111235155B (en) | Composition, method and application for qualitative analysis of mesenchymal stem cell membrane protein | |
| CN111239089B (en) | Method for nondestructive analysis of mesenchymal stem cell membrane protein | |
| KR101828812B1 (en) | Kit for Detecting Senescence of Stem cells | |
| JP7410023B2 (en) | Quantitative PCR probe | |
| KR101704828B1 (en) | Method for diagnosing inflammatory diseases through analysis of protein or gene of extracellular vesicle in a body fluid | |
| Keller et al. | On-slide detection of enzymatic activities in selected single cells | |
| JP7015510B2 (en) | Method to evaluate the degree of aging and kit for evaluating the degree of aging | |
| EP3009521B1 (en) | Marker for detecting proliferation and treatment capacities of adipose-derived stem cell cultured in medium containing egf or bfgf, and use thereof | |
| EP2843047B1 (en) | Nucleic acid detection method | |
| EP1693452B1 (en) | Method of estimating toxicity of drug | |
| KR102073597B1 (en) | Quality evaluation method of embryo, and biosensor system for quality evaluation | |
| CN105950746B (en) | The diagnosis and treatment target that RASL12 gene is shifted as lung squamous cancer | |
| US20220033887A1 (en) | High-throughput method for detecting chromosomal aberrations and/or telomere aberrations | |
| CN116716400A (en) | Double-catalysis hairpin self-assembled sequence group, kit and application thereof | |
| JP2012072063A (en) | Tumorigenicity test method of cell and tumor marker | |
| CN117630369A (en) | Accurate and sensitive tumor source exosome detection method based on double-parameter ortho-ligation reaction | |
| WO2018133222A1 (en) | Method for visually marking genomic site and application thereof in detection of cell and organism aging levels |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |