KR101828812B1 - Kit for Detecting Senescence of Stem cells - Google Patents

Abstract

The present invention provides a kit for detecting senescence of stem cells, a detection method, and a screening method of a cell senescence inhibitor. According to the present invention, there is provided a marker for detecting cell senescence, which is capable of determining the proliferative and differentiating ability of a stem cell, which is essential for stem cell treatment, and the cell senescence of the stem cell can be accurately detected using the marker.

Description

(Kit for Detecting Senescence of Stem cells)

The present invention relates to a kit for detecting cell senescence of stem cells.

As part of efforts to overcome the limitations of existing therapies for various intractable diseases, researches on regenerative medical cell therapy using stem cells aiming at recovery of original function by substituting and regenerating damaged cells have been actively conducted worldwide . In particular, mesenchymal stem cells among the various stem cells have self-renewal ability and differentiation ability to various tissues, and inhibit the immune rejection reaction. (1). In the present invention, the present invention relates to a method for the treatment of various diseases, which comprises administering a therapeutically effective amount of a compound of formula 3).

For the clinical application of mesenchymal stem cells, it is crucial to obtain as many cells as possible from a small number of stem cells through a series of in vitro culturing processes, and during this process, the characteristics of the stem cells are essential . However, in order to achieve this, it is necessary to cultivate in vitro for a long period of time. Unlike embryonic stem cells, extracorporeal proliferation is limited, and after a certain number of divisions, senescence occurs like normal somatic cells, And thus can have a significant impact on various aspects such as stem cell productivity and quality, therapeutic efficacy and safety (4-8).

Stem cell senescence has been noted as a major cause of cell proliferation and pluripotency, and stem cell proliferation and pluripotency in the production of stem cell therapy are directly related to the therapeutic efficacy of patients , The determination of senescence of stem cells is an absolute parameter in the development and production of stem cell therapy (9-12).

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

 Mundra V, Gerling IC, Mahato RI. Mesenchymal stem cell-based therapy. Mol Pharm. 2013 Jan 7; 10 (1): 77-89.  Wang S, Qu X, Zhao RC. Clinical applications of mesenchymal stem cells. J Hematol Oncol. 2012 Apr 30;  Parecade B, Milwid JM. Mesenchymal stem cells as therapeutics. Annu Rev Biomed Eng. 2010 Aug 15; 12: 87-117.  Stenderup K, Justesen J, Clausen C, Kassem M. Aging is associated with increased maximal life span and accelerated senescence of bone marrow stromal cells. Bone. 2003 Dec; 33 (6): 919-26.  Bonab MM, Alimoghaddam K, Talebian F, Ghaffari SH, Ghavamzadeha, Nikbin B. Aging of mesenchymal stem cells in vitro. BMC Cell Biol. 2006 Mar 10; 7:14.  Ryu E, Hong S, Kang J, Woo J, Park J, Lee J, Seo JS. Identification of senescence-associated genes in human bone marrow mesenchymal stem cells. Biochem Biophys Res Commun. 2008 Jul 4; 371 (3): 431-6.  Wagner W, Bork S, Horn P, Krunic D, Walenda T, Diehlmann A, Benes V, Blake J, Huber FX, Eckstein V, Boukamp P, Ho AD. Aging and replicative senescence have related effects on human stem and progenitor cells. PLoS One. Jun 9, 4 (6): e5846.  Wagner W, Ho AD, Zenke M. Different facets of aging in human mesenchymal stem cells. Tissue Eng Part B Rev. 2010 Aug; 16 (4): 445-53.  Wagner W, Bork S, Lepperdinger G, Joussen S, Ma N, Strunk D, Koch C. How to track cellular aging of mesenchymal stromal cells? Aging (Albany NY). 2010 Apr; 2 (4): 224-30.  Li J, Pei M. Cell senescence: a challenge in cartilage engineering and regeneration. Tissue Eng Part B Rev. 2012 Aug; 18 (4): 270-87.  Boyette LB, Tuan RS. Adult Stem Cells and Diseases of Aging. J Clin Med. 2014 Jan 21; 3 (1): 88-134.  Castorina A, Szychlinska MA, Marzagalli R, Musumeci G. Mesenchymal stem cell-based therapy as a potential treatment for neurodegenerative disorders: is the escape from senescence an answer? Neural Regen Res. 2015 Jun; 10 (6): 850-8.

The present inventors have made extensive efforts to find novel markers capable of accurately detecting the aging of stem cells useful for regenerative medical cell therapy. As a result, it was found that markers such as vitamin D binding protein (BP), adiponectin, EGF (epidermal growth factor) and FGF2 (fibroblast growth factor 2) Thereby completing the present invention.

Accordingly, an object of the present invention is to provide a kit for detecting cell senescence.

It is another object of the present invention to provide a method for detecting cellular senescence.

It is still another object of the present invention to provide a screening method of a cell senescence inhibitor.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a pharmaceutical composition comprising at least one selected from the group consisting of vitamin D BP (vitamin D binding protein), adiponectin, EGF (Epidermal Growth Factor) and FGF2 (Fibroblast Growth Factor 2) There is provided a kit for detecting senescence of stem cells comprising a nucleotide sequence, a sequence complementary to the nucleotide sequence, a fragment of the nucleotide, or an antibody or an aptamer that specifically binds to a protein encoded by the nucleotide sequence .

The present inventors have sought to find a novel marker capable of accurately detecting the cell senescence of stem cells useful for regenerative medical cell therapy. As a result, it was confirmed that vitamin D BP, adiponectin, EGF and FGF2 proteins secreted in cell culture medium of stem cells can accurately detect cell senescence.

As used herein, the term " cell senescence " refers to a state in which the cell has ceased to divide irreversible cells after a certain number of cleavage. Although cell senescence has decreased proliferation and division ability, it differs from cell death in that cell metabolism is maintained for a considerable period of time (Yoon Gye Sook, Molecular Cell Biology, Webzine 2011).

The marker of the present invention can be an indicator for cell senescence and can be used for detection of generation and development of cell senescence.

As used herein, the term " detection " means identifying the presence, absence or amount of one or more markers in a biological sample (e.g., a cell or cell culture fluid).

According to one embodiment of the present invention, the kit of the present invention is a microarray.

According to one embodiment of the present invention, the kit of the present invention is a gene amplification kit.

When the kit of the present invention is a microarray, the probe is immobilized on the solid-phase surface of the microarray. When the kit of the present invention is a gene amplification kit, it includes a primer.

The probe or primer used in the detection kit of the present invention has a sequence complementary to a nucleotide sequence selected from the group consisting of vitamin D BP, adiponectin, EGF and FGF2. The term " complementary " as used herein means having complementarity enough to selectively hybridize to the nucleotide sequences described above under any particular hybridization or annealing conditions. Thus, the term " complementary " has a different meaning from the term complementary, and the primers or probes of the present invention may include one or more mismatches mismatch < / RTI > sequence.

As used herein, the term " primer " refers to a primer that, under suitable conditions (i.e., four different nucleoside triphosphates and polymerization enzymes) in a suitable buffer at a suitable temperature, - means strand oligonucleotide. The suitable length of the primer is typically 15-30 nucleotides, although it varies with various factors such as temperature and use of the primer. Short primer molecules generally require lower temperatures to form a sufficiently stable hybrid complex with the template.

The sequence of the primer does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient if the primer has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer. Therefore, the primer in the present invention does not need to have a perfectly complementary sequence to the above-mentioned nucleotide sequence, which is a template, and it is sufficient that the primer has sufficient complementarity within a range capable of hybridizing to the gene sequence and acting as a primer. The design of such a primer can be easily carried out by a person skilled in the art with reference to the above-mentioned nucleotide sequence, for example, by using a program for primer design (for example, PRIMER 3 program).

As used herein, the term " probe " refers to a linear oligomer of natural or modified monomer or linkages and includes deoxyribonucleotides and ribonucleotides and can specifically hybridize to a target nucleotide sequence, Present or artificially synthesized. The probe of the present invention is preferably a single strand, and is an oligodioxyribonucleotide.

The nucleotide sequence of the marker of the present invention to be referred to in the preparation of the primer or probe can be confirmed by GenBank. For example, a vitamin D BP, one of the markers of the present invention, has a nucleotide sequence disclosed in GenBank accession No. NR_001017536 or NM_000583, adiponectin in GenBank accession number NR_046083, EGF in GenBank accession number NM_001963, FGF2 in GenBank accession number NM_002006, To design a primer or a probe.

In the microarray of the present invention, the probe is used as a hybridizable array element and immobilized on a substrate. Preferred gases include, for example, membranes, filters, chips, slides, wafers, fibers, magnetic beads or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries, as suitable rigid or semi-rigid supports. The hybridization array elements are arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bound by UV on a polylysine coating surface. In addition, the hybridization array element may be coupled to the gas through a linker (e.g., ethylene glycol oligomer and diamine).

On the other hand, the sample DNA to be applied to the microarray of the present invention can be labeled and hybridized with the array elements on the microarray. Hybridization conditions can be varied. The detection and analysis of the hybridization degree can be variously carried out according to the labeling substance.

The kit for detecting cell senescence of stem cells of the present invention can be carried out based on hybridization. In this case, a probe having a sequence complementary to the nucleotide sequence of the markers of the present invention described above is used.

Hybridization-based analysis may be performed using a probe hybridized to the nucleotide sequence of the markers of the present invention to determine whether or not the cancer is colon cancer.

The label of the probe may provide a signal to detect hybridization, which may be linked to an oligonucleotide. Suitable labels include fluorescent moieties (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent moieties, magnetic particles, (P ³² and S ³⁵ ), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), joins, substrates for enzymes, heavy metals such as gold and antibodies, streptavidin , Haptens with specific binding partners such as biotin, digoxigenin and chelating groups. Markers can be generated using a variety of methods routinely practiced in the art such as the nick translation method, the Multiprime DNA labeling systems booklet (Amersham, 1989) and the kaination method (Maxam & Gilbert, Methods in Enzymology , 65: 499 (1986)). The label provides signals that can be detected by fluorescence, radioactivity, color measurement, weighing, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, and nanocrystals.

The nucleic acid sample to be analyzed can be prepared using mRNA obtained from various biosamples.

According to an embodiment of the present invention, the raw sample is a stem cell. According to another embodiment of the present invention, the stem cell is a mesenchymal stem cell. According to another embodiment of the present invention, the mesenchymal stem cells are bone marrow-derived mesenchymal stem cells.

As used herein, the term " mesenchymal stem cells " refers to multipotent stromal cells capable of differentiating into various cell types such as osteoblast, chondrocyte, myocyte and adipocyte. cell (https://en.wikipedia.org/wiki/Mesenchymal_stem_cell). The mesenchymal stem cells of the present invention include all mesenchymal stem cells derived from bone marrow, adipose tissue, umbilical cord blood, umbilical cord, amniotic membrane, amniotic fluid, amniotic fluid fetus, and the like.

Instead of the probe, the cDNA to be analyzed may be labeled and subjected to a hybridization reaction-based analysis.

When a probe is used, the probe is hybridized with the cDNA molecule. In the present invention, suitable hybridization conditions can be determined by a series of procedures by an optimization procedure. This procedure is performed by a person skilled in the art in a series of procedures to establish a protocol for use in the laboratory. Conditions such as, for example, temperature, concentration of components, hybridization and washing time, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. The detailed conditions for hybridization are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization , Springer-Verlag New York Inc .; NY (1999). For example, high stringency conditions were hybridized at 65 ° C in 0.5 M NaHPO ₄ , 7% SDS (sodium dodecyl sulfate) and 1 mM EDTA, followed by addition of 0.1 x SSC / 0.1% SDS Lt; RTI ID = 0.0 > 68 C < / RTI > Alternatively, high stringency conditions means washing at < RTI ID = 0.0 > 48 C < / RTI > in 6 x SSC / 0.05% sodium pyrophosphate. Low stringency conditions mean, for example, washing in 0.2 x SSC / 0.1% SDS at 42 ° C.

After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. The hybridization signal can be carried out in various ways depending on, for example, the type of label attached to the probe. For example, when a probe is labeled with an enzyme, the substrate of the enzyme can be reacted with the result of hybridization reaction to confirm hybridization. Combinations of enzymes / substrates that may be used include, but are not limited to, peroxidases (such as horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis- Acetyl-3,7-dihydroxyphenox), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2) , 2'-Azine-di [3-ethylbenzthiazoline sulfonate]), o -phenylenediamine (OPD) and naphthol / pyronin; (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1-phosphate, and ECF substrate; alkaline phosphatase and bromochloroindoleyl phosphate; Glucose oxidase and t-NBT (nitroblue tetrazolium) and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate. Therefore, when the method of detecting cell senescence according to the present invention is carried out based on hybridization, specifically (i) hybridizing a probe having a sequence complementary to the nucleotide sequence of the marker of the present invention to a nucleic acid sample; (ii) detecting whether the hybridization reaction has occurred. By analyzing the intensity of the hybridization signal by the hybridization process, it is possible to judge whether or not the cell ages. That is, when the hybridization signal for the nucleotide sequence of the marker of the present invention in the sample is stronger than that of the normal sample (for example, primary stem cell), it is judged to be cell senescence.

As used herein, the term " early stem cell " means a stem cell of line 1 isolated from the human body.

According to an embodiment of the present invention, the kit for detecting cell senescence of stem cells of the present invention may be a gene amplification kit.

The term " amplification " as used herein refers to a reaction that amplifies a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. (LCR) (see, for example, A Laboratory Manual , 3rd Ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822) 17,18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA, WO 88/10315) (SEQ ID NO: 1), self-sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence primed polymerase chain reaction CP-PCR), U.S. Patent No. 4,437,975), random plasmids (AP-PCR), U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA), U.S. Patent No. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification (21,22), and loop-mediated isothermal amplification. (LAMP) 23, but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction chain reaction (IPCR), vectorette PCR and thermal asymmetric interlaced PCR (TAIL-PCR) have been developed for specific applications. For more information on PCR, see McPherson, MJ, and Moller, SG PCR . BIOS Scientific Publishers, Springer-Verlag New York Berlin, Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.

When the detection kit of the present invention is carried out using a primer, the gene amplification reaction is carried out to investigate the degree of expression of the nucleotide sequence of the marker of the present invention. Since the present invention analyzes the degree of expression of the nucleotide sequence of the marker of the present invention, the amount of mRNA of the nucleotide sequence of the marker of the present invention is examined in a sample (for example, a stem cell) to be analyzed and the nucleotide sequence And the like.

Therefore, in principle, the present invention uses a mRNA in a sample as a template and performs a gene amplification reaction using a primer that binds to mRNA or cDNA.

To obtain mRNA, total RNA is isolated from the sample. The isolation of total RNA can be carried out according to conventional methods known in the art (see Sambrook, J. et al., Molecular Cloning , A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001); Tesniere , C. et al, Plant Mol Biol Rep, 9:..... 242 (1991); Ausubel, FM et al, Current Protocols in Molecular Biology, John Willey & Sons (1987); and Chomczynski, P. et al Anal. Biochem. 162: 156 (1987)). For example, TRIzol can be used to easily isolate total RNA in a cell. Next, cDNA is synthesized from the separated mRNA, and this cDNA is amplified. Since the total RNA of the present invention is isolated from a human sample, it has a poly-A tail at the end of the mRNA, and the cDNA can be easily synthesized using the oligo dT primer and the reverse transcriptase using such a sequence characteristic ( reference: PNAS USA, 85: 8998 ( 1988); Libert F, et al, Science, 244:.... 569 (1989); and Sambrook, J. et al, Molecular Cloning A Laboratory Manual, 3rd ed Cold Spring Harbor Press (2001)). Next, the synthesized cDNA is amplified through gene amplification reaction.

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-stranded structure. Conditions suitable nucleic acid hybridization to form such double-stranded structure is Joseph Sambrook, such as, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, etc., Nucleic Acid Hybridization , A Practical Approach , IRL Press, Washington, DC (1985).

A variety of DNA polymerases can be used in the amplification of the present invention, including the " Clenow " fragment of E. coli DNA polymerase I, the thermostable DNA polymerase and the bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus furiosus (Pfu) .

When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component. It is required to provide the reaction mixture such that the desired degree of amplification can be achieved, such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reaction without changing the conditions such as the addition of reactants.

In the present invention, annealing is carried out under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary with environmental variables.

The cDNA of the nucleotide sequence of the thus amplified marker of the present invention is analyzed by a suitable method to investigate the degree of expression of the nucleotide sequence of the marker of the present invention. For example, the result of amplification reaction described above is subjected to gel electrophoresis, and the resulting band is observed and analyzed to examine the expression level of the nucleotide sequence of the marker of the present invention. Through such amplification reaction, when the expression of the nucleotide sequence of the marker of the present invention in the raw sample is higher than that of the normal sample (the early stem cell), it is judged to be cell senescence.

Therefore, when the method for detecting a cell senescence marker of the present invention is carried out based on an amplification reaction using cDNA, specifically (i) performing an amplification reaction using a primer annealed to the nucleotide sequence of the marker of the present invention; And (ii) analyzing the product of the amplification reaction to determine the degree of expression of the nucleotide sequence of the marker of the present invention.

According to one embodiment of the present invention, the present invention can be carried out by an immunoassay method, that is, an antigen-antibody reaction method. In this case, an antibody or an aptamer that specifically binds to the cell aging marker of the present invention described above is used.

The antibody used in the present invention is a polyclonal or monoclonal antibody, preferably a monoclonal antibody. Antibodies can be produced using methods commonly practiced in the art, such as the fusion method (Kohler and Milstein, European Journal of Immunology , 6: 511-519 (1976)), the recombinant DNA method (US Patent No. 4,816,56) Or phage antibody library methods (Clackson et al., Nature , 352: 624-628 (1991) and Marks et al . , J. Mol. Biol. , 222: 58, 1-597 (1991)). General procedures for antibody preparation are described in Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual , Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques , CRC Press, Inc., Boca Raton, Florida, 1984; And Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY , Wiley / Greene, NY, 1991, the disclosures of which are incorporated herein by reference. For example, the preparation of hybridoma cells producing monoclonal antibodies is accomplished by fusing an immortalized cell line with an antibody-producing lymphocyte, and the techniques necessary for this process are well known and readily practicable by those skilled in the art. Polyclonal antibodies can be obtained by injecting a protein antigen into a suitable animal, collecting the antiserum from the animal, and then separating the antibody from the antiserum using a known affinity technique.

When the method of the present invention is carried out using an antibody or an aptamer, the present invention can be carried out according to a conventional immunoassay method and used to detect cell senescence.

Such immunoassays can be performed according to various quantitative or qualitative immunoassay protocols developed in the past. The immunoassay format may include, but is not limited to, radioimmunoassays, radioimmunoprecipitation, immunoprecipitation, immunohistochemical staining, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hardwood analysis, sandwich analysis, flow cytometry, But are not limited to, fluorescent staining and immunoaffinity purification. Methods of immunoassay or immunostaining are described in Enzyme Immunoassay , ET Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology , Vol. 1, Walker, JM ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference.

For example, if the method of the present invention is carried out according to the method radioactive immunoassay, radioactive isotope is an antibody labeled (e.g., C ^14, I ^125, P ³² and S ³⁵⁾ of detecting the marker molecules of the present invention .

When the method of the present invention is carried out by an ELISA method, a specific embodiment of the present invention comprises the steps of (i) coating an unknown cell culture liquid (which is a cell sample lysate) to be analyzed onto the surface of a solid substrate; (Ii) reacting the antibody against the marker as a primary antibody with the cell culture liquid (which is a cell lysate); (Iii) reacting the result of step (ii) with an enzyme-conjugated secondary antibody; And (iv) measuring the activity of the enzyme.

Suitable as said solid substrate are hydrocarbon polymers (e.g., polystyrene and polypropylene), glass, metal or gel, and most preferably microtiter plates.

The enzyme bound to the secondary antibody may include an enzyme catalyzing a chromogenic reaction, a fluorescence reaction, a luminescent reaction, or an infrared reaction, but is not limited thereto. For example, an alkaline phosphatase,? -Galactosidase, Radish peroxidase, luciferase, and cytochrome P ₄₅₀ . In the case where alkaline phosphatase is used as an enzyme binding to the secondary antibody, it is preferable that the substrate is selected from the group consisting of bromochloroindole phosphate (BCIP), nitroblue tetrazolium (NBT), naphthol-AS -Bl-phosphate and ECF (enhanced chemifluorescence) are used. When horseradish peroxidase is used, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2'- Azine-di [3-ethylbenzthiazoline sulfonate]), o - phenylenediamine (OPD) and naphthol / pie Ronin, glucose oxidase and t-NBT (nitroblue tetrazolium) and m-PMS a substrate such as phenzaine methosulfate may be used All.

When the method of the present invention is carried out in a Capture-ELISA system, a specific embodiment of the present invention comprises the steps of (i) coating an antibody against a marker of the present invention as a capturing antibody on the surface of a solid substrate; (Ii) reacting the capture antibody with a cell sample; (Iii) a detection antibody (iii) which specifically binds to at least one protein selected from the group consisting of vitamin D BP, adiponectin, EGF and FGF2 detecting antibody; And (iv) measuring a signal originating from said label.

The detection antibody has a label that generates a detectable signal. The label may be a chemical (e.g., biotin), an enzyme (alkaline phosphatase,? -Galactosidase, horseradish peroxidase and cytochrome P ₄₅₀ ), a radioactive material (such as C ¹⁴ , I ¹²⁵ , P ³² and S ³⁵ ), fluorescent materials (e.g., fluorescein), luminescent materials, chemiluminescent materials and fluorescence resonance energy transfer (FRET). Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press, 1999.

In the ELISA method and the capture-ELISA method, measurement of the activity of the final enzyme or measurement of the signal can be performed according to various methods known in the art. Detection of such signals enables qualitative or quantitative analysis of the markers of the present invention. If biotin is used as a label, it can be easily detected by streptavidin. When luciferase is used, luciferin can easily detect a signal.

According to another variant of the invention, an aptamer which specifically binds to the marker of the invention can be used in place of the antibody. Aptamers are oligonucleic acid or peptide molecules, and the general contents of aptamers are described in Bock LC et al., Nature 355 (6360): 5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78 (8): 42630 (2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA. 95 (24): 142727 (1998).

Cell senescence can be detected by analyzing the intensity of the final signal by the above immunoassay procedure. That is, when the signal for the marker of the present invention is stronger than that of the normal sample in the sample, it is judged to be cell senescence.

The kit of the present invention may further include other components in addition to the above components. For example, when the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally comprise reagents necessary for PCR amplification, such as a buffer, a DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus Thermostable DNA polymerases obtained from Thermus filiformis , Thermis flavus , Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase joins and dNTPs. The kit of the present invention may be made from a number of separate packaging or compartments containing the above reagent components.

The markers of the present invention are biomolecules highly expressed in senescent stem cells. High expression of these markers can be measured at the mRNA or protein level. As used herein, the term " high expression " means that the degree of expression of a nucleotide sequence to be a target in a sample to be investigated is higher than that of a normal sample. For example, expression analysis methods conventionally used in the art, such as RT-PCR or ELISA methods (see Sambrook, J. et al., Molecular Cloning , A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001) In the case of expression analysis, it means that the expression is analyzed to be high. For example, when the markers of the present invention are highly expressed about 1.2-5.0 times as much as the initial stem cells, the cells are judged to be " high expression " in the present invention, do. For example, vitamin D BP (GenBank Accession Number: NM_000583) has a degree of expression of the nucleotide sequence of 2.0 to 5.0 times, 2.3 to 5.0 times, 2.6 to 5.0 times, 2.6 times to 4.7 times, 2.6 Fold to 4.4-fold, 2.6-fold to 4.1-fold, or 2.6-fold to 3.8-fold, respectively. Adiponectin (NR_046083) expresses the nucleotide sequence at 1.1 to 2.5 times, 1.3 to 2.5 times, 1.4 to 2.5 times, 1.4 to 2.3 times, 1.4 to 2.1 times , 1.4-fold to 1.9-fold, or 1.4-to-1.7-fold higher expression is judged as cell senescence. EGF (GenBank Accession Number: NM_001963) has a nucleotide sequence exhibiting 1.5 to 4.5 times, 1.8 to 4.5 times, 2.1 to 4.5 times, 2.4 to 4.5 times, 2.4 to 4.2 times Or 2.4 times to 3.9 times as high as that of the cells. FGF2 (GenBank Accession Number; NM_002006) has a nucleotide sequence of 2.0 to 5.0 times, 2.3 to 5.0 times, 2.6 times to 5.0 times, 2.6 times to 4.7 times, 2.6 times to 4.4 times , 2.6-fold to 4.1-fold or 2.6-fold to 3.8-fold higher expression is judged to be cell senescence (see Table 8).

According to an embodiment of the present invention, the stem cell is a mesenchymal stem cell. According to another embodiment of the present invention, the mesenchymal stem cells are bone marrow-derived mesenchymal stem cells.

According to another aspect of the present invention, there is provided a method for producing a stem cell, comprising the steps of: (i) culturing a stem cell of a mammalian animal selected from the group consisting of vitamin D binding protein (D BP), adiponectin, epidermal growth factor (EGF), and fibroblast growth factor 2 And detecting the expression of one kind of nucleotide sequence or protein. The present invention also provides a method for detecting senescence in a cell.

Since the detection method of the present invention is the same as that of the detection kit, the description common to both of them is omitted in order to avoid the excessive complexity of the present specification.

According to another aspect of the present invention, the present invention provides a method for screening a senescence inhibitor comprising the steps of:

(a) cells comprising at least one nucleotide sequence or protein selected from the group consisting of vitamin D BP (vitamin D binding protein), adiponectin, EGF (Epidermal Growth Factor) and FGF2 (Fibroblast Growth Factor 2) To a sample to be analyzed; And

(b) measuring the expression level of the nucleotide sequence or protein, and when the nucleotide sequence or protein is highly inhibited, the sample is determined to be a cell senescence inhibitor.

According to the method of the present invention, first, the sample to be analyzed is brought into contact with the cells containing the nucleotide sequence of the marker of the present invention. Preferably, the cell comprising the nucleotide sequence of the marker of the invention is a stem cell. The term " sample " used in referring to the screening method of the present invention means an unknown substance used in screening to check whether or not the expression amount of the marker of the present invention is affected. Such samples include, but are not limited to, chemicals, nucleotides, antisense-RNA, siRNA (small interference RNA) and natural extracts.

Next, the expression level of the marker of the present invention is measured in the sample-treated cells. Measurement of the expression level can be carried out as described above. When the high-stringency of the nucleotide sequence of the marker of the present invention is inhibited as a result of the measurement, the sample can be judged to be a cell senescence inhibitor.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a kit for detecting senescence of stem cells, a detection method, and a screening method of a cell senescence inhibitor.

(b) The present invention provides a marker for detecting cell senescence that can determine the proliferative and differentiating ability of stem cells essential for stem cell treatment.

(c) Using the marker of the present invention, cell senescence of stem cells can be accurately detected.

