CN111218443A - Method for synthesizing nucleic acid drug conjugates - Google Patents

Method for synthesizing nucleic acid drug conjugates Download PDF

Info

Publication number
CN111218443A
CN111218443A CN201811410067.7A CN201811410067A CN111218443A CN 111218443 A CN111218443 A CN 111218443A CN 201811410067 A CN201811410067 A CN 201811410067A CN 111218443 A CN111218443 A CN 111218443A
Authority
CN
China
Prior art keywords
nucleic acid
drug
primer
aptamer
drug conjugate
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811410067.7A
Other languages
Chinese (zh)
Other versions
CN111218443B (en
Inventor
谭蔚泓
王若文
孙洋
高飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Renji Hospital Shanghai Jiaotong University School of Medicine
Original Assignee
Renji Hospital Shanghai Jiaotong University School of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Renji Hospital Shanghai Jiaotong University School of Medicine filed Critical Renji Hospital Shanghai Jiaotong University School of Medicine
Priority to CN201811410067.7A priority Critical patent/CN111218443B/en
Publication of CN111218443A publication Critical patent/CN111218443A/en
Application granted granted Critical
Publication of CN111218443B publication Critical patent/CN111218443B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/513—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Abstract

The present invention relates to a method for synthesizing aptamer drug complexes. Specifically, the invention can realize the connection of one kind of medicine molecules to a plurality of kinds of medicine molecules by solid phase synthesis and fixed-point and quantitative introduction of the medicine molecules at the 5' tail end of the primer. Aptamer drug complexes can be synthesized in large quantities by performing amplification reactions (e.g., PCR) on a template (e.g., aptamer) and primers with drug molecules. The primers are shorter and easy to synthesize and separate, so that the yield is high, the cost is low, the batch-to-batch difference is small, and the controllability is high.

