CN104974998A - DNA double-chain separation method used for aptamer screening, aptamer screening method and new aptamer - Google Patents
DNA double-chain separation method used for aptamer screening, aptamer screening method and new aptamer Download PDFInfo
- Publication number
- CN104974998A CN104974998A CN201410142420.3A CN201410142420A CN104974998A CN 104974998 A CN104974998 A CN 104974998A CN 201410142420 A CN201410142420 A CN 201410142420A CN 104974998 A CN104974998 A CN 104974998A
- Authority
- CN
- China
- Prior art keywords
- ssdna
- aptamer
- library
- screening
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of biology and discloses a DNA double-chain separation method used for aptamer screening, an aptamer screening method and a new aptamer. The DNA double-chain separation method comprises the following steps: (1) neutralizing a FITC-ssDNA sub-library solution with an acid; (2) performing high-resolution agarose electrophoresis; and (3) separating the ssDNA sub-library and polluted sequences therein, cutting a target band in the ssDNA sub-library, and recycling the target band through a small-molecular-weight DNA purifying recycle kit. The aptamer screening method includes the steps of 1-1) preparing a random ssDNA library and a primer; 1-2) performing incubation and screening; 1-3) performing amplification; and 1-4) performing incubation to dsDNA and magnetic beads fixed with streptavidin, and adding an alkaline solution. The new aptamer in the invention has a nucleotide sequence represented as the Seq ID No.1 or the Seq ID No.2. In the invention, DNA double-chain separation efficiency is increased, pollution of the streptavidin and Biotin-ssDNA to the ssDNA sub-library is reduced, the cell survival status during the incubation and screening process is improved, and the successful rate of cell-SELEX is increased.
Description
Technical field
The present invention relates to biology techniques field, being specifically related to a kind of take cell as the separation method of DNA double chain and the screening method of aptamer and new aptamer in the nucleic acid aptamer screening process of target.
Background technology
Nucleic acid aptamer (aptamer) is single strain oligonucleotide (ssDNA or RNA) that obtained by phyletic evolution technology (Systematic evolution of ligands by exponential enrichment, the SELEX) screening of index concentration aglucon, energy specific combination target material.Nucleic acid aptamer and antibody function similar, but compared with antibody, nucleic acid aptamer has more advantages, as higher avidity and specificity, non-immunogenicity, can chemosynthesis, cost low, can chemical labeling, good stability, be easy to preserve.And the target material of nucleic acid aptamer is more extensive, comprises metal ion, amino acid, nucleic acid, polypeptide, protein, and extends to the mixture targets such as complete virion and cell from single target
[1].Therefore, nucleic acid aptamer is constantly applied to the aspects such as fundamental research, drug development, clinical application in recent years.Meanwhile, the triage techniques of nucleic acid aptamer also obtains development, and suitability, simplicity are constantly improved
[2].Take cell as the Methodology for Aptamer Selection of target, i.e. cell-SELEX, it is the cell-based screening technology grown up on former SELEX basis, this technology take viable cell as screening object, not needing the characterization of molecules understanding target cells in advance, carrying out by introducing non-target cell the nucleic acid aptamer that anti-sieve obtains specific recognition target cell.Its screening process mainly comprises following step
[3]: 1. build library: the single stranded oligonucleotide library that the stochastic sequence that external synthetic mesophase is 30-60nt, two ends are the fixed sequence program of 18-40nt; 2. hatch screening: hatched in this library and target cell, collect the nucleic acid with target specific combination, and then hatch with non-target cell, collect non-bind nucleic acid; 3. increase (PCR): pcr amplification is combined with target cell, while nucleic acid uncombined with non-target cell, obtain double-stranded DNA (dsDNA); 4. be separated: be separated dsDNA, obtain single stranded DNA (ssDNA) Ya Wenku, or transcribe and obtain the sub-library of RNA; 5. enrichment: repeat said process 5-20 circulation, some and target have the DNA of high-affinity and high specific or RNA molecule constantly to obtain enrichment; 6. clone identification: the enrichment condition of flow cytomery ssDNA, when enrichment acquires a certain degree, carries out cloning, check order and identifying.
Screen at cell-SELEX in the process of aptamer, be separated double stranded PCR products, obtain the rate-limiting step that the single stranded DNA Ya Wenku that can be used for follow-up screening is whole process
[4].At present, what be separated the most classical way of double stranded PCR products is biotin-streptavidin-paramagnetic particle method.The method utilizes the binding characteristic of vitamin H and streptavidin, and the method comprises: first synthesize forward primer and reverse primer, and reverse primer carries out vitamin H (Biotin) mark; Then, pcr amplification obtains biotin labeled dsDNA product, after dsDNA is concentrated and purified, hatch with the magnetic bead being fixed with streptavidin (Streptavidin), alkaline denaturation breaks the hydrogen bond between dsDNA, be fixed on after Biotin-ssDNA is combined with streptavidin on magnetic bead, another free ssDNA is then separated, as the Ya Wenku of follow-up screening
[5].But nearest research report shows, the method can break the interaction between streptavidin and vitamin H after alkaline denaturation, makes Biotin-ssDNA split away off, polluting the sub-library of ssDNA, there is annealing reaction and forms double-stranded DNA in the two again
[6].In addition, alkaline denaturation also can destroy the covalent linkage coupling between streptavidin and magnetic bead, and the streptavidin come off is mixed into ssDNA library, follow-up with the process of cell incubation in cause the gathering of cell, affect the survival condition of cell
[4,6].