Figure 1 shows the subculture schedule of mesenchymal stem cells.
FIG. 2 shows the cumulative population doubling level of the mesenchymal stem cells after serial passage.
FIG. 3 shows the ability of the mesenchymal stem cells to differentiate into osteoblasts and adipocytes according to the continuous passage culture (M0401140106).
FIG. 4 shows the results of confirming cell senescence by continuous passage culture of mesenchymal stem cells (M0401140106) through SA-β-gal (Senescence-associated beta-galactosidase) staining.
FIG. 5 shows the result of confirming cell senescence by continuous passage culture of mesenchymal stem cells (M0401140113) through SA-β-gal (senescence-associated beta-galactosidase) staining.
FIG. 6 shows the result of confirming cell senescence by continuous passage culture of mesenchymal stem cells (M0401140210) through SA-β-gal (Senescence-associated beta-galactosidase) staining.
FIG. 7 shows the results of confirming cell senescence by continuous passage culture of mesenchymal stem cells (M0401140213) through SA-β-gal (Senescence-associated beta-galactosidase) staining.
Figure 8 shows a graph quantifying the SA-beta-gal activity of donor cells by passage.
FIG. 9 shows the results of RT-PCR for the expression of aging-related genes Lamp1, LC3II, p16, p21 and p27 in the successive passage of mesenchymal stem cells (M0401140106).
Fig. 10 shows the results of RT-PCR analysis of the expression of the senescence-related gene in the successive passage of mesenchymal stem cells (M0401140113).
FIG. 11 shows the results of RT-PCR analysis of the expression of the senescence-related gene during the continuous passage of mesenchymal stem cells (M0401140210).
FIG. 12 shows the results of RT-PCR analysis of the expression of the senescence-related gene in the successive passage of mesenchymal stem cells (M0401140213).
13 shows the results of antibody analysis of cell culture medium of mesenchymal stem cells (M0401140106).
14 shows results of antibody analysis of cell culture medium of mesenchymal stem cells (M0401140113).
15 shows the results of antibody analysis of cell culture medium of mesenchymal stem cells (M0401140210).
16 shows the results of antibody analysis of cell culture medium of mesenchymal stem cells (M0401140213).
FIGS. 17A to 17J show quantitative changes in the amount of protein secreted from the antibody analysis results of the donor cell culture solution.
18 shows the secretion of vitamin D BP (vitamin D binding protein) upon cell senescence.
FIG. 19 shows the secretion amount of adiponectin according to cell senescence.
20 shows the secretion amount of FGF2 (Fibroblast Growth Factor 2) according to cell senescence.
21 shows the secretion amount of EGF (Epidermal Growth Factor) according to cell senescence.
22 shows the secretion amount of VEGF (Vascular Endothelial Growth Factor) according to cell senescence.
23 shows the secretion amount of IGF-1 (Insulin-like Growth Factor 1) according to cell senescence.
24 shows the secretion amount of TGF-beta1 (Transforming Growth Factor beta 1) according to cell senescence.
25 shows the secretion amount of HGF (Hepatocyte Growth Factor) according to cell senescence.
FIGS. 26A to 26D show the results of analysis of the proliferation rate of the additional donor-specific mesenchymal stem cells for the screening of the selected aging markers.
FIGS. 27A to 27C show the secretion amount of vitamin D BP of the additional donor-specific mesenchymal stem cells. FIG.
FIGS. 28A to 28C show the secretion amount of adiponectin of the additional donor-specific mesenchymal stem cells.
29A to 29C show the secretion amount of EGF of the additional donor-specific mesenchymal stem cells.
30A to 30C show the secretion amount of FGF2 of the additional donor-specific mesenchymal stem cells.
FIGS. 31A to 31C show secretion amounts of VEGF in the mesenchymal stem cells of the additional donors.
FIGS. 32A to 32C show the secretion amount of IGF-1 of the additional donor-specific mesenchymal stem cells. FIG.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Induction of bone marrow-derived mesenchymal stem cell aging

Isolation and culture of bone marrow-derived mesenchymal stem cells

The donors of bone marrow-derived mesenchymal stem cells used for induction of aging are shown in the following Table 1:

Manufacturing number age gender M0401140106 73 female M0401140113 75 south M0401140210 75 female M0401140213 67 female

Bone marrow was collected from the pelvis of the donor and bone marrow aspirated from the pelvis, donated in a heparin-containing glass heptin tube, and transferred to the bone marrow aspirate (Dulbecco's Phosphate Buffered Saline, DPBS) After the addition, the mixed solution was slowly flowed over the same amount of Ficoll (HISTOPAQUE-1077) solution, followed by density gradient centrifugation at 2,000 rpm for 20 minutes to recover the mononuclear cell layer in the supernatant of the Ficoll upper layer. And centrifuged at 1,800 rpm for 5 minutes to collect only mononuclear cells. The recovered mononuclear cells were washed again with DPBS and suspended in DMEM medium containing 10% fetal bovine serum (FBS) and gentamicin (20 μg / ml) and inoculated into a culture vessel (T-75 flask) After culturing for 5 to 7 days in a 5% CO ₂ incubator, the cells were removed from the bottom of the container by replacing the cells with new medium. After the cells were further cultured, the colony of the mesenchymal stem cells, And suspended in DMEM medium and cultured in a new culture container (passage 0).

Induction of senescence of mesenchymal stem cells

In order to identify the senescence-related factors (aging markers) secreted by the mesenchymal stem cells, the cells were cultured under the same conditions (culture period, etc.) for each passage, and the cells were cultured in the conditioned medium The increase and decrease patterns should be compared. However, the method of subculturing the culture period to 3 or 4 days based on the condition that the cultured cells occupy 70-80% or more of the area of the culture container after cell inoculation after each passage, And it is impossible to quantitatively compare the secretory factors between cells. Therefore, the present inventors further cultured the mesenchymal stem cells in a continuous subculture by adjusting the incubation period to be the same regardless of the cell proliferation pattern in all the passages.

Specifically, 1 × 10 ⁶ cells were inoculated into a T-175 flask (culture medium: 30 ml), cultured, and the culture medium was changed for 2 and 4 days, and cultured for 3 Day, followed by subculture (Fig. 1). For quantitative comparison of secretory factors secreted by each cell line, the cell culture medium (MSC-conditioned medium) cultured for the last 3 days was frozen and stored for later analysis.

As a result of culturing the four donor MSCs from passage 1 to passage 15, the proliferation rate gradually decreased with increasing passage in all the cells. M0401140106 from passage 13 and M0401140113 from passage 14 (M0401140210), and M0401140213 (Strain 15), a marked reduction in the growth rate was observed (Fig. 2).

As the number of passages increases, the proliferation rate of mesenchymal stem cells gradually decreases, suggesting that aging is progressively induced.

Aging Cell Characterization

(A) Cell shape

Morphological changes in the induction of aging by continuous subculture are due to the fact that most of the cells in the early stage of culture have an elongated fusiform shape similar to the fibroblasts typical of mesenchymal stem cells, In the latter stage of culture, it became gradually larger and wider, and it was confirmed that fine protrusions and granules were formed. Cells cultured with a one - week incubation period were similarly increased in size and shape as the number of passages increased.

(B) Cell phenotype

Mesenchymal stem cells generally express CD105, CD73 and CD90 as specific surface antigens. Therefore, in this study, expression patterns of specific surface antigens CD105 and 1 CD73 by continuous subculture were analyzed by flow cytometry analysis using FITC conjugated anti-CD105 Antibody and PE-conjugated anti-CD73 Antibody ).

As a result, more than 99% of CD105 and CD73 positive cells were present in various donor cells of all passages. That is, it was confirmed that there was no change in the expression pattern of specific surface antigens of mesenchymal stem cells in the induction of aging by continuous subculture.