Description

Method for synthesizing nucleic acid drug conjugates
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to a method for synthesizing a nucleic acid medicine conjugate.
Background
There are currently reported various methods for the ligation of aptamers to drug complexes. Among them, covalent linkage is more often used.
In 2009, the Tan task group realizes covalent linkage of a drug Dox and a nucleic acid aptamer sgc8, and examines the activity of the drug Dox and the nucleic acid aptamer sgc8, and finds that the drug Dox can well target and specifically kill target cells CEM of the nucleic acid aptamer sgc8, and has no influence on the activity of NB4 cells.
The Rossi subject group in 2016 constructed a nucleic acid aptamer drug complex by the nucleic acid aptamer P19 targeting pancreatic cancer and gemcitabine, 5FdCMP, MMAE and DM1 respectively through covalent connection, and realizes targeted drug delivery and targeted treatment of pancreatic cancer.
The aptamer and the drug can also be connected in a non-covalent assembly mode, and in 2006, John task group realizes the targeted transportation of the drug by embedding the drug Dox into the aptamer A10.
In 2015, Tan group achieved targeted drug delivery by loading multiple doxs in aptamer sgc8 by means of construction of Nano-train.
In addition, the targeting delivery of the drug can also be realized by combining the targeting property of the aptamer through a nano material carrier.
In 2015, the Li topic group modified the aptamer through nanoparticles, loaded the photodynamic therapy drug, and used for photodynamic therapy of tumors.
The song group in 2018 is loaded in a drug Dox by constructing a nano-carrier through a liposome and a nucleic acid aptamer, and is used for targeted therapy of breast cancer.
The above-mentioned connection mode is complex in reaction, low in yield and poor in controllability. By the covalent linking method, only one drug molecule can be introduced into one end of the aptamer, and the reaction is relatively complex and the yield is not high. And the non-covalent embedding mode is easy to fall off the drug molecules, and the number of the drug molecules cannot be controlled. Through the mode of the nano-carrier, the nano-carrier needs to be prepared, the aptamer is modified, the reaction is complex, and the proportion and the efficiency of wrapping the drug molecules are not controllable.
In 2014, Tan task group connects 5FdU of a drug to an aptamer sgc8 through a solid phase synthesis reaction, so that a method for introducing a specific number of drug molecules on the aptamer at fixed points is realized, and the targeted controllable transportation of the drug is realized. However, solid phase synthesis itself is limited by the length of DNA, and as the length of DNA increases, the efficiency of synthesis decreases and the cost of synthesis increases. The synthesis of long-chain or bispecific aptamers by solid phase synthesis is disadvantageous because of the low synthesis yields and relatively high costs.
Therefore, there is a need in the art to develop a method for preparing aptamer drug complexes with high synthesis yield, low cost, and good controllability.
Disclosure of Invention
The invention aims to provide a method for preparing a nucleic acid aptamer drug complex with high synthesis yield, low cost and good controllability.
In a first aspect of the present invention, there is provided a method of preparing a nucleic acid drug conjugate, the method comprising the steps of:
(a) providing a first primer, wherein the structure of the first primer is shown in a formula I,
(X1)n-X2 (I)，
wherein "-" is a chemical bond or a linking element,
x1 is a drug molecule which is,
x2 is a matching region which is fully complementary to the nucleic acid to be amplified,
n is a positive integer not less than 1;
(b) in an amplification system, using the nucleic acid to be amplified as a template, and performing nucleic acid amplification by using the first primer, thereby obtaining a nucleic acid amplification product; and optionally
(c) Removing the antisense strand from the nucleic acid amplification product of step (b) to obtain the nucleic acid drug conjugate.
In another preferred example, the method further comprises the steps of: (d) mixing the nucleic acid drug conjugate in the step (c) with a pharmaceutically acceptable carrier to prepare the pharmaceutical composition.
In another preferred embodiment, the nucleic acid to be amplified is selected from the group consisting of: a nucleic acid aptamer or its complementary strand (or its antisense strand), siRNA, miRNA, mRNA, DNA, or a combination thereof.
In another preferred embodiment, the amplified nucleic acid amplification product is a double-stranded nucleic acid.
In another preferred embodiment, the antisense strand refers to the strand that does not contain (is not coupled to) a drug molecule, and the sense strand refers to the strand that contains (is coupled to) a drug molecule.
In another preferred embodiment, the sense strand is a nucleic acid drug conjugate.
In another preferred example, the nucleic acid to be amplified is an aptamer antisense chain, and the nucleic acid drug conjugate is an aptamer drug conjugate.
In another preferred embodiment, n is 1 to 10, preferably n is 1 to 8, and more preferably n is 1 to 4.
In another preferred embodiment, (X1)nLocated (or attached) at the 5' end of X2.
In another preferred embodiment, said (X1)nIs n identical (including identical and partially identical) or different drug molecules.
In another preferred embodiment, the molecular weight of said X1 is 100 to 4000, preferably 200 to 3000, more preferably 300 to 2500, more preferably 1000 to 2000.
In another preferred embodiment, the linking element is a dipeptide, such as Val-Cit.
In another preferred embodiment, the drug molecule and the matching region are linked by reaction of a thiol group with an amino group.
In another preferred embodiment, the length of the matching region is 10-50bp, preferably 15-30 bp.
In another preferred embodiment, each X1 is independently a drug molecule selected from the group consisting of: nucleic acid analogs, base analogs, alkaloids, herbal extracts, small molecule inhibitors, or other drug molecules.
In another preferred embodiment, n drug molecules X1 are covalently linked to the primer in tandem; or n drug molecules X1 are each independently covalently modified to be linked to the primer.
In another preferred embodiment, n drug molecules X1 are connected in series on the primer in the form of base analogues.
In another preferred embodiment, each X1 is independently a drug molecule selected from the group consisting of: 5FdUTP, 5F-dCTP, MMAE, camptothecin, or a Tyrosine Kinase Inhibitor (TKI).