Therefore, be necessary to improve traditional biotin-streptavidin-paramagnetic particle method, improve double-strand separation efficiency, reduction streptavidin and Biotin-ssDNA are to the pollution in the sub-library of ssDNA, improve the cells survival state of screening and hatching in process, improve the success ratio of cell-SELEX.
Summary of the invention
For above prior art present situation, the invention provides the separation method of DNA double chain in a kind of new nucleic acid aptamer screening process, and a kind of screening method of nucleic acid aptamer of improvement is provided further, the present invention introduces high resolving power agarose electrophoresis by obtain the sub-library of ssDNA at biotin-streptavidin-paramagnetic particle method after, further separation and purification is carried out to the sub-library of ssDNA, Ya Wenku after purifying continues on for follow-up cell-SELEX and screens, and can successfully screen cell-specific aptamer.
In aptamer screening process of the present invention, the separation method of DNA double chain, comprises the steps:
1) get the sub-library solution acid of luciferin (the FITC)-ssDNA obtained by biotin-streptavidin-paramagnetic particle method and alkaline denaturation to neutralize;
2) by step 1) in gained and rear solution carry out high resolving power agarose electrophoresis;
3) be separated the sub-library of ssDNA and polluted sequence wherein, cut the target stripe in the sub-library of ssDNA, reclaim test kit by small-molecular-weight DNA purifying and reclaim, to obtain final product.
The inventive method step 1) described in the FITC-ssDNA sub-library solution that obtains of biotin-streptavidin-paramagnetic particle method and alkaline denaturation can originate unrestricted, can be library, the FITC-ssDNA Asia solution that under the conventional laboratory conditions of this area, biotin-streptavidin-paramagnetic particle method and alkaline denaturation obtain.
As one of embodiment of the present invention, step 1 in described separation method) in acid be selected from hydrochloric acid or acetum; The concentration range of described acid is 50mM-300mM; The concentration of further preferably salt acid solution is 200mM.
As one of embodiment of the present invention, step 2 in described separation method) in the condition of high resolution agarose electrophoresis be: resolving power is 20-1000bp, and temperature is room temperature, and electrophoresis time is 30min-1hr, and voltage is 150-180v.
The inventive method step 3) in be separated the sub-library of ssDNA and polluted sequence wherein, described separation method can adopt the separation method of this area routine; Described step 3) in cut the target stripe in the sub-library of ssDNA, reclaim test kit by small-molecular-weight DNA purifying and reclaim, the technical approach of ability routine can be adopted to carry out; The present invention includes but be not limited to use ethidium bromide staining 10 minutes, under ultraviolet lamp, cutting the target stripe of FITC-ssDNA, reclaiming test kit by small-molecular-weight DNA purifying and reclaim.
As one of embodiment of the present invention, step 3 in described separation method) in small molecules purification kit be selected from the small molecule DNA purification kit of 20bp-100bp molecular weight ranges.
The present invention also provides a kind of screening method adopting the nucleic acid aptamer of separation method of the present invention, and described screening method also comprises the FITC-ssDNA sub-library solution obtained by biotin-streptavidin-paramagnetic particle method and alkaline denaturation and obtains according to the following steps:
1-1) prepare ssDNA pool, the forward primer of FITC mark and the reverse primer of Biotin mark;
1-2) get targeted cells and ssDNA pool is hatched, then collect the supernatant liquor containing the ssDNA be combined with targeted cells;
SsDNA and the non-target cell of 1-3) getting the combination of above-mentioned targeted cells are hatched, and collect and carry out pcr amplification with the uncombined ssDNA of non-target cell, obtain dsDNA;
1-4) get dsDNA to hatch with the magnetic bead being fixed with streptavidin, then add basic solution and get final product.
In the screening method of nucleic acid aptamer of the present invention, as one of embodiment, step 1-1 in described method) in ssDNA random library be selected from
5 '-ATCCAGAGTGACGCAGCA-40nt-TGGACACGGTGGCTTAGT-3 ' or
5’-GCAATGGTACGGTACTTCC-40nt-CAAAAGTGCACGCTACTTTGCTA-3’；
In the inventive method, as one of embodiment, the forward primer of described FITC mark is selected from:
5 ' primer: 5 '-FITC-ATCCAGAGTGACGCAGCA-3 ' or
5’-FITC-GCAATGGTACGGTACTTCC-3’；
In the inventive method, as one of embodiment, the reverse primer of described Biotin mark is selected from:
3 ' primer: 5 '-biotin-ACTAAGCCACCGTGTCCA-3 ' or
5’-biotin-TTAGCAAAGTAGCGTGCACTTTTG-3’；
In the screening method of nucleic acid aptamer of the present invention, as one of embodiment, step 1-2 in described method) middle targeted cells, those skilled in the art can select different targeted cells according to art technology general knowledge and different screening objects, its source is unrestricted, from commercially available, also can prepare voluntarily; Include but not limited to from Rat Mesenchymal Stem Cells; The source of described Rat Mesenchymal Stem Cells is unrestricted, can be commercially available, also can prepare; As one of embodiment of the present invention, described Rat Mesenchymal Stem Cells is further preferably by processing acquisition as follows: healthy adult rat is taken off neck and put to death, get femur and shin bone, appear medullary space under aseptic condition.Rinse medullary space with the low sugar DMEM nutrient solution containing 10%FBS and go out marrow, then marrow single cell suspension is made in piping and druming repeatedly, is directly inoculated in culturing bottle, puts 37 degree of incubators and cultivates; Further preferably change nutrient solution after 48 hours, within later every 3 days, change liquid 1 time;
The step 1-2 of aptamer screening method of the present invention) in, described non-target cell can select different non-targeted cells by those skilled in the art according to art technology general knowledge and different screening objects equally, its source is unrestricted, can from commercially available, also can prepare voluntarily.
Described non-targeted cell includes but not limited to rat hepatocytes system BRL-3A; As one of embodiment of the present invention, be preferably handled as follows: adopt the well-grown cell of cell dissociation buffer process without enzyme, according to 5 × 10
6be inoculated in culture dish, incubated overnight, can be used for library screening when cell grows to 95%.
In aptamer screening method of the present invention, as one of embodiment, step 1-3 in described method) in amplification (PCR) method of ability routine can be adopted to carry out, amplification condition can combine different screening object by those skilled in the art according to art technology general knowledge and different material be determined.As one of embodiment of the present invention, described amplification condition includes but not limited to: 94 degree of denaturation 3min, 94 degree of sex change 30s, 55-56 degree annealing 30s, and 72 degree extend 30s, and last 72 degree extend 5min.
In aptamer screening method of the present invention, institute step 1-4) in alkali include but not limited to sodium hydroxide; Described paper mill wastewater ranges preferably from 50mM-200mM;
In aptamer screening method of the present invention, as one of embodiment, described step 1-4) preferably comprise further: dsDNA is after evaporating pipe (Amicon Ultra-15centrifugal Filter-10k) is concentrated, with streptavidin-magnetic bead (Z5482, Promega) 40min-1hr is hatched at 37 DEG C, add 50mM-200mM NaOH solution and carry out alkaline denaturation 5-7 minute, get supernatant liquor and get final product.
As one of embodiment of the present invention, the screening method of aptamer of the present invention comprises:
(I) ssDNA library and primer is synthesized:
SsDNA library:
5’-ATCCAGAGTGACGCAGCA-40nt-TGGACACGGTGGCTTAGT-3’
5 ' primer: 5 '-FITC-ATCCAGAGTGACGCAGCA-3 ';
3 ' primer: 5 '-biotin-ACTAAGCCACCGTGTCCA-3 ';
(II) screening and amplification: hatched in ssDNA library and target cell, collects the nucleic acid with target cell specific combination, and then hatches with non-target cell, collect and the unconjugated nucleic acid of non-target cell.Pcr amplification is combined with target cell but nucleic acid uncombined with non-target cell, obtains double-stranded DNA (dsDNA).
(III) double-stranded DNA is separated: dsDNA and the magnetic bead (Z5482, Promega) 37 degree being fixed with streptavidin are hatched 1 hour.Add 200mM NaOH solution and carry out alkaline denaturation 7 minutes, break the interaction of hydrogen bond between dsDNA, be fixed on magnetic bead after Biotin-ssDNA is combined with streptavidin, free FITC-ssDNA is then separated.
To add in appropriate 100nM appropriate hydrochloric acid solution and after, high-resolution agarose electrophoresis (D615 is carried out in sub-for above-mentioned FITC-ssDNA library, Takara), voltage sets is 180V, electrophoresis time is 40 minutes, is again separated FITC-ssDNA and polluted sequence wherein (dsDNA).Ethidium bromide staining 10 minutes, cuts the target stripe of FITC-ssDNA under ultraviolet lamp, reclaim test kit (ZP205, Beijing Zoman Biotechnology, Co., LTD) reclaim by small-molecular-weight DNA purifying.
(IV) separating effect is detected: high resolving power electrophoresis detection aforesaid method is separated purity and the efficiency of ssDNA.Microscopic examination aforesaid method is separated the ssDNA that obtains to the impact of cell aggregation state.MTT detects aforesaid method and is separated the ssDNA that obtains to the impact of cells survival state.
(V) enrichment: repeat said process 5-20 circulation, some and target have the DNA of high-affinity and high specific or RNA molecule constantly to obtain enrichment.
(VI) detect enrichment degree: flow cytomery fluorescence intensity, judge the enrichment condition of the ssDNA be combined with target specificity
(VII) clone identification: when enrichment acquires a certain degree, carries out pcr amplification by ssDNA, and reclaim purifying and connect carrier T, screen through blue hickie, the multiple clone of random choose carries out checking order and flow cytometry.
The present invention also provides a kind of the inventive method that utilizes to obtain new nucleic acid aptamer, and described aptamer has following SEQ ID NO.1 or the nucleotide sequence shown in SEQ ID NO.2:
SEQ ID NO.1：
CTGGCTAGGCCTACGTAGTATTGCCCTGGTCAGTCCAGCG；
Its secondary structure as shown in Figure 4;
SEQ ID NO.2：
AACGGTGCATCTTAGGCTAGCGTCGAATGGACGTGCGTTC；
Its secondary structure as shown in Figure 5.
The DNA double chain separation method being applied to cell-SELEX of the present invention's improvement, PCR primer double-strand separation efficiency in cell-SELEX process can be improved, reduction streptavidin and Biotin-ssDNA are to the pollution of Ya Wenku, improve the method for the cells survival state of hatching in process, improve the purity in the sub-library of the ssDNA obtained, thus improve cell-SELEX be filtered into power.
Accompanying drawing explanation
Fig. 1: agarose electrophoresis result figure in embodiment 1.First swimming lane is 20bp DNA ladder; Second swimming lane is pure FITC-ssDNA library, is synthesized by the raw work in Shanghai; 3rd swimming lane is the FITC-ssDNA that modification method obtains; 4th swimming lane is the FITC-ssDNA that traditional method obtains; 5th swimming lane is the dsDNA that pure ssDNA library obtains through pcr amplification; Agarose concentration is 1.5%, and electrophoresis time is 40 minutes.
Fig. 2: in embodiment 1 different methods obtain single stranded DNA and cell incubation after microscopy results figure.The A microscopic examination figure that to be the microscopic examination figure after mescenchymal stem cell and pure ssDNA library are hatched, B be after ssDNA that mescenchymal stem cell cell and traditional method obtain hatches; C is the microscopic examination figure after ssDNA that mescenchymal stem cell and modification method obtain is hatched.Incubation time is 1 hour, and incubation temperature is 37 DEG C.
Fig. 3: the FITC-ssDNA of the FITC-ssDNA that in embodiment 1, mtt assay tests pure FITC-ssDNA, modification method obtains and traditional method acquisition is on the impact of cells survival state.The FITC-ssDNA that pure FITC-ssDNA, modification method obtain and the FITC-ssDNA concentration that traditional method obtains are respectively 20nM, 40nM, 80nM, 160nM, 320nM.
Fig. 4: the secondary structure of RNAstructure predicting candidate aptamer M1 in embodiment 1.
Fig. 5: the secondary structure of RNAstructure predicting candidate aptamer M2 in embodiment 1.
Fig. 6: the binding ability of flow cytomery candidate aptamer M1 and ssDNA library and target cell MSCs and non-target cell BRL-3A in embodiment 1.Aptamer M1 and ssDNA library all mark fluorophor FITC.Incubation time is 1 hour, and incubation temperature is 37 DEG C.
Fig. 7: the binding ability of flow cytomery candidate aptamer M2 and ssDNA library and target cell MSCs and non-target cell BRL-3A in embodiment 1.Aptamer M2 and ssDNA library all mark fluorophor FITC.Incubation time is 1 hour, and incubation temperature is 37 DEG C.
Embodiment
The present invention further illustrates the present invention by following experimental example, is applied in cell-SELEX process by above-mentioned modification method as one of embodiment, the present invention, screen a kind of can the aptamer of target mescenchymal stem cell, but the present invention is not limited to this.
Embodiment 1
1. experiment material:
The forward primer of 1.1ssDNA library, FITC mark and the reverse primer of Biotin mark:
SsDNA library:
5’-ATCCAGAGTGACGCAGCA-40nt-TGGACACGGTGGCTTAGT-3’
5 ' primer: 5 '-FITC-ATCCAGAGTGACGCAGCA-3 ';
3 ' primer: 5 '-biotin-ACTAAGCCACCGTGTCCA-3 '; By Shanghai, Sheng Gong bio-engineering corporation provides.
1.2 rats: rat used is 6 month female SD rats, buys in Beijing Vital River Experimental Animals Technology Co., Ltd..
The separation of 1.3 Rat Mesenchymal Stem Cells: healthy adult rat is taken off neck and put to death, get femur and shin bone under aseptic condition, appear medullary space.Rinse medullary space with the low sugar DMEM nutrient solution containing 10%FBS and go out marrow, then marrow single cell suspension is made in piping and druming repeatedly, is directly inoculated in culturing bottle, puts 37 degree of incubators and cultivates; Change nutrient solution after 48 hours, within later every 3 days, change liquid 1 time.
1.4 rat hepatocytes: BRL-3A, purchased from Chinese Academy of Sciences's cell bank, nutrient solution is the DMEM substratum of 10% foetal calf serum.
1.5 nutrient solutions: DMEM substratum and foetal calf serum are purchased from Gbico company.
1.6 flow cytometers: purchased from BD Immunocytometry Systems.
1.7CH inverted light microscope: purchased from Japanese Olympus company.
1.8PCR test kit (article No.: R011), DNA Marker (20bp DNA ladder (Dyeplus), article No.: 3420A) and sepharose (Agarose MS-6, article No.: D615) purchased from Dalian Takara company.
1.9 small-molecular-weight DNA purifying reclaim test kit (article No.: ZP205) purchased from BeijingZoman Biotechnology, Co., LTD.
The magnetic bead (article No.: Z5482) of 1.10 streptavidins is purchased from Promega company.
1.11 tetrazolium bromides (MTT, article No.: M2128) available from Sigma.
1.12PCR instrument purchased from American Perkin Elmer company.
1.13 ultraviolet gel imaging systems are purchased from Rio-Rad company.
1.14 evaporating pipes (Amicon Ultra-15centrifugal Filter-10k) are purchased from MerckMilipore company.
2. experimental technique:
The screening of 2.1 aptamers
Prepare above-mentioned ssDNA pool, the forward primer of FITC mark and the reverse primer of Biotin mark.
Adherent method is adopted to be separated Rat Mesenchymal Stem Cells.Healthy adult rat is taken off neck to put to death, get femur and shin bone under aseptic condition, appear medullary space.Rinse medullary space with the low sugar DMEM nutrient solution containing 10%FBS and go out marrow, then marrow single cell suspension is made in piping and druming repeatedly, is directly inoculated in culturing bottle, puts 37 degree of incubators and cultivates.Change nutrient solution after 48 hours, within later every 3 days, change liquid 1 time.
Selection Rat Mesenchymal Stem Cells is target cell, and rat hepatocytes system BRL-3A (ATCC) is non-target cell, adopts the well-grown cell of cell dissociation buffer process without enzyme, according to 5 × 10
6be inoculated in culture dish, incubated overnight, can be used for library screening when cell grows to 95%.
Digested by target cell, hatch 1 hour with random library under 37 degree of conditions, incubation buffer is for containing 1.0mM MgCl
2, the PBS of 0.1mg/ml yeast tRNA and 0.1mg/ml salmon sperm dna.
After hatching end, cell centrifugation is got off, add distilled water, 100 degree of heating in water bath 10 minutes, collect supernatant, in supernatant, screen containing the first round single stranded DNA be combined with target cell, for pcr amplification, prepare next round and screen Ya Wenku.
PCR reaction conditions is: 94 degree of denaturation 3min, 94 degree of sex change 30s, 56 degree of annealing 30s, and 72 degree extend 30s, and last 72 degree extend 5min.
PCR primer dsDNA is after evaporating pipe (Amicon Ultra-15centrifugal Filter-10k) is concentrated, with streptavidin-magnetic bead (Z5482, Promega) 1 hour is hatched at 37 degree, add 200mM NaOH solution and carry out alkaline denaturation 7 minutes, break the hydrogen bond between dsDNA, be fixed on after Biotin-ssDNA is combined with streptavidin on magnetic bead, the sub-library of free FITC-ssDNA is then separated.Get supernatant, add appropriate 100mM hydrochloric acid soln and neutralize.
High-resolution agarose electrophoresis (D615, Takara) is carried out in sub-for above-mentioned FITC-ssDNA library, and voltage sets is 180V, and electrophoresis time is 40 minutes, is again separated FITC-ssDNA and polluted sequence wherein (dsDNA).
Ethidium bromide staining 10 minutes, cuts the target stripe of FITC-ssDNA under ultraviolet lamp, reclaim test kit (ZP205, Beijing Zoman Biotechnology, Co., LTD) reclaim by small-molecular-weight DNA purifying.
2.2. detect
High resolving power electrophoresis detection traditional biological element-streptavidin-paramagnetic particle method is separated purity and the efficiency (Fig. 1) of ssDNA with improvement biotin-streptavidin-paramagnetic particle method.Find by contrasting with pure FITC-ssDNA and dsDNA, traditional biological element-streptavidin-paramagnetic particle method is separated the FITC-ssDNA obtained on electrophorogram, shows two bands, article one, the FITC-ssDNA position with pure is identical, another article identical with dsDNA position (the 4th swimming lane).Improvement biotin-streptavidin-paramagnetic particle method is separated the FITC-ssDNA obtained only a band, and position identical with pure FITC-ssDNA position (the 3rd swimming lane).
Detect the present invention to the impact of cell aggregation state
The ssDNA that the ssDNA that pure ssDNA observed respectively by microscope, traditional biological element-streptavidin-paramagnetic particle method is separated is separated with improvement biotin-streptavidin-paramagnetic particle method is on the impact (Fig. 2) of cell aggregation state.The ssDNA obtained by modification method can not cause cell aggregation, and the ssDNA obtained by traditional method can cause the gathering of cell.
Detect the present invention to the impact of cells survival state
MTT experiment test traditional biological element-streptavidin-paramagnetic particle method and improvement biotin-streptavidin-paramagnetic particle method are on the impact (Fig. 3) of cells survival state.Traditional method is separated the ssDNA obtained has larger impact to cells survival state, and the ssDNA that modification method obtains does not have a significant effect to cell state.
The enrichment of 2.3 aptamers
In order to reduce the loss in ssDNA library, only target cell is hatched in first round screening.Taking turns from second, introduce non-target cell after just sieving and bear sieved journey.Just sieving the process of hatching consistent with above-mentioned, in negative sieved journey, after hatching 1 hour under 37 degree of environment, collected by centrifugation supernatant, discards the sequence be combined with non-target cell.
Repeat said process 5-20 circulation, in order to obtain higher affinity and specific aptamer, along with the increase of screening wheel number, increase washing dynamics gradually, washing times is also increased to 5 times from 3 times, and washing time was increased to 5 minutes from 3 minutes.
Every several flow cytometer that recycles, enrichment condition is analyzed in screening process.Target cell and non-target cell are digested, carries out 37 degree with enriched library with it and hatch 1 hour.After PBS washes three times, add 400ul PBS re-suspended cell, flow cytometry analysis fluorescence intensity.When fluorescence intensity acquires a certain degree, stop screening.
The order-checking of 2.4 aptamers:
The Library PCR amplification be finally enriched to is become double-stranded DNA, and use Cloning Kit (Invitrogen, cat.no.K4500-01) to clone, screen through blue hickie, random choose multiple clone check order.
RNA structure software and DNAMAN software is used to carry out the analysis of primary sequence and secondary structure according to sequencing result.Trimmed sums qualification is carried out according to analytical results.Finally pick out two candidate's aptamer M1, M2, their primary sequences are respectively:
M1:CTGGCTAGGCCTACGTAGTATTGCCCTGGTCAGTCCAGCG (i.e. SEQ ID NO.1); M1 aptamer secondary structure as shown in Figure 4.
M2:AACGGTGCATCTTAGGCTAGCGTCGAATGGACGTGCGTTC (i.e. SEQ ID NO.2); M2 aptamer secondary structure as shown in Figure 5.
The detection of 2.5 binding abilities
M1 and the M2 aptamer of 200nM respectively with 2x10
5target cell (mescenchymal stem cell) and non-target cell (liver cell BRL-3A) 37 degree hatch 1h, centrifugally remove supernatant, then wash three times with PBS, finally by cell suspension in 400ul PBS damping fluid, the fluorescence intensity of flow cytomery cell.
The binding ability of candidate's aptamer M1 that flow cytomery FITC marks and target cell and non-target cell, the ssDNA of FITC mark is as negative control (Fig. 6).There is stronger fluorescence intensity after M1 and target cell hatch, after ssDNA library and target cell hatch, there is no obvious fluorescence.
The binding ability of candidate's aptamer M2 that flow cytomery FITC marks and target cell and non-target cell, the ssDNA of FITC mark is as negative control (Fig. 7).There is stronger fluorescence intensity after M2 and target cell hatch, after ssDNA library and target cell hatch, there is no obvious fluorescence.
Reference
[1].Tan W，Wang H，Chen Y，Zhang X，Zhu H，Yang C，Yang R，Liu C.Molecular aptamers for drug delivery.Trends Biotechnol.2011Dec；29(12)：634-40.
[2].Mencin N，
T，
M，Mavri J，Hren M，
a K，
P，Ulrich H,
B.Optimization of SELEX：comparison of differentmethodsfor monitoring the progress of in vitro selection of aptamers.JPharm Biomed Anal.2014Mar25；91：151-9.
[3].Sefah K，Shangguan D，Xiong X，O′Donoghue MB，Tan W.Development of DNA aptamers using Cell-SELEX.Nat Protoc.2010Jun；5(6)：1169-85.
[4].Marimuthu C，Tang TH，Tominaga J，Tan SC，Gopinath SC.Single-stranded DNA(ssDNA)production in DNA aptamer generation.Analyst.2012Mar21；137(6)：1307-15.doi：10.1039/c2an15905h.Epub2012Feb7.Review.
[5].Safarik I(1)，Safarikova M.Magnetic techniques for the isolation andpurification of proteins and peptides.Biomagn Res Techn0l.2004Nov26；2(1)：7.
[6].Paul A(1)，Avci-Adali M，Ziemer G，Wendel HP.Streptavidin-coatedmagnetic beads for DNA strand separation implicate a multitude ofproblems during cell-SELEX.Oligonucleotides.2009Sep；19(3)：243-54.