(C)

One of the typical features of mesenchymal stem cells is multipotency that can differentiate into osteocytes, adipocytes, chondrocytes and neurons on the test tube. Therefore, the present study confirmed the effect of continuous subculture on the differentiation ability of osteoblasts and adipocytes. The osteoblast differentiation was induced by differentiation of mesenchymal stem cells into differentiation medium (high concentration-glucose DMEM, 10% FBS, 100 U / ml penicillin, 100 / / ml streptomycin, 0.1 袖 M dexamethasone, 10 mM 棺 -glycerol phosphate, L-ascorbic acid] induced differentiation for 7-14 days and confirmed the differentiation by alkaline phosphatase staining. Adipocyte differentiation was induced by differentiation of mesenchymal stem cells into adipocyte differentiation induction medium [high-glucose DMEM, 10% FBS, 100 U / ml penicillin, 100 占 퐂 / ml streptomycin, 1 占 dexamethasone, 10 占 퐂 / (High glucose DMEM, 10% FBS, 100 U / ml penicillin, 0.5% fetal bovine serum) for 72 hours after induction of differentiation by culturing the cells for 72 hours with 0.5 mM methyl isobutyl-zanthine 100 ㎍ / ㎖ streptomycin 10 ㎍ / ㎖ insulin) for 24 h. Differentiation of adipocytes was induced by repeating the adipocyte differentiation induction medium and the adipocyte differentiation maintaining medium 3 times in total. The adipocyte differentiation was confirmed by lipid staining with oil red O.

After induction of differentiation into osteoblasts and adipocytes, osteoblast and adipocyte differentiation was observed in all donor cells. In particular, although differentiation was observed in cells of the later stage, which are presumed to be senescent cells, the ability to differentiate into cells gradually decreased as the number of cells in the early passage increased.

In the above results, there was no change in the expression pattern of the specific surface antigen in the successive passage of the mesenchymal stem cells. However, the proliferation rate decreased and the ability to differentiate into osteoblasts and adipocytes gradually decreased with increasing passage. In other words, it was confirmed that self-renewability and differentiation ability of mesenchymal stem cells are decreased during the induction of aging through continuous subculture.

Verification of bone marrow-derived mesenchymal stem cell senescence

Senescence-associated beta-galactosidase (senescence-associated beta-galactosidase)

In order to examine aging induction of mesenchymal stem cells by continuous subculture, the aging-related β-galactosidase (SA-β-gal), which is characteristically expressed in aging cells and is one of the well known aging markers The activity was confirmed using commercially available aging β-galactosidase staining kit (Cell signaling technology). As a result of SA-β-gal staining, it was confirmed that a few cells stained in all cells in the early passage of stem cells, and only a part of them stained in the stained cells. However, it was confirmed that cells that were positive for SA-β-gal staining increased as the passages were continuously increased according to the continuous culture, and most of the cells stained in the late passage where the cell proliferation was decreased (FIGS.

Next, SA-β-gal activity was quantitated and compared by passage (FIG. 3). Specifically, the cells in each passage were dissolved with M-PER (Mammalian Protein Extraction Reagent), and the reaction solution was added with the assay reagent for β-galactosidase for 30 minutes, and the reaction was stopped by adding an assay stop solution. And the activity was measured. As a result, SA-β-gal activity of all donor cells increased gradually with increasing passage and at least 3 times more than passage 1 in passage 15. These results are consistent with the SA-beta-gal staining results described above.

These results suggest that some of the cells in the early passages exhibit SA-β-gal staining, whereas all of the cells in the late passage through subsequent passages stain, and similarly, SA-β- gal activity was also increased, indicating that aging was induced in the cells at this stage as a whole.

Aging-related gene expression

In order to examine the induction of senescence of mesenchymal stem cells by continuous subculture, the expression patterns of genes whose expression increases with cell senescence were confirmed by RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) method. Autophagy is a highly regulated lysosome pathway that breaks down intracellular macromolecules and cell organelles, and is known to be activated during cellular senescence. We have confirmed the expression patterns of Lamp1 and LC3II, the major markers of childhood action. In addition, expression of p16, p21, and p27, which are CDK (cyclin dependent kinase) inhibitors, whose expression increases with aging, are also confirmed. Specifically, RNA was extracted from cells in each passage for each donor, and cDNA was synthesized with a cDNA synthesis kit (Gendepot). Starting from 5 minutes at 95 ° C using a primer as shown in Table 3 as a template, Sec, annealing temperature for each primer of 30 sec, and 72 ° C for 30 sec, respectively.

primer The sequence (5'-3 ') Annealing temperature
(° C) cycle Product size
(bp) GAPDH Forward ACCTGCCGCCTGGAGAAACC 62 25 383 Reverse GACCATGAGGTCCACCACCCTG P16 Forward CTTCCTGGACACGCTGGT 55 35 138 Reverse GCATGGTTACTGCCTCTGGT P21 Forward GGAAGACCATGTGGACCTGT 58 27 403 Reverse ATGCCCAGCACTCTTAGGAA P27 Forward AGTTCGGCTCTGTGAACACC 58 27 336 Reverse CCACAGTACTGCCACCACAC Lamp1 Forward AGAGACTGAAAACCTGTTTGGC 62 34 108 Reverse AAATGGCTGACATCCTACATGAC LC3II Forward ATGCCGTCCGAGAAGACCTTC 60 30 377 Reverse TTACACAGCCATTGCTGTC

As a result, the expression of the gene for the activation of the pituitary gland (Lamp1 and LC3II) and the CDK inhibitor gene (p16, p21 and p27) gradually increased with successive subculture in all donor cells. In each donor's late passage, It was confirmed that the gene expression was maximally increased (Figs. 9 to 12).

Screening of biomarkers related to aging of mesenchymal stem cells

Antibody analysis in cell culture under normal culture conditions

Proteome Profiler ™ human XL cytokine assay kit from R & D Systems was used to screen for age-related factors secreted by mesenchymal stem cells under normal culture conditions containing FBS. This assay kit can detect 102 human soluble proteins (cytokines, chemokines, growth factors, etc.) at the same time. When the membrane bound to the sample and the capture antibody is reacted at 4 ° C overnight, the protein in the sample is detected as a specific capture antibody Binding to an additional specific detection antibody to which biotin is bound and then to detect the protein by streptavidin-binding HRP that specifically binds to biotin. The so-called sandwich method has the advantage of being capable of detecting proteins more specifically than in analysis.

The incubation period was fixed for one week for each donor and each subculture under the same conditions. Antibody analysis was performed using the cell culture medium in which the cells were cultured for the last 3 days.

M0401140106 analysis of the cell cultures in passages 1, 5, 11 and 14 revealed that the proteins showed a quantitative change (decrease or increase of secretion) in the medium from the early passage to the late passage 13 and Table 3). Most of the proteins identified as quantitative changes were not detected in the early passage or were detected as low amounts, and the amount of secretion increased as the passage increased. On the other hand, VEGF (Vascular Endothelial Growth Factor) was increased in passage 5 compared to passage 1, but decreased in passage 11 and decreased in passage 14. In FGF7 (Fibroblast growth factor 7), the secretion amount was increased in passage 5 as compared to passage 1, but was not detected in passage 5.

The analysis results in passages 1, 5, 11 and 14 of M0401140113 also showed a similar pattern to M0401140106 (Fig. 14 and Table 4). In the case of VEGF, the amount detected was gradually decreased with increasing passage, and FGF-7 was detected only in passage 1 and not in the remaining passage. In addition, the amount of secreted proteins was increased as the number of passages was increased as in the case of M0401140106.

The results of analysis of M0401140210 showed that there were some differences in the proteins showing quantitative change from M0401140106 and M0401140113 results. However, in the case of adiponectin, EGF (epithermal growth factor), FGF2 and vitamin D BP The results were consistent with the increase in secretion. In addition, in the case of VEGF, the secretion amount decreased with increasing passage (Fig. 15 and Table 5).

The results of analysis of M0401140213 were not detected in passage 1 in the case of adiponectin, EGF, FGF2 and vitamin D BP as in the above-mentioned 3-lot results, but the results were increased as the passage was increased and the secretion amount was increased. Similarly, VEGF was consistent with a decrease in secretion in the late passages (Figure 16 and Table 6).

The results of the antibody analysis comparing the secretion pattern of protein in the cell cultures of the four donors showed that the secretion increased or decreased as the passage increased. The adiponectin, Vitamin D BP, which plays a role in binding and transporting vitamin D3 and vitamin D metabolites, and EGF and FGF2, which are involved in stem cell growth, were not detected or weakly detected in passage 1, Or 14), the amount of secretion increased sharply. On the other hand, the amount of secretion of VEGF involved in cell growth and angiogenesis gradually decreased in the late passage in which aging was induced compared to the early passage (Figs. 17A to 17E). In addition, EMMPRIN (CD147), which is involved in cancer and inflammation as an inducer of MMP (matrix metalloproteinase), FGF-19 involved in cell growth as one of the FGF-family, osteopontin affecting osteoblasts, PF4 platelet factor 4, and RBP4 (retinol binding protein 4) involved in cell cycle arrest. In addition, it was confirmed that the amount of protein secretion increased in the late passage when aging was induced (Figs. 17f to 17j ). Therefore, further experiments were conducted to confirm the applicability of these proteins as aging-related markers that could potentially determine aging of mesenchymal stem cells.

Microarray

A microarray was performed to confirm the results of aging - related Marcus clearing using the antibody assay in the cell culture medium of mesenchymal stem cells at gene expression level. Total RNAs were isolated from each of the cells in cultured passages 1, 5, and 14, and cDNAs were synthesized. Affinity gene expression patterns were confirmed using Affymetrix GeneChip® Human Gene 2.0 ST assay system. Samples were obtained from MS0401140106 cells using MSCs in subculture 1 (P1, early), 5 (P5, middle) and 14 (P14, late) How the genes of leaf stem cells are changed is analyzed by microarray.

As a result, the expression of adiponectin, EGF, FGF2 and vitamin D BP genes gradually increased in cells of passage 5 vs. passage 1 and passage 14, respectively, similar to the results of the above antibody analysis. Expression of adiponectin gene was increased by 1.15 times in passage 5 and 1.81 times in passage 14 cells. In the EGF gene, there was no difference in expression between passages 1 and 5, but in passage 14 cells, expression was 2.98 fold higher than passage 1. Expression of FGF2 gene was increased by 1.40 times in passage 5 cells compared with passage 1 and 3.11 times more in passage 14 than passage 1. Expression of vitamin D BP gene was increased by 1.56 times in passage 5 cells compared to passage 1 and by 3.18 times in passage 14 cells. In contrast, the expression of VEGF and RBP4 genes decreased in passage 5 and 14 compared to passage 1.

In order to confirm that these factors are potentially an aging-related marker that can determine the senescence of mesenchymal stem cells through antibody analysis and microarray results, the cell culture medium of each passage is used to determine the amount of secretion of each factor Respectively.

Gene ProbeID Gene Accession Gene Symbol P1 P5 / P1 P14 / P1 Gene Description UniGene ID Chromosome Adiponectin 16698122 NR_046083 ADIPOR1 One 1.49161 1.58247 adiponectin receptor 1 Hs.740387 chrl 16746696 ENST00000357103 ADIPOR2 One 1.04158 One adiponectin receptor 2 Hs.371642 chr12 16949397 ENST00000412955 ADIPOQ One 1.15808 1.81677 adiponectin, C1Q and collagen domain Hs.80485 chr3 EGF 16862721 NM_001410 MEGF8 One One One multiple EGF-like-domains 8 Hs.132483 chr19 16969729 NM_001963 EGF One 1.01234 2.98444 epidermal growth factor Hs.419815 chr4 17000724 ENST00000230990 HBEGF One 1.26395 2.71357 heparin-binding EGF-like growth factor Hs.799 chr5 17046135 ENST00000275493 EGFR One 1.64756 3.71482 epidermal growth factor receptor Hs.488293 chr7 FGF2 16970404 NM_002006 FGF2 One 1.40718 3.11808 fibroblast growth factor 2 (basic) Hs.284244 chr4 VEGF 16726311 NM_001243733 VEGFB One -1.11857 -1.24072 vascular endothelial growth factor B Hs.732095 chr11 16981730 NM_005429 VEGFC One -1.01365 -1.18045 vascular endothelial growth factor C Hs.435215 chr4 17009093 NM_001025366 VEGFA One -1.17461 -1.30461 vascular endothelial growth factor A Hs.73793 chr6 Vit D 16763764 NM_001017536 VDR One 1.48125 1.48125 vitamin D (1,25-dihydroxyvitamin D3) receptor Hs.524368 chr12 16976676 NM_000583 GC One 1.56498 3.18517 group-specific component (vitamin D binding protein) Hs.418497 chr4

ELISA

Proteins that are presumed to be aging-related markers identified in cell cultures of each donor by lineage, and proteins estimated to be related to aging through literature review were quantified with an ELISA kit from R & D system, Respectively.

(1) Vitamin D binding protein

In the cell cultures of passages 1, 2 and 3, quantitative determination of vitamin D BP was not common (less than 156 pg / ml). Although there was a difference in the number of passages that started to be quantified with the vitamin D BP ELISA kit for each donor, the amount of secretion gradually increased as the passages increased with successive subculture. In the passage 15 induced by aging, (Fig. 18).

(2) Adiponectin

In the case of adiponectin, quantification was not possible in cell culture solutions up to 10 passages (detection limit 62.5 pg / ㎖ or more), and secretory proteins were quantitated from the passage 11 or 12 by donor. And the secretion level in the passage 15 was maintained at a concentration of 1000 pg / ml (Fig. 19).

(3) FGF2

In the case of FGF2, quantitation was not possible in cell culture solutions up to 8 passages (detection limit exceeded 15.6 pg / ㎖), and secretory proteins could be quantified from 9 or 10 passages by donor. Although the amount of secretion was less than the amount of vitamin D BP and adiponectin previously identified, the amount of secretion gradually increased with the successive cultivation of the seedlings, and the amount of secretion gradually increased with the passage of the latter period. (Fig. 20).

(4) EGF

Similar to adiponectin and FGF2, EGF was not quantifiable in cell cultures up to late passage 10 (detection limit 3.91 pg / ㎖ or less), and secretory proteins could be quantified from passages 11 or 12 by donor. In the subsequent passage, the amount of secretion increased sharply, while the secretion amount in passage 15 remained above the concentration of 600 pg / ml (FIG. 21).

The increase in the concentration of vitamin D BP, adiponectin, FGF2 and EGF in the cell culture medium in the late passage in which aging is induced is similar to that of the increase in the spot intensity of each protein according to the increase in the passage observed in the antibody analysis. Therefore, it is presumed that these proteins are highly likely to be used as markers capable of determining senescence.

(5) VEGF

As in the case of the conventional antibody analysis, the secretion amount of VEGF gradually decreased as the passages were commonly increased in all donors, and the lowest concentration of VEGF in the cell culture medium was detected in passage 14 in which senescence was induced (FIG. 22). Therefore, there is a possibility that the decrease of the secretion amount of VEGF is a marker which can determine aging. However, M0401140106 cells showed an increase in the concentration of VEGF abruptly in the passages 5 and 11 during culture and then decreased thereafter, while the other donors were not prominent. However, the concentration of M0401140106 cells temporarily increased during culture And thus it is not suitable to use as an aging marker because it has a disadvantage that it is difficult to set the concentration of the aging judgment standard due to the deviation of the secretion amount.

(6) IGF-1, TGF-? 1 and HGF

Several studies have examined the secretion patterns of insulin-like growth factor-1 (IGF-1), TGF-β1 (Tumor growth factor-beta1) and hepatocyte growth factor (HGF) associated with cell senescence. In the case of IGF-1, there was a large deviation in the distribution of secretions without increasing tendency to increase or decrease secretion in all donor cells (Fig. 23). TGF-β1 secretion was increased in the cells of the late passage induced by aging compared to passage 1, but the change in the secretion level from the passage 1 to the passage before the passage began to be constantly increased, decreased or maintained for each donor There was no tendency (Fig. 24). HGF showed a tendency that the secretion amount was decreased in the cells of the late passage in which the senescence was induced compared to the passage 1 (FIG. 25), and in the case of one donor (M0401140113) In this passage 3, it was temporarily increased and then decreased. In the latter passage, the level of secretion was maintained to the level of passage 1. Therefore, it was confirmed that there was no relation between the secretion amount of these factors and aging.

In conclusion, the antibody analysis and ELISA results of each donor line of various donors confirm that the secretion of vitamin D BP, adiponectin, EGF and FGF2 is increased during the process of inducing aging through continuous subculture of mesenchymal stem cells And that these factors could be used as aging markers in the determination of aging. To date, no direct or indirect association of these factors with aging has been reported.

Verification of aging-related biomarkers

In order to verify whether aging-related biomarkers selected for vitamin D BP, adiponectin, EGF and FGF2 were related to actual aging, an additional 15 donor cells (Table 8) were subjected to continuous subculture to induce cell senescence And the amount of each secretion in the conditioned medium of each passage was confirmed by ELISA. The culture period for each group was fixed to 7 days in the same manner as described above, and the growth rate of all the cells decreased from the late stage to the late stage (Figs. 26a to 26d).

Manufacturing number age gender Manufacturing number age gender M07112014 37 south M06252014 40 south M08152014 49 female M09282014 72 female M09052014 59 south M09112014 46 south M08252014 55 south M09152014 75 female M10102014 41 south M09072014 49 south M09232014 67 south M141001104 45 south M102214 43 female M140927101 51 south M10062014 39 female

Similar to previous results, vitamin D BP, adiponectin, EGF, and FGF2 showed no secreted proteins in the early passage and were secreted as successive passages increased, while VEGF was reduced inversely, IGF-1 showed a large variation in secretion regardless of the increase of the passage. Specific details are as follows:

end. Vitamin D BP

As in the previous results, the presence of vitamin D BP in the cell culture started to be confirmed from 3-5 by donor, and the secretion increased gradually as the passageway increased and secreted to the maximum concentration in the cells of the last passage of all donors (Figs. 27A to 27C).

I. Adiponectin

The presence of adiponectin in the cell culture medium began to be confirmed from passage 5-9, which is somewhat later than the vitamin D BP, and thereafter, the secretion amount was increased as the passage increased, and the secretion was maximized in the cells of the last passage of all donors (Figs. 28A to 28C).

All. EGF

The presence of EGF in the cell culture medium was confirmed from passage 7-11, and it was confirmed that the amount of secretion gradually increased as the passageway was increased. Similarly, it was confirmed that secretion was maximized in the cells of the last passage of all the donors 29a to 29c).

la. FGF2

From the passage 6-11, the presence of FGF2 in the cell culture began to be confirmed. As with the other proteins, the secretion amount was increased as the passageways increased, and it was confirmed that the secretion was maximized in each of the cells in the last passages of all donors 30c).

la. VEGF and IGF-1

In the case of VEGF, contrary to the above factors, it was confirmed that the secretion amount gradually decreased with increasing passage (Figs. 31A to 31C). On the other hand, it was also confirmed that the amount of secretion decreased and then increased again in each donor. Similar to previous results, IGF-1 also showed a large variation such as increased or decreased secretion amount as the passage was increased (Figs. 32A to 32C).

In conclusion, we examined the secretion of vitamin D BP, adiponectin, EGF, and FGF2, which are presumed to be related to aging-related markers identified by previous antibody analysis and ELISA, in the sub-donors (15 patients) It was verified that the aging - related markers can increase the amount of secretion in the cell aging caused by the successive subculture of mesenchymal stem cells and thus determine the senescence.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Claims (13)

A nucleotide sequence complementary to the nucleotide sequence, a fragment of the nucleotide, or a nucleotide sequence of the nucleotide sequence of vitamin D binding protein (BP), adiponectin, EGF (epidermal growth factor) and FGF2 (Fibroblast Growth Factor 2) A kit for detecting senescence of stem cells, comprising each antibody or an aptamer that specifically binds to a protein encoded by the nucleotide sequence or protein, wherein the expression of the nucleotide sequence or protein is compared with a primary stem cell, Wherein the cell is judged to be senescent.
The kit according to claim 1, wherein the kit is a microarray.
The kit according to claim 1, wherein the kit is a gene amplification kit.
The kit according to claim 1, wherein the kit is an immunoassay kit.
The kit according to claim 1, wherein the stem cells are aging of mesenchymal stem cells.
6. The kit according to claim 5, wherein the mesenchymal stem cells are bone marrow-derived mesenchymal stem cells.
Stem cell aging comprising the step of detecting the expression of a nucleotide sequence or protein of vitamin D binding protein (BP), adiponectin, EGF (epidermal growth factor) and FGF2 (fibroblast growth factor 2) in stem cells senescence detection method, wherein the expression of the nucleotide sequence or protein is determined to be cell senescence when the expression of the nucleotide sequence or protein is highly expressed as compared with primary stem cells.
8. The method of claim 7, wherein the method is performed in a microarray manner.
8. The method of claim 7, wherein the method is performed by gene amplification.
8. The method of claim 7, wherein the method is performed in an antigen-antibody reaction mode.
8. The method of claim 7, wherein the stem cell is an aging of mesenchymal stem cells.
12. The method according to claim 11, wherein the mesenchymal stem cells are bone marrow derived mesenchymal stem cells.
A screening method of a stem cell senescence inhibitor comprising the steps of:
(a) contacting a sample to be analyzed with a cell containing a nucleotide sequence or protein of vitamin D BP (vitamin D binding protein), adiponectin, EGF (epidermal growth factor) and FGF2 (Fibroblast Growth Factor 2) ; And
(b) measuring the expression level of the nucleotide sequence or protein; and when the nucleotide sequence or protein is highly inhibited, the sample is judged to be a stem cell senescence inhibitor.

Images