In another preferred embodiment, each X1 independently is the drug molecule is an MMAE, camptothecin, or tyrosine kinase inhibitor.
In another preferred example, the nucleic acid drug conjugate is a nucleic acid aptamer drug conjugate, preferably a mono-specific nucleic acid aptamer drug conjugate, a bi-specific nucleic acid aptamer drug conjugate, or a multi-specific nucleic acid aptamer drug conjugate.
In another preferred example, the aptamer drug conjugate refers to a aptamer conjugated with a drug.
In another preferred example, the nucleic acid to be amplified is a complementary strand or an antisense strand of a nucleic acid aptamer.
In another preferred example, the nucleic acid aptamer is a monospecific nucleic acid aptamer, a bispecific nucleic acid aptamer, or a multispecific nucleic acid aptamer.
In another preferred example, the bispecific nucleic acid aptamer or the multispecific nucleic acid aptamer refers to a nucleic acid aptamer that can target two or more targets.
In another preferred example, the aptamer is a single aptamer, or a plurality (e.g., 2, 3, 4) of identical or different aptamers connected in series.
In another preferred example, in a plurality (e.g. 2, 3, 4) of identical or different aptamers connected in series, a nucleic acid connecting sequence between two adjacent aptamers is provided, and preferably, the length of the nucleic acid connecting sequence is 4-8.
In another preferred example, the nucleic acid aptamer targets (or specifically binds to) a target selected from the group consisting of: a protein, a sugar chain, or a combination thereof. For example, proteins aberrantly expressed on the surface of tumors, PTK7, EGFR, HER2, and the like.
In another preferred embodiment, step (a) comprises mixing (X1)nModified or synthesized at the 5' end of the matching region, preferably by solid phase synthesis or PCR synthesis.
In another preferred embodiment, the amplification system of step (b) further comprises a second primer, wherein the second primer is a normal primer or a primer with a label.
In another preferred embodiment, the marker comprises: biotin, sulfhydryl, his tags, or other labels for separation.
In another preferred embodiment, the nucleic acid amplification in step (b) is a PCR amplification (e.g., temperature-controlled PCR, isothermal PCR).
In another preferred embodiment, the molar ratio of the first primer to the second primer is C1/C2 ≥ 10, preferably C1/C2 ≥ 20, more preferably C1/C2 ≥ 100.
In another preferred embodiment, the label in the second primer is biotin.
In another preferred embodiment, step (c) further comprises: and (3) unwinding double chains, combining the double chains with agarose beads or magnetic beads marked with avidin through avidin-biotin, and separating antisense chains to obtain the nucleic acid drug conjugate.
In another preferred embodiment, the label in the second primer is a thiol group, and step (c) comprises isolating the antisense strand by gold particles.
In another preferred embodiment, the tag in the second primer is a His-tag, and step (c) comprises isolating the antisense strand by Ni-modified beads.
In another preferred embodiment, the unwinding of the double strand comprises treatment with an alkaline solution, or temperature control of the depolymerization and polymerization of the double strand (e.g., other temperature control device such as a microfluidic or water bath).
In another preferred example, step (c) further comprises desalting.
In another preferred example, the method further comprises the step of performing functional and effective detection on the obtained aptamer drug complex.
In a second aspect of the present invention, there is provided a kit for preparing a nucleic acid drug conjugate, the kit comprising a container, and, in the container:
(a) a first primer, the structure of which is shown in formula I,
(X1)n-X2 (I)，
wherein "-" is a chemical bond or a linking element,
x1 is a drug molecule which is,
x2 is a matching region which is fully complementary to the nucleic acid to be amplified,
n is a positive integer not less than 1;
(b) nucleic acid to be amplified; and optionally
(c) Other reagents for nucleic acid amplification.
In another preferred embodiment, the nucleic acid to be amplified is selected from the group consisting of: a nucleic acid aptamer or its complementary strand (or its antisense strand), siRNA, miRNA, mRNA, DNA, or a combination thereof.
In another preferred example, the (c) other reagent for nucleic acid amplification comprises a second primer, and the second primer is a normal primer or a primer with a label.
In another preferred embodiment, the marker comprises: biotin, sulfhydryl, his tags, or other labels for separation.
In another preferred embodiment, the kit further comprises reagents for isolating the antisense strand.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
Drawings
FIG. 1 shows a flow chart of PCR method for constructing aptamer drug complex.
FIG. 2 shows the results of agarose gel identification of aptamer drug complex ApDC 1.
FIG. 3 shows the results of mass spectrometric identification of aptamer drug complex ApDC 1.
FIG. 4 shows the results of flow-examining the binding ability of ApDC1 prepared in example 1 to normal cell NCM460(A) and tumor cell HCT116(B), in which the "NCM 460-control" group and the "HCT 116-control" group are negative controls for nucleic acid aptamers.
Figure 5 shows the results of Confocal validation of the ability of ApDC1 to recognize targets.
FIG. 6 shows the results of cell viability experiments to verify the efficacy of ApDC1 against normal NCM460(A) and tumor HCT116 (B).
Fig. 7 shows the result of agarose gel testing for the correctness of ApDC2 prepared in example 2.
FIG. 8 shows the results of flow cytometry for detecting the targeting of the bispecific nucleic acid aptamers to colon cancer cells HCT116(A) and lung cancer cells H460(B), wherein the "HCT 116-control" group and the "H460-control" group are negative controls for the nucleic acid aptamers.
Fig. 9 shows the results of flow-verifying the targeting of ApDC 2. Wherein, A is the combination of colon cancer cell HCT116, and B is the combination of lung cancer cell H460.
FIG. 10 shows the results of cell viability assay to verify the efficacy of ApDC2 on colon cancer HCT116(A) and lung cancer H460 (B).
FIG. 11 shows the correctness of ApDC3 in example 4 verified with agarose gel.
Fig. 12 shows the mass spectrometry analysis of the molecular weight of ApDC 3.