Claims (10)
1., for a separation method for DNA double chain in nucleic acid aptamer screening, it is characterized in that, described method comprises the steps:
1) get the sub-library solution acid of the FITC-ssDNA obtained by biotin-streptavidin-paramagnetic particle method and alkaline denaturation to neutralize;
2) by step 1) in gained and rear solution carry out high resolving power agarose electrophoresis;
3) be separated the sub-library of ssDNA and polluted sequence wherein, cut the target stripe in the sub-library of ssDNA, reclaim test kit by small-molecular-weight DNA purifying and reclaim, to obtain final product.
2. method according to claim 1, is characterized in that, step 1 in described method) in acid be selected from hydrochloric acid or acetum; The concentration range of described acid is 50mM-300mM; The concentration of preferred hydrochloric acid is 100mM.
3. method according to claim 1, is characterized in that, step 2 in described method) condition of described high resolution agarose electrophoresis is: resolving power is 20-1000bp, and temperature is room temperature, and electrophoresis time is 30min-1h, and voltage is 150-180v.
4. method according to claim 1, is characterized in that, step 3 in described method) in small molecules purification kit be the small molecule DNA purification kit of 20bp-100bp molecular weight ranges.
5. one kind comprises the screening method of the nucleic acid aptamer of the arbitrary described method of claim 1-4, it is characterized in that, described screening method also comprises the FITC-ssDNA sub-library solution obtained by biotin-streptavidin-paramagnetic particle method and alkaline denaturation and obtains according to the following steps:
1-1) prepare ssDNA pool, the forward primer of FITC mark and the reverse primer of Biotin mark;
1-2) getting targeted cells and ssDNA pool is hatched, then collecting the ssDNA containing being combined with targeted cells;
1-3) get the above-mentioned ssDNA that is combined with targeted cells and non-target cell is hatched, collect and carry out pcr amplification with the uncombined ssDNA of non-target cell, obtain dsDNA;
1-4) get dsDNA to hatch with the magnetic bead being fixed with streptavidin, then add basic solution and get final product.
6. method according to claim 5, is characterized in that, step 1-1 in described method) in,
SsDNA library is selected from:
5 '-ATCCAGAGTGACGCAGCA-40nt-TGGACACGGT GGCTTAGT-3 ' or
5’-GCAATGGTACGGTACTTCC-40nt-CAAAAGTGCACGCTACTTTGCTA-3’；
The forward primer of FITC mark is selected from:
5 ' primer: 5 '-FITC-ATCCAGAGTGACG CAGCA-3 ' or
5’-FITC-GCAATGGTACGGTACTTCC-3’；
The reverse primer of Biotin mark is selected from:
3 ' primer: 5 '-biotin-ACTAAGCCACCGTGTCCA-3 ' or
5’-biotin-TTAGCAAAGTAGCGTGCACTTTTG-3’。
7. method according to claim 5, is characterized in that, step 1-2 in described method) in targeted cells be selected from Rat Mesenchymal Stem Cells; Preferably be handled as follows further: healthy adult rat is taken off neck and put to death, get femur and shin bone under aseptic condition, appear medullary space; Rinse medullary space with the low sugar DMEM nutrient solution containing 10%FBS and go out marrow, then marrow single cell suspension is made in piping and druming repeatedly, is directly inoculated in culturing bottle, puts 37 degree of incubators and cultivates; Further preferably change nutrient solution after 48 hours, within later every 3 days, change liquid 1 time;
Step 1-2 in described method) described in non-target cell be selected from rat hepatocytes system BRL-3A; Preferably be handled as follows: adopt the well-grown cell of cell dissociation buffer process without enzyme, according to 5 × 10
6be inoculated in culture dish, incubated overnight, can be used for library screening when cell grows to 95%.
8. method according to claim 5, is characterized in that, step 1-3 in described method) in amplification condition be: 94 degree of denaturation 3min, 94 degree of sex change 30s, 55-56 degree annealing 30s, 72 degree extend 30s, last 72 degree extension 5min.
9. method according to claim 5, is characterized in that, step 1-4 in described method) in alkali be selected from sodium hydroxide; Described paper mill wastewater scope is 50mM-200mM; Preferably include further: dsDNA, after evaporating pipe is concentrated, is hatched 40min-1h with streptavidin-magnetic bead at 37 degree, added 50mM-200mM NaOH solution and carry out alkaline denaturation 5-7 minute, get supernatant liquor and get final product.