Fig. 13 shows the binding ability and targeting of ApDC3 to cells. Wherein, A is tumor cell HCT116, B is normal cell NCM460, and the NCM 460-control group and the HCT 116-control group are negative controls of the aptamer.
Fig. 14 shows the toxicity and selectivity of ApDC3 for cells. Wherein, A is normal cell NCM460, and B is tumor cell HCT 116.
Detailed Description
The present inventors have made extensive and intensive studies and, for the first time, have developed a method for preparing an aptamer drug complex. The invention can introduce the drug molecules into the 5' end of the primer in a fixed point and quantitative manner through solid phase synthesis, and can realize the connection of one drug molecule to a plurality of drug molecules. Aptamer drug complexes can be synthesized in large quantities by performing amplification reactions (e.g., PCR) on a template (aptamer) and primers with drug molecules. The primers are shorter and easy to synthesize and separate, so that the yield is high, the cost is low, the batch-to-batch difference is small, and the controllability is high. The present invention has been completed based on this finding.
Term(s) for
In order that the disclosure may be more readily understood, certain terms are first defined. As used in this application, each of the following terms shall have the meaning given below, unless explicitly specified otherwise herein. Other definitions are set forth throughout the application.
The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined.
As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….
The term "administering" refers to the physical introduction of the product of the invention into a subject using any of a variety of methods and delivery systems known to those skilled in the art, including intravenous, intramuscular, subcutaneous, intraperitoneal, spinal cord or other parenteral routes of administration, e.g., by injection or infusion.
Nucleic acid aptamers
As used herein, "nucleic acid aptamer," "aptamer," and "aptamer" are used interchangeably to refer to a nucleic acid sequence capable of binding to a particular target molecule, including DNA aptamers, RNA aptamers, aptamers of the hybrid type, or other types of aptamers. In addition, in the present invention, aptamers also include single-stranded and double-stranded forms, particularly single-stranded forms of aptamers. Preferably, the nucleic acid aptamer is as described in the first aspect of the invention.
First primer
As used herein, a "first primer" refers to a primer having a drug molecule attached to its 5' end, the first primer having a structure represented by formula I,
(X1)n-X2 (I)，
wherein "-" is a chemical bond or a linking element,
x1 is a drug molecule which is,
x2 is a matching region which is fully complementary to the nucleic acid to be amplified,
n is a positive integer not less than 1.
In another preferred embodiment, each X1 is independently a drug molecule selected from the group consisting of: nucleic acid analogs, base analogs, alkaloids, herbal extracts, small molecule inhibitors, or other drug molecules.
In another preferred embodiment, each X1 is independently a drug molecule selected from the group consisting of: 5FdUTP, 5F-dCTP, MMAE, camptothecin, Tyrosine Kinase Inhibitor (TKI), or a combination thereof.
In another preferred embodiment, each X1 independently is the drug molecule is an MMAE, camptothecin, or tyrosine kinase inhibitor.
Aptamer Drug complexes (Aptamer-Drug-conjugates, ApDC)
The aptamer-drug complex refers to a conjugate of a aptamer and a drug, and aims to improve targeting and reduce toxic and side effects of the drug.
In recent years, a great deal of research is carried out on targeted drug delivery, and researchers propose various targeting strategies to improve the targeting property of the drugs and reduce the toxicity of the drugs at present. While targeted delivery of the drug depends on the targeting element. The aptamer is a single-stranded DNA or RNA with high affinity, specificity and selectivity, and has the characteristics of easiness in synthesis, easiness in modification, small batch-to-batch difference, easiness in storage and transportation, low cost, low immunogenicity, strong tissue penetration capacity, easiness in activity recovery after thermal denaturation, and the like. Nucleic acid aptamers can be targeted to cells and even tissues. Research shows that the connection of the aptamer and the medicine can effectively improve the water solubility of the medicine, improve the targeting property of the medicine and reduce the toxic and side effects of the medicine on normal tissues.
There are currently reported various methods for the ligation of aptamers to drug complexes. Among them, covalent linkage is more often used. The aptamer and the drug can also be linked by non-covalent assembly. In addition, the targeting delivery of the drug can also be realized by combining the targeting property of the aptamer through a nano material carrier. However, the above-mentioned connection method is complicated in reaction, low in yield and poor in controllability. By the covalent linking method, only one drug molecule can be introduced into one end of the aptamer, and the reaction is relatively complex and the yield is not high. And the non-covalent embedding mode is easy to fall off the drug molecules, and the number of the drug molecules cannot be controlled. Through the mode of the nano-carrier, the nano-carrier needs to be prepared, the aptamer is modified, the reaction is complex, and the proportion and the efficiency of wrapping the drug molecules are not controllable.
In 2014, Tan task group connects 5FdU of a drug to an aptamer sgc8 through a solid phase synthesis reaction, so that a method for introducing a specific number of drug molecules on the aptamer at fixed points is realized, and the targeted controllable transportation of the drug is realized. However, solid phase synthesis itself is limited by the length of DNA, and as the length of DNA increases, the efficiency of synthesis decreases and the cost of synthesis increases.
The method for preparing the nucleic acid drug conjugate
The invention provides a preparation method of a nucleic acid drug conjugate with high synthesis yield, low cost and good controllability. Specifically, the method for preparing a nucleic acid drug conjugate is as described in the first aspect of the present invention.
In the present invention, a typical nucleic acid drug conjugate is prepared as follows:
as shown in figure 1, drugs are modified/synthesized on a primer, then a large amount of nucleic acid drug conjugates are obtained through PCR amplification reaction, double chains are untied through NaOH, an antisense chain is separated through streptavidin-labeled agarose beads by means of the affinity of streptavidin and biotin, the nucleic acid drug conjugates dissolved in NaOH are obtained, and pure nucleic acid drug conjugates can be obtained through desalting.
Besides the temperature-controlled PCR amplification method, a constant-temperature PCR method can also be adopted, namely, the reaction process of PCR can be realized under a certain temperature condition without heating and cooling. The PCR reaction itself is a temperature-controlled reaction depending on polymerase, and therefore, the isothermal PCR method also belongs to this category. Similar temperature-controlled reactions are achieved by other means, and it is also within this category to achieve large-scale amplification of DNA by enzymes.
The invention mainly utilizes the action of polymerase, realizes the depolymerization and polymerization of double chains by adjusting the temperature, and realizes the synthesis and mass amplification of nucleic acid drug conjugates. Other temperature control devices such as micro-fluidic or water bath can also realize the reaction.
The traditional method for synthesizing DNA is solid phase synthesis, but the efficiency of synthesizing long-chain DNA is low, and particularly, the cost is high when synthesizing medicaments or specially modified DNA. Compared with solid phase synthesis, the nucleic acid amplification method can quickly and efficiently synthesize DNA with any length.
The PCR technique, i.e., polymerase chain reaction, can obtain a large amount of products through a small amount of template reaction, and is a method for efficiently realizing large-scale DNA synthesis. The invention combines the advantages of solid phase synthesis, and can introduce drug molecules into the 5' end of the primer in a fixed point and quantitative manner through the solid phase synthesis. The primer molecule is short, and is easy to synthesize and separate, so that the yield is high and the cost is low. The synthesis of large-batch nucleic acid aptamer drug complexes can be realized through nucleic acid amplification reaction. Therefore, the preparation method has the advantages of high reaction efficiency, high yield, low cost, small batch-to-batch difference and high controllability.
The main advantages of the invention include:
1. can realize simple and controllable connection of various medicines
The invention can introduce the drug molecules into the tail end of nucleic acid (such as aptamer) in a fixed point and quantitative manner by solid phase synthesis of the primer. Can realize the connection of one kind to a plurality of medicine molecules, and the connection ratio is controllable. The primer molecule is shorter and easy to synthesize and separate, so the synthesis efficiency is high, the yield is high, the cost is low and the controllability is strong.
2. Can realize the batch preparation of nucleic acid drug conjugates
The invention can realize exponential multiple amplification by carrying out amplification reaction (such as PCR) on a template (such as aptamer) and a primer with drug molecules, thereby preparing aptamer drug complexes in batches, amplifying DNA with any length, and having high yield, low cost and small batch-to-batch difference.
3. Multiple repeated aptamers or combinations of different aptamers of a single aptamer can be constructed through sequence combination, the target-enhanced or cooperative target-delivered drugs are achieved, and the construction method is simple and efficient, low in cost and strong in controllability.
4. The aptamer drug complex prepared by the method has strong target specificity, has the same target binding capacity as the aptamer, has small toxic and side effects, and can effectively kill tumor cells.
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.
Example 1 aptamer drug Complex constructed by PCR
Aptamer drug complex constructed by PCR method
The drug used in this example was 5F uracil (drug 1), also known as 5FU (5 FdU or 5 FU). 5FdU is a base analog, and 5FdU is connected to the upstream primer by a PCR synthesis method to obtain the upstream primer of which the 5' end is connected with 5 FdU.
Aptamer-Drug complexes (ApDC) were constructed by PCR, as shown in FIG. 1. Wherein the template is aptamer sgc8 (aptamer 1), the PTK7 protein is targeted, and the sequence is TTTTTTATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA (SEQ ID NO: 3).
An upstream primer: 5 '-FAM-5 FdU5FdU5 FdU-TTTTTTATCTAACTGCTG-3' (SEQ ID NO: 1)
A downstream primer: 5 '-Biotin-TCTAACCGTACAGTATTT-3' (SEQ ID NO: 2)
The PCR system is as follows: 10 Xbuffer 100 u L, dNTP 80 u L, upstream and downstream primer each 300 u L, template 5 u L, Taq enzyme 5 u L, water make up to 1000 u L.
The reaction conditions are as follows:
95℃3min，95℃30s，44℃30s，72℃30s，72℃3min，4℃∞
50 cycles.
Then adding 300 mu L of streptavidin modified agarose beads into each 1ml of PCR product, incubating overnight at 4 ℃, washing the beads with 10ml of DPBS the next day, removing unbound nucleic acid, adding 500 mu L of 0.2M NaOH for denaturation for 3min, and centrifuging to obtain the supernatant, namely the product. And adding the product into a desalting column, desalting ions, and eluting with 1ml of ultrapure water to obtain the aptamer drug complex ApDC1 dissolved in water, wherein the aptamer drug complex ApDC1 can be freeze-dried for later use. The ApDC1 is a nucleic acid aptamer sgc8 with 5FdU coupled to the 5' end.
2. Aptamer drug complex identification
The molecular weight of ApDC1 prepared by the above method was first identified by agarose gel electrophoresis and found to be correct in size (FIG. 2). The molecular weight of ApDC1 was then identified by mass spectrometry, consistent with theoretical 15920 (FIG. 3), and the aptamer drug complex was therefore considered to be correctly constructed.
3. Functional Activity examination of aptamer drug complexes
First, the drug 5FdU alone and the aptamer sgc8 alone were used as controls by flow cytometry. The ApDC1 prepared by the method is examined for the binding capacity of the colon cancer cell HCT116 and the colon epithelial cell NCM460, so that the selectivity of ApDC1 is judged.
The results are shown in fig. 4, and for the tumor cell HCT116, the ApDC1 has the binding capacity equivalent to that of the aptamer sgc8 alone, and has no obvious binding to the normal cell NCM 460. The result shows that ApDC1 prepared by the method still retains the capability of combining the target, and the combining capability is equivalent to that of a single aptamer, the targeting specificity is good, and the toxic and side effects are small.