10. utilize the nucleic acid aptamer that the arbitrary described method of claim 5-9 obtains, be characterised in that, described aptamer has the nucleotide sequence shown in SEQ ID NO.1 or SEQNO.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410142420.3A CN104974998A (en) | 2014-04-11 | 2014-04-11 | DNA double-chain separation method used for aptamer screening, aptamer screening method and new aptamer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410142420.3A CN104974998A (en) | 2014-04-11 | 2014-04-11 | DNA double-chain separation method used for aptamer screening, aptamer screening method and new aptamer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104974998A true CN104974998A (en) | 2015-10-14 |
Family
ID=54271961
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410142420.3A Pending CN104974998A (en) | 2014-04-11 | 2014-04-11 | DNA double-chain separation method used for aptamer screening, aptamer screening method and new aptamer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104974998A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106483289A (en) * | 2016-12-30 | 2017-03-08 | 魏乃东 | A kind of test kit for people's maturation mesenchymal stem cells MSCs detection |
| CN110229819A (en) * | 2019-05-31 | 2019-09-13 | 江苏大学 | A kind of Non-SELEX screening technique of streptomysin aptamers |
| CN111218443A (en) * | 2018-11-23 | 2020-06-02 | 上海交通大学医学院附属仁济医院 | Method for synthesizing nucleic acid drug conjugates |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102965377A (en) * | 2012-08-30 | 2013-03-13 | 广东医学院 | New Delhi metallo-beta-lactamase-1 aptamer, its screening method and application |
| CN103290019A (en) * | 2013-06-14 | 2013-09-11 | 严鹏科 | Atherosclerosis targeting aptamer as well as preparation method and application thereof |
-
2014
- 2014-04-11 CN CN201410142420.3A patent/CN104974998A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102965377A (en) * | 2012-08-30 | 2013-03-13 | 广东医学院 | New Delhi metallo-beta-lactamase-1 aptamer, its screening method and application |
| CN103290019A (en) * | 2013-06-14 | 2013-09-11 | 严鹏科 | Atherosclerosis targeting aptamer as well as preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| CITARTAN MARIMUTHU ET AL.: "Single-stranded DNA (ssDNA) production in DNA aptamer generation", 《ANALYST》 * |
| XIDONG WU ET AL.: "Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo", 《PLUS ONE》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106483289A (en) * | 2016-12-30 | 2017-03-08 | 魏乃东 | A kind of test kit for people's maturation mesenchymal stem cells MSCs detection |
| CN111218443A (en) * | 2018-11-23 | 2020-06-02 | 上海交通大学医学院附属仁济医院 | Method for synthesizing nucleic acid drug conjugates |
| CN111218443B (en) * | 2018-11-23 | 2024-03-08 | 上海交通大学医学院附属仁济医院 | Method for synthesizing nucleic acid drug conjugates |
| CN110229819A (en) * | 2019-05-31 | 2019-09-13 | 江苏大学 | A kind of Non-SELEX screening technique of streptomysin aptamers |
| CN110229819B (en) * | 2019-05-31 | 2023-03-24 | 江苏大学 | Non-SELEX screening method of streptomycin aptamer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113699135B (en) | Adenine base editor fusion protein without PAM limitation and application thereof | |
| CA3111432A1 (en) | Novel crispr enzymes and systems | |
| CN106544351A (en) | CRISPR Cas9 knock out the method for drug resistant gene mcr 1 and its special cell-penetrating peptides in vitro | |
| McGrath et al. | Isolation and analysis of mRNA from environmental microbial communities | |
| KR20190059966A (en) | S. The Piogenes CAS9 mutant gene and the polypeptide encoded thereby | |
| AU2019294630A1 (en) | Crispr effector system based amplification methods, systems, and diagnostics | |
| KR20220150329A (en) | Class II, Type V CRISPR System | |
| US20190203242A1 (en) | Scalable biotechnological production of dna single strand molecules of defined sequence and length | |
| CN101878304A (en) | Method for isolation of genomic DNA, RNA and proteins from a single sample | |
| US20190330682A1 (en) | Methods and Compositions for Improving Removal of Ribosomal RNA from Biological Samples | |
| CN109477132A (en) | Ribonucleic acid (RNA) interaction | |
| US20220135958A1 (en) | Class 2 crispr-cas rna-guided endonucleases | |
| US20220228150A1 (en) | Crispr system high throughput diagnostic systems and methods | |
| CN104974998A (en) | DNA double-chain separation method used for aptamer screening, aptamer screening method and new aptamer | |
| CA3101066A1 (en) | Crispr/cas and transposase based amplification compositions, systems and methods | |
| EP4165180A2 (en) | Engineered mad7 directed endonuclease | |
| CN106916821B (en) | ssDNA nucleic acid aptamer and application thereof | |
| CN106957857A (en) | A kind of method that utilization CRISPR/Cas9 systems knock out goat MSTN and FGF5 gene jointly | |
| CN113186315A (en) | Primer pair and detection method for detecting bacterial leaf streak germs of rice | |
| CN106282191B (en) | Aptamer of specific targeting osteosarcoma cell and preparation method and application thereof | |
| CN102703400A (en) | Hot start DNA (Deoxyribose Nucleic Acid) polymerase and application thereof | |
| CN113528563B (en) | Preparation method and application of visual biosensor synthesized by using explosive molecule degradation genes | |
| CN104004726A (en) | Transmembrane type TALEN-R11 protein with fluorescent label and preparation method and application thereof | |
| JP2024521894A (en) | RNA-guided CasΩ nuclease and its uses in diagnosis and therapy | |
| CN109055382A (en) | Aptamer and its application of 6X histidine tag can be specifically bound |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151014 |