Further, the ability of the ApDC1 prepared by the above method to distinguish normal cells from tumor cells was observed by confocal microscopy. 10 ten thousand cells were seeded into a confocal dish, the medium was discarded the next day and washed with DPBS, 250nM, 500ul ApDC1 was incubated with the cells for 30 minutes at 4 ℃ and the DPBS washed for unbound aptamer.
As shown in FIG. 5, the ApDC1 bound well to HCT116, which is a tumor cell, but did not bind to NCM460, which is a normal cell.
Next, by a cytotoxicity experiment, 10000 cells were inoculated to a 96-well plate with the drug 5FdU alone and the aptamer sgc8 alone as controls, ApDC1 and 5F, sgc8 at different concentrations were added the next day, the medium was discarded after 48 hours, added to CCK-8 diluted with the medium, incubated at 37 ℃ for 0.5 to 1 hour, and the cell survival rate was calculated by measuring the absorbance value at 450nm with a microplate reader. ApDC1 prepared by the above method was examined for toxicity to tumor HCT116 cells and normal NCM460 cells to determine the selectivity and toxicity of ApDC.
As shown in FIG. 6, the ApDC1 can significantly inhibit the growth of HCT116 tumor cells, and can cause cell death at 2. mu.M without toxicity to normal cells. The results show that the toxicity of the aptamer drug complex prepared by the method is obviously enhanced compared with that of a single drug and the aptamer, and the aptamer drug complex has the advantages of selectivity on tumor cells, good targeting specificity and small toxic and side effects (figure 6).
Example 2 construction of bispecific nucleic acid aptamer drug complexes
In a similar manner as described above, two or even more fragments of aptamers are synthesized, separated by a few A or T bases, achieving bispecific to multi-targeting. The drug used in this example was 5F uracil as in example 1. The aptamer drug complex is constructed by a PCR method, and the process is shown in figure 1. The template is aptamer sgc8-R50, wherein sgc8 targets PTK7 protein and is highly expressed on the surfaces of leukemia and colon cancer cells, and R50 (aptamer 2) targets lung cancer cells, and the sequence is TTTTTTATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTTTTAAAGGGCGGGGGGTGGGGTGGTTGGTAGTTGTTTTTTCTGTTTC (SEQ ID NO.: 5).
An upstream primer: 5 '-FAM-5 FdU5FdU5 FdU-TTTTTTATCTAACTGCTG-3' (SEQ ID NO: 1)
A downstream primer: 5 '-Biotin-GAAACAGAAAAAACAAC-3' (SEQ ID NO.:4)
The PCR method and the purification method of the aptamer drug complex are the same as those in example 1, and ApDC2 is finally prepared.
The resulting bispecific ApDC2 was identified and functionally tested according to the same experimental protocol as in example 1, except that ApDC1 in example 1 was replaced with bispecific ApDC2 in this example.
The molecular weight of the ApDC2 prepared was identified by agarose gel electrophoresis, and the control was the bispecific nucleic acid aptamer sgc8-R50, which was found to be correct in size (FIG. 7). As shown in FIG. 8, the bispecific aptamer maintains the targeting of aptamer 1 to the colon cancer cell HCT116, and has stronger targeting to the lung cancer cell H460 than aptamer 2. As shown in fig. 9, ApDC2 has targeting effects similar to those of aptamer 1 and aptamer 2 on colon cancer cell HCT116 and lung cancer cell H460.
The drug effect of ApDC2 was verified by cytotoxicity experiments, and the result is shown in FIG. 10, ApDC2 can well inhibit the growth of colon cancer cell HCT116 and lung cancer cell H460.
Example 3PCR method for constructing aptamer drug complexes containing drugs
The drug of this example also includes 5FdC as a base analog, which can be ligated to the primer simultaneously with 5FdU for subsequent PCR to synthesize ApDC with two drugs.
Specifically, the synthesis of primer 5 '-FAM-5 FdU5FdU5FdC5 FdC-TTTTTTATCTAACTGCTG-3' (SEQ ID No.:1), and an additional downstream primer, can achieve tandem connection of two drugs to the same nucleic acid sequence. The specific implementation method is the same as that in the embodiment 1.
The result shows that the aptamer drug complex ApDC coupled with the 5FdC and 5FdU can target targets well and selectively, has good targeting specificity and small toxic and side effects, and effectively exerts the drug effects of the two drugs.
Example 4 construction of aptamer drug complexes containing macromolecular drugs
The drug used in this example was monomethyl auristatin E (MMAE) (drug 2), a tubulin inhibitor. In order to facilitate the reaction with the primer, the drug is a drug modified by maleic amide.
The template was aptamer sgc8, as in example 1.
An upstream primer: 5 'SH-FAM-TTTTTTATCTAACTGCTG-3' (SEQ ID NO: 1)
A downstream primer: 5 '-Biotin-TCTAACCGTACAGTATTT-3' (SEQ ID NO: 2)
The MMAE is connected with the upstream primer through the reaction of the maleimide on the medicine and the SH on the primer. The reaction condition is NHCl4Acetonitrile solution, room temperature 8 hoursThen (c) is performed.
The PCR method and the purification method of the aptamer drug complex are the same as those in example 1, and ApDC3 is finally prepared.
The prepared ApDC3 was identified and examined for functional activity in the same manner as in example 1, except that ApDC1 in example 1 was replaced with ApDC3 in this example.
The molecular weight of the ApDC3 prepared was identified by agarose gel electrophoresis, and the control was aptamer 1, which was found to be correct in size (FIG. 11). Further mass spectrometric analysis of the molecular weight of ApDC3 revealed it to be consistent with theoretical value (15990) (FIG. 12).
As shown in fig. 13, ApDC3 maintained good binding of aptamer 1 to tumor cell HCT116, but no binding to normal cell NCM 460.
The efficacy of ApDC3 was verified by cytotoxicity experiments, and the result is shown in FIG. 14, ApDC3 can inhibit the growth of HCT116, but not the growth of NCM460, which is a normal cell.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Shanghai university of traffic medical college affiliated renji hospital
<120> method for synthesizing nucleic acid drug conjugate
<130>P2018-0924
<160>5
<170>PatentIn version 3.5
<210>1
<211>18
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>1
ttttttatct aactgctg 18
<210>2
<211>18
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>2
tctaaccgta cagtattt 18
<210>3
<211>47
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>3
ttttttatct aactgctgcg ccgccgggaa aatactgtac ggttaga 47
<210>4
<211>17
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>4
gaaacagaaa aaacaac 17
<210>5
<211>76
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>5
cgccgggaaa atactgtacg gttagatttt ttaaagggcg gggggtgggg tggttggtag 60
ttgttttttc tgtttc 76

Claims (10)

1. A method of preparing a nucleic acid drug conjugate, comprising the steps of:
(a) providing a first primer, wherein the structure of the first primer is shown in a formula I,
(X1)n-X2(I)，
wherein "-" is a chemical bond or a linking element,
x1 is a drug molecule which is,
x2 is a matching region which is fully complementary to the nucleic acid to be amplified,
n is a positive integer not less than 1;
(b) in an amplification system, using the nucleic acid to be amplified as a template, and performing nucleic acid amplification by using the first primer, thereby obtaining a nucleic acid amplification product; and optionally
(c) Removing the antisense strand from the nucleic acid amplification product of step (b) to obtain the nucleic acid drug conjugate.
2. The method of claim 1, wherein n is 1-10, preferably n is 1-8, more preferably n is 1-4.
3. The method of claim 1, wherein each X1 is independently a drug molecule selected from the group consisting of: nucleic acid analogs, base analogs, alkaloids, herbal extracts, small molecule inhibitors, or other drug molecules.
4. The method of claim 1, wherein n drug molecules X1 are covalently linked in tandem to the primer; or n drug molecules X1 are each independently covalently modified to be linked to the primer.
5. The method of claim 1, wherein each X1 independently is a MMAE, camptothecin, or tyrosine kinase inhibitor.
6. The method of claim 1, wherein the nucleic acid drug conjugate is a nucleic acid aptamer drug conjugate, preferably a mono-specific nucleic acid aptamer drug conjugate, a bi-specific nucleic acid aptamer drug conjugate, or a multi-specific nucleic acid aptamer drug conjugate.
7. The method of claim 1, wherein step (a) comprises combining (X1)nModified or synthesized at the 5' end of the matching region, preferably by solid phase synthesis or PCR synthesis.
8. The method of claim 1, wherein the amplification system of step (b) further comprises a second primer, wherein the second primer is a normal primer or a primer with a label.
9. The method of claim 1, wherein the label in the second primer is biotin.
10. A kit for preparing a nucleic acid drug conjugate, the kit comprising a container, and within the container:
(a) a first primer, the structure of which is shown in formula I,
(X1)n-X2(I)，
wherein "-" is a chemical bond or a linking element,
x1 is a drug molecule which is,
x2 is a matching region which is fully complementary to the nucleic acid to be amplified,
n is a positive integer not less than 1;
(b) nucleic acid to be amplified; and optionally
(c) Other reagents for nucleic acid amplification.
CN201811410067.7A 2018-11-23 2018-11-23 Method for synthesizing nucleic acid drug conjugates Active CN111218443B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811410067.7A CN111218443B (en) 2018-11-23 2018-11-23 Method for synthesizing nucleic acid drug conjugates

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811410067.7A CN111218443B (en) 2018-11-23 2018-11-23 Method for synthesizing nucleic acid drug conjugates

Publications (2)

Publication Number Publication Date
CN111218443A true CN111218443A (en) 2020-06-02
CN111218443B CN111218443B (en) 2024-03-08

Family

ID=70813507

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811410067.7A Active CN111218443B (en) 2018-11-23 2018-11-23 Method for synthesizing nucleic acid drug conjugates

Country Status (1)

Country Link
CN (1) CN111218443B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114392358A (en) * 2022-01-06 2022-04-26 上海交通大学医学院附属仁济医院 Tumor-targeted aptamer drug conjugate
CN114681619A (en) * 2020-12-30 2022-07-01 上海交通大学医学院附属仁济医院 Aptamer compound based on Biotin-SA and application thereof
CN115990264A (en) * 2022-12-21 2023-04-21 中国科学院基础医学与肿瘤研究所(筹) PTK7 targeted aptamer coupled drug

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101942445A (en) * 2010-07-19 2011-01-12 谭蔚泓 Nucleic acid aptamer derivative and application thereof in preparation of medicament carrier
CN104974998A (en) * 2014-04-11 2015-10-14 中国中医科学院中医临床基础医学研究所 DNA double-chain separation method used for aptamer screening, aptamer screening method and new aptamer
CN105087593A (en) * 2014-05-12 2015-11-25 中国医学科学院基础医学研究所 HER2 nucleic acid aptamer and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101942445A (en) * 2010-07-19 2011-01-12 谭蔚泓 Nucleic acid aptamer derivative and application thereof in preparation of medicament carrier
CN104974998A (en) * 2014-04-11 2015-10-14 中国中医科学院中医临床基础医学研究所 DNA double-chain separation method used for aptamer screening, aptamer screening method and new aptamer
CN105087593A (en) * 2014-05-12 2015-11-25 中国医学科学院基础医学研究所 HER2 nucleic acid aptamer and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RUOWEN WANG等: "Automated Modular Synthesis of Aptamer–Drug Conjugates for Targeted Drug Delivery", 《JOURNAL OF THE AMERICAN CHEMICAL SOCIETY》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114681619A (en) * 2020-12-30 2022-07-01 上海交通大学医学院附属仁济医院 Aptamer compound based on Biotin-SA and application thereof
CN114681619B (en) * 2020-12-30 2023-08-29 上海交通大学医学院附属仁济医院 Aptamer complex based on Biotin-SA and application thereof
CN114392358A (en) * 2022-01-06 2022-04-26 上海交通大学医学院附属仁济医院 Tumor-targeted aptamer drug conjugate
CN115990264A (en) * 2022-12-21 2023-04-21 中国科学院基础医学与肿瘤研究所(筹) PTK7 targeted aptamer coupled drug

Also Published As

Publication number Publication date
CN111218443B (en) 2024-03-08

Similar Documents

Publication Publication Date Title
Limoni et al. Engineered exosomes for targeted transfer of siRNA to HER2 positive breast cancer cells
CN107469088B (en) Construction method for accurately identifying targeted nano-carrier based on DNA origami and application thereof
CN111218443B (en) Method for synthesizing nucleic acid drug conjugates
CN112933219B (en) Preparation method and application of DNA-polypeptide reversible covalent coupling molecule
CN110354268B (en) Aptamer, and annular bivalent aptamer-drug coupling system and application thereof
US20220202949A1 (en) Ligand-targeted cell conjugate (ltcc)-based anti-tumor immune cell, as well as preparation method and use thereof
Taskova et al. Synthetic nucleic acid analogues in gene therapy: an update for peptide–oligonucleotide conjugates
US20190209695A1 (en) Pharmaceutical Compositions for High-Capacity Targeted Delivery
WO2011072292A2 (en) Phase changing formulations of rna and rna derivatives
JP2011511776A (en) Cationic siRNA for RNA interference, synthesis and use
JP2016513089A (en) Functional DNA dendrimers for gene delivery into cells
WO2012173994A2 (en) Phase changing formulations of nucleic acid payloads
MXPA01012802A (en) Copolymers for the transfer of nucleic acids to the cell.
CN108239646B (en) Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer
CN112779261B (en) Aptamer combined with human B7-H4 protein, application thereof and detection method using aptamer
CN108084268A (en) A kind of kidney targeting small nucleic acids deliver polypeptide
CN116271078A (en) Synthesis method of targeted drug nCoVshRNA.2ACE2
CN110950931B (en) Polypeptide for specifically targeting triple negative breast cancer stem cells and application thereof
KR101484441B1 (en) Glycol Chitosan-Methyl Acrylate-Polyethyleneimine nanoparticle for Gene Delivery
CN104189920B (en) Gene composition h-R3/PAMAM siRNA for reversing multidrug resistance of tumors and application of gene composition
KR101445438B1 (en) A PAMAM Dendrimer Derivatives for Neucleotide delivery
WO2014030147A2 (en) Synthetic proteins based on dendrimers
US20240067960A1 (en) Non-viral delivery compositions and screening methods
CN111909933B (en) Aptamer of targeting cell surface antigen MFI2 protein and application
CN116019927B (en) Three-drug co-assembled carrier-free drug delivery system, and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant