CN111206021A - Method for separating, enriching and detecting enveloped viruses based on CL7-CVN and Im7 system - Google Patents
Method for separating, enriching and detecting enveloped viruses based on CL7-CVN and Im7 system Download PDFInfo
- Publication number
- CN111206021A CN111206021A CN202010058494.4A CN202010058494A CN111206021A CN 111206021 A CN111206021 A CN 111206021A CN 202010058494 A CN202010058494 A CN 202010058494A CN 111206021 A CN111206021 A CN 111206021A
- Authority
- CN
- China
- Prior art keywords
- cvn
- beads
- virus
- protein
- enrichment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
- C12N2710/16751—Methods of production or purification of viral material
Abstract
The invention discloses a method for separating, enriching and detecting a togavirus based on a CL7-CVN and Im7 system, which comprises the following steps: firstly, preparing recombinant CL7-CVN protein and Im7 protein; coupling Im7 protein with microspheres to obtain microspheres Im 7-Beads; firstly, putting recombinant CL7-CVN protein into a virus sample to be enriched, after incubation, putting Im7-Beads, after incubation, enriching, and centrifuging to obtain Im7-Beads enriched with viruses; and (3) extracting the Im7-Beads enriched enveloped virus nucleic acid, detecting by RT-PCR and calculating the enrichment efficiency. The invention prepares CL7-CVN protein by a genetic engineering method, and can enrich PRV virus particles to the surface of Im7-Beads by utilizing the specific binding of CL7 and Im7 and the property of CVN binding to enveloped viruses, thereby providing a brand-new technical means for virus separation and enrichment and detection thereof.
Description
Technical Field
The invention belongs to the field of biotechnology application and the technical field of environmental monitoring, and particularly relates to a method for separating, enriching and detecting enveloped viruses based on CL7-CVN and Im7 systems.
Background
At present, enveloped viruses such as AIDS virus, herpes simplex virus, hepatitis C virus, influenza virus, pseudorabies virus, African swine fever, Ebola virus and the like pose a great threat and even a disaster to human survival and development. The existing methods for separating and diagnosing the enveloped viruses are various, such as virus separation culture, PCR nucleic acid detection, enzyme-linked immunosorbent assay and the like; however, these methods all have the disadvantages of complicated operation, time-consuming, high technical requirements and high price, and are not suitable for rapid and on-site detection. Therefore, a simple, convenient, rapid, accurate and high-flux diagnostic detection method is established, and the method has important significance for controlling virus outbreak.
Disclosure of Invention
Cyanovirin-N (CVN for short) is a water-soluble glycoprotein separated from blue-green algae, can be specifically and high-affinity combined on capsid protein of enveloped virus to prevent virus from infecting invading cells, thereby exerting antiviral activity, so that the protein can not be interfered by virus variation, and simultaneously has the characteristics of wide antiviral spectrum, stable property and the like, thereby leading the CVN protein to become a valuable antiviral drug and simultaneously leading the CVN protein to become a method for separating and detecting the enveloped virus. Studies have shown that CL7/Im7 is the most strongly protein-interacting group 1 protein (Kd 10)-14-10-17M)。
The invention fuses CL7 to the CVN protein by a genetic engineering method to obtain the recombinant protein CL7-CVN fused with the CL7 label. The soluble expression level of CVN can be remarkably improved, the expressed CL7-CVN fusion protein has remarkable antiviral activity, and the recombinant CL7-CVN protein can also be specifically combined with Im7 protein.
According to the CL7/Im7 ultrahigh affinity system, the recombinant CL7-CVN can be combined with enveloped virus capsid protein and Im7 specifically and at the same time with high affinity. Furthermore, Im7 is bound to the microspheroidal particle, so that the virus particles in the solution can be specifically bound to the surface of the microspheroidal particle, thereby achieving the effect of separating the virus particles from the solution, and establishing a separation and enrichment detection method for the enveloped virus. The method has the advantages of high sensitivity, high separation speed, strong specificity, simple operation, good repeatability, no need of expensive instruments and equipment and the like.
The invention provides a method for enriching, separating and detecting enveloped viruses, which adopts the following technical scheme:
a method for isolating and enriching a togavirus based on a CL7-CVN and Im7 system, comprising the steps of:
(1) transforming an expression vector of the CL7-CVN into a first host cell, performing induced expression, and purifying to obtain a recombinant CL7-CVN protein;
(2) transforming the expression vector of the Im7 into a second host cell, inducing expression, and purifying to obtain Im7 protein;
(3) coupling reaction of Im7 protein and microsphere to obtain Im 7-Beads;
(4) firstly, putting recombinant CL7-CVN protein into a sample to be separated and enriched, after incubation, putting Im7-Beads, after incubation, enriching, and centrifuging to obtain the virus-enriched Im 7-Beads.
The method for detecting the enveloped viruses comprises the steps of extracting the Im7-Beads enriched enveloped virus nucleic acid, detecting the copy number of the enriched viruses by adopting fluorescent quantitative PCR (polymerase chain reaction), and calculating the enrichment efficiency of the enveloped viruses.
The technical scheme provided by the invention at least comprises the following beneficial effects:
1. the invention prepares Im7 protein by a genetic engineering method, and prepares Im7-Beads microspheres by the method, wherein the average grain diameter of the Im7-Beads microspheres is 82.35 +/-0.35 mu m to 151.27 +/-0.48 mu m, so that more excellent microstructure and swelling property can be provided, and better effect is provided for enriching and separating viruses.
2. The invention prepares the recombinant CL7-CVN protein by a genetic engineering method, and can enrich PRV virus particles to the surface of Im7-Beads microspheres by utilizing the specific binding of CL7 and Im7 and the capability of CVN binding to the enveloped viruses, thereby providing a brand-new technical means for the separation, enrichment and detection of the enveloped viruses; and the capacity of Im7-Beads for enriching viruses reaches 1.06 multiplied by 1010viruses/mL。
Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.
Drawings
FIG. 1 is a schematic diagram of enrichment and isolation of viruses provided by the present invention;
FIG. 2 is an electrophoresis (SDS-PAGE) of the PCR amplification results of the linear vector and the target gene fragment provided by the present invention: in the figure, lanes 1 and 2 are the original vector pET28a and the linear vector pET28a obtained by PCR amplification, respectively; 3. lanes 4 are respectively CL7-linker-His and 3C-CVN linear fragments obtained by PCR amplification, and lane M is DL5000 marker;
FIG. 3 is an electrophoresis (SDS-PAGE) of the PCR identification of the transformed E.coli DH5a colony according to the present invention: lane 1 is the original vector PCR control; 2. lanes 3, 4 and 5 are PCR identification results of different colonies; lane M is DL5000 marker;
FIG. 4 is an electrophoretogram (SDS-PAGE) of the transformed plasmid identification results provided by the present invention: lane 1 is the PCR amplified linear pET28a vector; 2. lanes 3, 4 and 5 are plasmid identification results of different colonies; lane M is DL5000 marker;
FIG. 5 shows the results of the purification of CL7-CVN protein according to the example of the present invention: lane 1, heat-treated supernatant protein; lane 2, flow through after hanging the column; lane 3, eluted CL 7-CVN; m protein marker;
fig. 6 shows the expression and purification results of Im7 protein provided by the embodiment of the present invention: lane wcl, whole protein expressed by pET28a-Im 7; sup lane, supernatant protein after cell lysis; pel lane, protein precipitated after cell lysis; h-sup lane, supernatant protein after cell lysis supernatant protein heat treatment centrifugation; EL1, EL2, EL3, eluted Im7 protein; m protein marker;
FIG. 7 shows the results of ELISAs detecting the binding of CL7, CVN, CL7-CVN to viruses according to the present invention: FIG. 7A, schematic diagram of ELISAs verifying the binding of CL7-CVN to PRV; FIG. 7B OD450 values measured after equimolar dilution of CL7, CVN, CL7-CVN at different fold for binding to the virus and detection of the bound CL7-CVN, CVN with Anti-His HRP antibody;
FIG. 8 shows the enrichment PRV fluorescence detection of CL7-CVN and Im7-Beads microspheres provided by the embodiment of the present invention: ep tube 1 is a blank control with only Im 7-Beads; only PRV virus fluid in Ep tube 2; in the Ep tube 3, Im7-Beads and PRV virus liquid are in a mixed state; the Ep tube 4 is in a state that the Ep tube 3 is washed with the Im 7-Beads; ep tube 5 is in a state of mixing Im7-Beads, PRV virus liquid and CL7 protein liquid; the Ep tube 6 is the state of the Ep tube 5 after washing the Im 7-Beads; ep tube 7 is in a state of mixing Im7-Beads, PRV virus liquid and CVN protein liquid; the Ep tube 8 is in a state that the Ep tube 7 is washed with the Im 7-Beads; ep tube 9 is in a state of mixing Im7-Beads, PRV virus liquid and CL7-CVN protein liquid; the Ep tube 10 is in a state that the Ep tube 9 is washed with Im 7-Beads; in FIG. 8, the upper row is a white light irradiation map, and the lower row is a fluorescence map under blue light irradiation;
FIG. 9 shows the result of virus enrichment efficiency in RT-PCR assay according to an embodiment of the present invention; the PRV efficiency is enriched by equimolar CL7, CVN, CL7-CVN and the same amount of Im7 microspheres;
FIG. 10 shows the results of the virus-adsorbing concentration efficiency of microspheres prepared in various embodiments of the present invention;
FIG. 11 shows the PCR assay of the enriched PRV gene fragments provided in the examples of the present invention: FIG. 11A, a fragment of the gD gene (226bp), FIG. 11B, a gB gene fragment (331 bp); lane 1, positive control; lane 2, water control; lane 3, PBS and Im7-Beads treated group; lane 4, CL7 and Im7-Beads treated group; lane 5, CVN and Im7-Beads treatment group; lane 6, CL7-CVN and Im7-Beads treated group;
FIG. 12 illustrates the optimization of virus enrichment and isolation conditions provided by an embodiment of the present invention; effect of different masses of CL7-CVN treated virus on Im7-Beads enrichment of isolated virus: 0, 0.125, 0.25, 0.5, 1 μmol CL7-CVN treatment isolation virus RT-PCR detection virus enrichment efficiency result;
FIG. 13 shows the detection of the infectivity of the supernatant virus after enrichment and separation of the virus fluid sample according to the embodiment of the present invention: normal cells; infection of virus stock solution; im 7-nonspecific adsorption of Beads; adsorption of Im7-Beads and CL 7-CVN;
FIG. 14 shows the results of susceptibility testing for enriched and isolated viruses provided by embodiments of the present invention; FIG. 14A, RT-PCR assay of virus enrichment efficiency for different dilution volumes of virus samples; FIG. 14B, detection of gK gene fragments of viruses enriched by PCR detection of virus samples of different dilution volumes;
FIG. 15 shows the results of a capacity assay for enrichment and isolation of viruses provided in an embodiment of the present invention; FIG. 15A, enrichment of virus when the virus sample volume was increased from 100 μ L to 500 μ L; FIG. 15B, the efficiency of enrichment of virus when the virus sample volume was increased from 100. mu.L to 500. mu.L.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail below. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention.
The embodiment of the invention relates to the following main materials:
escherichia coli Rosetta (DE3) (Merck), Escherichia coli BL21(DE3) (Merck), pET28a plasmid (Merck), pET23a plasmid (Merck). The 3C protease and the PfuDNA polymerase are expressed and purified by the laboratory, the T5 exonuclease is purchased from NEB company, the ultra-low molecular protein molecular weight standard protein is purchased from Boshide company, and the primer is purchased from Shanghai Biotechnology company. Pseudorabies virus (PRV), PK15 cells were derived from Hua shanThe university of middle school agriculture is awarded to the laboratory for storage. PBS buffer (8mM Na)2HPO4,136mM NaCl,2mM KH2PO42.6mM KCL), imidazole buffer (5-200mM imidazole,40mM NaH)2PO4300mM NaCl), 1M IPTG solution, 3C digestion buffer (25mM Tris-HCl, pH 7.0,150mM NaCl,0.5mM EDTA, and 1mM DTT).
Construction of recombinant CL7-CVN protein prokaryotic expression vector
1. First PCR amplification: obtaining a mutant CL7 gene (the nucleotide sequence is shown as SEQ ID NO:3, and the amino acid sequence of the mutant protein is shown as SEQ ID NO: 4) by site-directed mutagenesis;
using pET23a-CL7 plasmid as a template, using F1 shown as SEQ ID NO. 6 and R1 shown as SEQ ID NO. 7 as primers, introducing linker, His and terminal homologous sequence at the same time, and carrying out PCR amplification to obtain a CL7-linker-His linear fragment, which is shown as a 3-lane in FIG. 2; according to the CVN gene sequence published by gene bank, the CVN gene synthesized by codon optimization design is used as a template, F2 shown as SEQ ID NO. 8 and R2 shown as SEQ ID NO. 9 are used as primers, 3C and terminal homologous sequences are introduced at the same time, and PCR amplification is carried out to obtain a 3C-CVN linear fragment, which is shown in lane 4 in figure 2. The primers were designed as follows:
f1: 5'-AGAAGGAGATATACCATGGGCAGCAAAAGCA-3' as shown in SEQ ID NO 6;
r1:5 'GTGATGGTGATGACTGCCCCCTCCACCGCTCCCTCCGCCACCGCCTTCA ATATCAATGTT-3' as shown in SEQ ID NO: 7;
f2:5 'AGTCATCACCATCACCATCACTTGGAGGTTTTGTTCCAGGGTCCACTTG GTAAATTCTCCC-3' as shown in SEQ ID NO 8;
r2: 5'-CGGATCCTCGAGTCATTCGTATTTTAGTGTACCGTCT-3' as shown in SEQ ID NO 9.
2. Second PCR amplification: the linear fragment of pET28a vector was obtained by vector PCR amplification using the plasmid pET28a stored in the laboratory as template and F3/R3 as primers, and the results are shown in lane 2 in FIG. 2, and the primers were designed as follows:
f3: 5'-TGACTCGAGGATCCGGCTGCT-3' as shown in SEQ ID NO: 10;
r3: 5'-GGTATATCTCCTTCTTAAAGTTAAACAAAA-3' as shown in SEQ ID NO: 11.
3. Digesting three linear fragments of CL7-linker-His, 3C-CVN and pET28a vectors obtained by the first PCR amplification and the second PCR amplification by using T5 exonuclease in ice water bath for 5min, carrying out conventional transformation on a product to obtain escherichia coli DH5a competent cells, picking up a single colony for culture, carrying out bacterial liquid PCR (figure 3) and plasmid identification (figure 4), screening positive clones to obtain a recombinant plasmid of pET28a-CL7-linker-His-3C-CVN, wherein the fusion gene sequence of CL7-linker-His-3C-CVN is shown as SEQ ID NO:2, the 3 lane in figure 3 is a positive clone identified by PCR, and the 3 lane in figure 4 is a positive recombinant plasmid of pET28 lane 28a-CL7-CVN identified by PCR. Meanwhile, pET28a-CVN plasmid was constructed as a control.
In the primers, F1 (AGAAGGAGATATACC at the 5 'end) and R3 (GGTATATCTCCTTCT at the 5' end) are homologous sequences, F2 (AGTCATCACCATCAC at the 5 'end) and R1 (GTGATGGTGATGACT at the 5' end) are homologous sequences, F3 (TGACTCGAGGATCCG at the 5 'end) and R2 (CGGATCCTCGAGTCA at the 5' end) are homologous sequences, three fragments obtained by first PCR amplification and second PCR amplification are subjected to homologous series digestion by T5 exonuclease, and are recombined and combined into a circular shape in a DH5a competent cell of escherichia coli, so that an expression vector pET28a-CL7-CVN is constructed.
Preparation of recombinant CL7-CVN protein
1. The constructed pET28a-CL7-CVN expression plasmid is transformed into a first host cell, such as Escherichia coli Rosetta (DE3) (Merck Corp.);
2. carrying out induced expression, wherein the IPTG concentration is 0.5mMol/L, the induction temperature is 18 ℃, and the induced expression time is 16 h;
3. centrifuging to collect induced Escherichia coli, ultrasonic crushing, collecting supernatant, heating the collected supernatant in 80 deg.C water bath for 30min, centrifuging, and collecting supernatant;
4. combining the supernatant after heat treatment with Ni-NTA at room temperature for 30-60min, washing the nickel beads with 0-30 mM imidazole, and removing non-specifically combined hybrid protein;
5. washing the target protein CL7-CVN with 200-300mM imidazole;
6. filtering the obtained target protein with 0.22um filter membrane for sterilization, subpackaging and storing at low temperature;
7. the one-step purification result is shown in FIG. 5, and the purity of CL7-CVN can reach 99%.
Preparation of Im7-Beads
Preparation of Im7 protein: transforming the expression vector pET-Im7 of Im7 into a second host cell, such as Escherichia coli BL21(DE3) (Merck company), to induce expression of Im7 protein; heating the cell lysis supernatant for 30min at 80 deg.C in water bath, centrifuging to collect supernatant, and performing Ni-NTA one-step affinity purification, wherein the purification result is shown in FIG. 6, and the purity can reach 99%.
Preparation of Beads: preparing inulin into solution, adding sodium hexametaphosphate, and stirring to dissolve; dropwise adding a sodium carbonate solution into the system, adjusting the pH to 10-10.5 and the temperature to 40-50 ℃, stirring to react for 3.5-4.0h, adjusting the pH to be neutral after the reaction is finished, precipitating for multiple times by using a 95% ethanol solution, centrifuging to obtain a precipitate, and fully dispersing the precipitate by using deionized water to obtain a Beads dispersion liquid; wherein, the sodium hexametaphosphate accounts for 8 to 10 percent (marked as SHMP percent) of the inulin by mass.
Preparation of Im 7-Beads: taking an emulsifier, and fully stirring to obtain an oil phase liquid; respectively dropwise adding the Im7 protein purified in the above example and the dispersions of Beads into the oil phase liquid, and emulsifying for 40-60 min; and (3) dropwise adding a PC solution (anthocyanin) into the emulsion, carrying out water bath at 37 ℃, stirring and reacting for 40-48h, centrifugally collecting precipitates after the reaction is finished, washing with isopropanol for three times, and drying in vacuum to obtain the Im7-Beads microspheres. Wherein the combination mass ratio of Im7, Beads and PC (200- & ltwbr & gt 300- & ltwbr & gt (100- & ltwbr & gt 150- & ltwbr & gt 0.02-0.025) is equal, and the volumes of the Im7 solution, the Beads dispersion and the PC solution are equal. The emulsifier is selected from 2% by mass of Span-80 solution or 2% by mass of Tween-80 solution.
Measuring the particle size span: the particle size of the microspheres is determined by a laser particle size analyzer, and dried microspheres are suspended in deionized water and dispersed by ultrasonic. The suspension was sonicated at 50mV for 30min in a sample receiving tube at 2500rpm with a shading control of between 5% and 13%.
Particle size span index (range of microsphere particle size): span ═ D (D)90-D50)/D10；
In the formula, D90、D50、D10And 90 th, 50 th and 10 th percentiles representing the particle sizes of the microspheres, the span index of the particle sizes representing the distribution range of the particle sizes, and three measurements were repeated for each sample.
Taking dried microspheres with the mass of 0.1g and the weight of Wd as Ws, suspending the microspheres in a 5ml deionized water centrifugal tube, carrying out medium temperature and vibration on a shaking table, then carrying out centrifugal sampling once every 1h, wiping water on the surfaces of the swelled microspheres by using filter paper, immediately weighing the microspheres, and recording the weight as Ws, wherein the swelling ratio formula is as follows: esw (%) - (Ws-Wd)/Wd 100%;
the equilibrium water content formula is as follows: ewc (%) - (Wc-Wd)/Wd ] 100%;
wc is the mass of the swollen microspheres at equilibrium water content.
In the above manner, a total of 10 kinds of microspheres including examples 1 to 6, and comparative examples 1 to 4 were prepared in this embodiment, and the process parameters and properties of the microspheres are shown in Table 1. Table 1 lists the weight percentage (SHMP) of sodium hexametaphosphate in inulin, and the dropwise added sodium carbonate solution of step S1 is used to adjust the pH to 10-10.5, the reaction temperature is controlled to 40-50 ℃, and the reaction time is 3.5-4.0 h; the combination mass ratio of Im7, Beads and PC, wherein in the step S2, the emulsification time is 40-60min later; the reaction time of the PC solution after dropwise addition is 40-48 h; im7-Beads particle size Span (Span), Swell Filter (Esw, 10h) and equilibrium Water content (Ewc).
In comparative example 4, the existing agarose microspheres were coupled with Im7 to obtain microspheres. The specific method comprises the following steps: ultrafiltering the purified Im7 protein with buffer solution, and concentrating to 50 mg/mL; washing agarose microspheres with buffer solution, mixing Im7 protein and microspheres at room temperature, binding for 15min, and standing at room temperature for 30 min; sealing the microspheres with 50mM cysteine for 15min in dark, standing for 30min, washing the microspheres with 1M NaCl for 3 times, and finally storing with NaN 3;
TABLE 1
As can be seen from Table 1, in examples 1-6, compared with comparative examples 1-4, the average particle size of Im7-Beads is smaller, the particle size span is smaller, and the swelling ratio is higher, which indicates that the Im7-Beads microspheres provided by the examples of the invention can provide a more excellent microstructure, and provide better effects for enriching and isolating viruses.
ELISAs detect the binding ability of CL7-CVN and CVN to PRV virus
1. Freezing and thawing PK15 cells infected with PRV for 3 times;
2. centrifuging cell lysate for 10min at 10000g, and collecting virus supernatant;
3. coating virus supernatant on ELISAs plates with coating liquid at 4 ℃ overnight;
4. blocking with PBS containing 2% BSA at 37 ℃ for 1 h;
5. adding diluted CL7, CVN and CL7-CVN at a multiple ratio respectively, and incubating at 37 ℃ for 1 h;
6. detecting the combined CVN and CL7-CVN by using an antibody of Anti-His-Tag HRP;
7. the reaction was stopped by adding 100. mu.L of 1M HCl and the OD450 was read with a microplate reader.
The results are shown in FIG. 7, and the OD450 values gradually decreased with the increase of the dilution factor, and the OD450 values of CL7-CVN and CVN experimental groups are higher than those of CL7 control group, which indicates that CL7-CVN and CVN both have PRV binding activity, and CL7 does not have PRV binding activity.
Fluorescence intensity observations of Im7-Beads adsorbing Virus examples
1. Equimolar (0.4umol) amounts of CL7, CVN, CL7-CVN were combined with 100. mu. LPRV (GFP-labelled, 10. mu.L)6viruses/mu L) virus liquid for mixed incubation for 30 min; respectively adding 50 mu L of Im7-Beads microspheres, and mixing and incubating for 30min at room temperature; wherein Im7-Beads microspheres were the microspheres prepared in example 5 above;
2. centrifuging to separate supernatant and microspheres, and washing the microspheres with a coupling buffer (0.1M Tris-HCl, pH8.0, 0.5MNaCl)/1MNaCl for 3-5 times;
3. the fluorescence intensity of the adsorbed result was observed with a blue-ray spectrometer.
The results are shown in FIG. 8, and in Ep tubes 4, 6 and 8, no green fluorescence signal is detected from the washed microspheres, which indicates that the addition of PBS, CL7 and CVN respectively cannot enable Im7-Beads to bind and adsorb PRV; in the Ep tube 9, by adding Im7-Beads and recombinant CL7-CVN protein, green fluorescence of the washed microspheres is found in the Ep tube 10, and since PRV can generate fluorescence under blue light irradiation, the Im7-Beads can be combined with the recognition of the enveloped virus through the recombinant CL7-CVN protein to realize the separation and enrichment of the enveloped virus. The principle of adsorption of Im7-Beads, recombinant CL7-CVN protein and virus is shown in FIG. 1.
Separation and enrichment for RT-PCR primary detection of PRV virus
1. Equimolar (0.4. mu. mol) amounts of CL7, CVN, CL7-CVN were mixed with 100. mu.L of PRV virus solution (GFP-labeled, 10)6virues/. mu.L) mixed and incubated at room temperature for 30 min; respectively adding 50 mu L of Im7-Beads, mixing and incubating for 30min at room temperature; wherein Im7-Beads were the microspheres prepared in examples 5-6 above, and comparative examples 1-4;
2. centrifuging to separate supernatant and microspheres, and washing the microspheres with a coupling buffer (0.1M Tris-HCl, pH8.0, 0.5MNaCl)/1MNaCl for 3-5 times;
3. respectively extracting viral genomes of the supernatant and the microspheres; the enrichment efficiency was determined by fluorescent quantitative PCR (RT-PCR).
4. The enrichment efficiency is represented by the following formula:
as a result, as shown in FIG. 9, neither PBS, CL7 nor CVN enabled Im7-Beads to effectively achieve virus isolation and enrichment; the CL7-CVN can enable Im7-Beads to realize the separation and enrichment of PRV virus, and the enrichment efficiency is as high as 90.78%; and the Im7-Beads prepared in examples 5-6 are used for adsorbing viruses, and the enrichment efficiency is remarkably higher than that of comparative examples 1-4, as shown in FIG. 10.
PCR method for verifying separation, enrichment and detection of PRV (PRV virus)
1. Respectively mixing the PBS solution, the CL7 protein solution, the CVN protein solution and the CL7-CVN protein solutionWith 100. mu.L of PRV virus fluid (GFP-labeled, 10)6virues/. mu.L) mixed and incubated at room temperature for 30 min;
2. respectively adding Im7-Beads, mixing and incubating for 30min at room temperature; wherein Im7-Beads microspheres were the microspheres prepared in example 5 above;
3. standing or simply centrifuging to settle and separate the microspheres; the microspheres were washed 3-5 times with a coaling buffer (0.1M Tris-HCl, pH8.0, 0.5M NaCl)/1M NaCl;
4. after washing the microspheres, respectively extracting PRV genomes of the microspheres, and respectively detecting gD gene fragments (226bp) and gB gene fragments (331bp) by PCR; and (6) calculating the enrichment efficiency.
As a result, as shown in FIG. 11, the fragment (226bp) of gD gene and the fragment (331bp) of gB gene were detected in the CL7-CVN treatment group, but were not detected in the PBS, CL7 and CVN treatment groups; again, it was confirmed that only CL7-CVN enabled Im7-Beads to achieve isolation and enrichment of PRV virus.
Effect of different concentrations of CL7-CVN on PRV Virus enrichment efficiency
1. Different molar amounts of CL7-CVN (0, 0.125, 0.25, 0.5, 1. mu. mol) were mixed with 100. mu.L of PRV virus solution (GFP-labeled, 10)6virues/. mu.L) mixed and incubated at room temperature for 30 min;
2. respectively adding 50 mu L of Im7-Beads, mixing and incubating for 30min at room temperature; wherein Im7-Beads microspheres were the microspheres prepared in example 5 above;
3. standing or centrifuging to separate the microspheres by sedimentation;
4. respectively extracting viral genomes of the supernatant and the microspheres; RT-PCR detects the enrichment efficiency;
as shown in FIG. 12, the treatment concentration of CL7-CVN was between 0.125 and 1. mu. mol, and the corresponding treatment concentration of 50. mu.L of Im7-Beads, i.e., the treatment concentration of CL7-CVN binding to Im7-Beads was 2.5 to 20. mu. mol/mLIm7-Beads, and the corresponding concentration of virus solution adsorbing 100. mu.L was 106viruses/. mu.L; when the CL7-CVN treatment concentration is 0.5 mu mol, namely the treatment concentration of CL7-CVN combined with Im7-Beads is 10 mu mol/mL Im7-Beads, the enrichment efficiency can reach 97.32 percent, namely the optimal treatment concentration.
Separating and enriching PRV (GFP) virus sample to obtain supernatantDe-infected cell analysis
1. Taking an equal amount of virus sample to mix and incubate with Im7-Beads combined with CL 7-CVN;
2. setting a control, normal cells and not enriching separated virus infected cells;
3. centrifuging to collect supernatant virus liquid, and filtering for sterilization;
4. respectively infecting the sterilized virus liquid into cells;
5. culturing for 16h to observe virus infection condition by a fluorescence microscope;
the result is shown in FIG. 13, and the cell infection shows that after the virus sample is treated and adsorbed by Im7-Beads and CL7-CVN, the virus particles in the supernatant of the virus sample are obviously reduced, which shows that the separation and enrichment of PRV virus can be realized by adopting Im7-Beads and recombinant CL7-CVN, and provides a basis for the actual detection of the virus infection of organisms.
Enrichment of sensitivity to PRV viruses
1. Each 100. mu.L of PRV virus (10)6viruses/. mu.L) to a final volume of 200, 400, 800, 1000. mu.L;
2. respectively incubating 0.5 mu mol of CL7-CVN protein and PRV virus solution with different volumes at room temperature for 30 min;
3. respectively adding 50 mu L of Im7-Beads, mixing and incubating for 30min at room temperature;
4. standing or simply centrifuging to settle and separate the microspheres;
5. respectively extracting viral genomes of the supernatant and the microspheres, and detecting enrichment efficiency by adopting RT-PCR;
6. PCR detecting PRVgK gene segment enriched by microsphere;
the enrichment efficiency results of RT-PCR are shown in FIG. 14A, when 100. mu.L PRV virus solution (10)6Virus/. mu.L) was diluted to 1mL (concentration: 10)5viruses/mu L), 0.5 mu mol of recombinant CL7-CVN protein and 50 mu L of Im7-Beads are adopted, the enrichment efficiency can still reach 88.72 percent, and the method for separating and enriching PRV provided by the invention has high sensitivity and can be laid for later gene detection; the results of PCR detection of gK gene fragments are shown in FIG. 14B, which shows that PRV gene can still be detected when the sample is diluted 10 timesOne step proves that the enrichment method has better sensitivity and can be used for enrichment detection of large-volume samples.
Capacity to enrich for PRV virus
1. Respectively take 106100, 200, 300, 400, 500 μ L of PRV virus of viruses/μ L;
2. 50 μ L of Im7-Beads conjugated to 1 μmol of CL7-CVN were incubated with different volumes of virus solution for 30min at room temperature, respectively; im7-Beads microspheres the microspheres prepared in example 5 above were used; the binding ratio of CL7-CVN to Im7-Beads is shown in Table 2;
3. standing or simply centrifuging to settle and separate the microspheres;
4. respectively extracting virus genomes of the supernatant and the microspheres, detecting enrichment efficiency by RT-PCR, and calculating enrichment capacity, wherein the enrichment capacity is the virus amount which can be enriched by Im7-Beads per ml.
FIG. 15, when 106When PRV virus samples of viruses/. mu.L were increased from 100. mu.L to 300. mu.L, using 50. mu.L of Im7-Beads combined with 1. mu. mol of CL7-CVN, the virus enrichment was increased 3-fold, and the capacity of Im7-Beads for virus enrichment was about 5.41X 109viruses/mL, and the enrichment efficiency of the viruses reaches 89.64 percent; the enrichment efficiency and the enrichment capacity of the virus samples are not increased greatly from the stage of 300 mu L to 500 mu L, which indicates that the binding virus is close to saturation.
In Table 2, 10 is used6PRV virus samples of viruses at 500. mu.L, so that the microspheres adsorb viruses with saturation, and the effects of different CL7-CVN to Im7-Beads binding mass-to-volume ratios (. mu. mol/mL), and incubation times on enrichment efficiency and enrichment capacity were examined. As shown in Table 2, the mass-to-volume ratio of CL7-CVN to Im7-Beads was 2.5-20. mu. mol/mL, and the total incubation time of CL7-CVN |, Im7-Beads and viruses was 40-100 min. When the mass ratio of CL7-CVN to Im7-Beads is 5-15 mu mol/mL and the total incubation time is 60-100min, the enrichment efficiency is 86.36-93.16 percent, and the enrichment capacity is 5.41 multiplied by 109-1.06×1010Virus/mL. And when the mass-to-volume ratio of the CL7-CVN to the Im7-Beads is 10 mu mol/mL and the incubation time is 30min, the enrichment efficiency and the enrichment capacity are maximized.
TABLE 2
In summary, the following steps:
1. the invention prepares Im7 protein by a genetic engineering method, and prepares Im7-Beads microspheres by the method, wherein the average grain diameter of the Im7-Beads microspheres is 82.35 +/-0.35 mu m to 151.27 +/-0.48 mu m, so that more excellent microstructure and swelling property can be provided, and better effect is provided for enriching and separating viruses.
2. The invention prepares the recombinant CL7-CVN protein by a genetic engineering method, and can enrich PRV virus particles to the surface of Im7-Beads by utilizing the specific binding of CL7 and Im7 and the performance of CVN binding to enveloped viruses, thereby providing a brand-new technical means for virus separation and enrichment and detection; and the capacity of Im7-Beads for enriching viruses reaches 1.06 multiplied by 1010viruses/mL。
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> university of Hubei
<120> method for isolating, enriching and detecting enveloped viruses based on CL7-CVN and Im7 system
<160>9
<170>SIPOSequenceListing 1.0
<210>2
<211>771
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atgggcagca aaagcaatga accgggtaaa gcaaccggtg aaggtaaacc ggttaataac 60
aaatggctga acaatgccgg taaagatctg ggtagtccgg ttccggatcg tattgcaaat 120
aaactgcgtg ataaagaatt cgagagcttc gatgattttc gtgaaacctt ttgggaagaa 180
gttagcaaag atcctgaact gagcaaacag tttagccgca ataacaatga tcgtatgaaa 240
gttggtaaag caccgaaaac acgtacccag gatgttagcg gtaaacgtac ctcatttgaa 300
ctgaatcatc agaaaccgat tgaacagaat ggtggcgttt atgatatgga taacattagc 360
gttgttaccc cgaaacgcaa cattgatatt gaaggcggtg gcggagggag cggtggaggg 420
ggcagtcatc accatcacca tcacttggag gttttgttcc agggtccact tggtaaattc 480
tcccagacct gctacaactc cgctatccag ggttctgttc tgacctctac ctgcgaacgt 540
accaacggtg gttataacac ctcctctatc gacctgaact ccgttattga aaacgttgac 600
ggttctctga aatggcagcc atctaacttc atcgaaacct gccgtaacac ccagctggct 660
ggttcctctg aactggctgc tgaatgcaaa acccgtgctc agcagttcgt ttctaccaaa 720
atcaacctag acgaccatat agctaacata gacggtacac taaaatacga a 771
<210>3
<211>396
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
atgggcagca aaagcaatga accgggtaaa gcaaccggtg aaggtaaacc ggttaataac 60
aaatggctga acaatgccgg taaagatctg ggtagtccgg ttccggatcg tattgcaaat 120
aaactgcgtg ataaagaatt cgagagcttc gatgattttc gtgaaacctt ttgggaagaa 180
gttagcaaag atcctgaact gagcaaacag tttagccgca ataacaatga tcgtatgaaa 240
gttggtaaag caccgaaaac acgtacccag gatgttagcg gtaaacgtac ctcatttgaa 300
ctgaatcatc agaaaccgat tgaacagaat ggtggcgttt atgatatgga taacattagc 360
gttgttaccc cgaaacgcaa cattgatatt gaaggc 396
<210>4
<211>132
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>4
Met Gly Ser Lys Ser Asn Glu Pro Gly Lys Ala Thr Gly Glu Gly Lys
1 5 10 15
Pro Val Asn Asn Lys Trp Leu Asn Asn Ala Gly Lys Asp Leu Gly Ser
20 25 30
Pro Val Pro Asp Arg Ile Ala Asn Lys Leu Arg Asp Lys Glu Phe Glu
35 40 45
Ser Phe Asp Asp Phe Arg Glu Thr Phe Trp Glu Glu ValSer Lys Asp
50 55 60
Pro Glu Leu Ser Lys Gln Phe Ser Arg Asn Asn Asn Asp Arg Met Lys
65 70 75 80
Val Gly Lys Ala Pro Lys Thr Arg Thr Gln Asp Val Ser Gly Lys Arg
85 90 95
Thr Ser Phe Glu Leu Asn His Gln Lys Pro Ile Glu Gln Asn Gly Gly
100 105 110
Val Tyr Asp Met Asp Asn Ile Ser Val Val Thr Pro Lys Arg Asn Ile
115 120 125
Asp Ile Glu Gly
130
<210>6
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
agaaggagat ataccatggg cagcaaaagc a 31
<210>7
<211>60
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
gtgatggtga tgactgcccc ctccaccgct ccctccgcca ccgccttcaa tatcaatgtt 60
<210>8
<211>61
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
agtcatcacc atcaccatca cttggaggtt ttgttccagg gtccacttgg taaattctcc 60
c 61
<210>9
<211>37
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
cggatcctcg agtcattcgt attttagtgt accgtct 37
<210>10
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
tgactcgagg atccggctgc t 21
<210>11
<211>30
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
ggtatatctc cttcttaaag ttaaacaaaa 30
Claims (10)
1. A method for separating and enriching a enveloped virus based on a CL7-CVN and Im7 system is characterized by comprising the following steps:
(1) transforming an expression vector of the CL7-CVN into a first host cell, performing induced expression, and purifying to obtain a recombinant CL7-CVN protein;
(2) transforming the expression vector of the Im7 into a second host cell, inducing expression, and purifying to obtain Im7 protein;
(3) coupling reaction of Im7 protein and microspheres to obtain Im7-Beads microspheres;
(4) mixing the enveloped virus sample to be separated and enriched, the recombinant CL7-CVN protein solution and the Im7-Beads, incubating and centrifuging to obtain the Im7-Beads microspheres enriched in enveloped viruses.
2. The method for isolating and enriching a togavirus based on the CL7-CVN and Im7 system of claim 1, wherein the step (3) is specifically:
s1: preparing inulin into solution, adding sodium hexametaphosphate, and stirring to dissolve; dropwise adding a sodium carbonate solution into the system for reaction, centrifuging to obtain a precipitate after the reaction is finished, and washing and dispersing the precipitate to obtain a Beads dispersion liquid;
s2: taking an emulsifier as an oil phase liquid, respectively dropwise adding the purified Im7 protein obtained in the step (2) and the Beads dispersion liquid into the oil phase liquid, and emulsifying to obtain a primary emulsion; dropwise adding the PC solution into the primary emulsion, stirring for reaction, centrifugally collecting precipitate after the reaction is finished, washing to obtain Im7-Beads, and adding Na3And N, storing.
3. The method for the isolation and enrichment of enveloped viruses based on the CL7-CVN and Im7 system of claim 2, wherein in the S1 step, the input mass percentage of sodium hexametaphosphate in inulin is 8% -10%.
4. The CL7-CVN and Im7 based method for separation and enrichment of enveloped viruses according to claim 2, wherein in the S1 step, a sodium carbonate solution is added dropwise to adjust the pH to 10 to 10.5, the reaction temperature is controlled to 40 to 50 ℃, the reaction time is 3.5 to 4.0 hours, the pH is adjusted to neutral after the reaction is finished, the solution after the reaction is precipitated with a 95% ethanol solution after the reaction is finished, and the precipitate is washed and dispersed with deionized water.
5. The method for separating and enriching enveloped viruses based on the CL7-CVN and Im7 system as claimed in claim 2, wherein in the S2 step, the binding mass ratio of Im7, Beads and PC is (200-) (300-) (100-) (150-) (0.02-0.025), and the volumes of the Im7 solution, the Beads dispersion and the PC solution are equal.
6. The method for separating and enriching enveloped viruses based on the CL7-CVN and Im7 system as claimed in claim 5, wherein in the step S2, the binding mass ratio of Im7, Beads and PC is (250-.
7. The method for the isolation and enrichment of enveloped viruses based on the CL7-CVN and Im7 system of claim 2, wherein in the S2 step, the emulsification time is 40-60min later; and (3) dropwise adding the PC solution, controlling the temperature of a water bath at 37 ℃, reacting for 40-48h, centrifugally collecting precipitate after the reaction is finished, and washing with isopropanol.
8. The method for the systematic isolation and enrichment of enveloped viruses based on CL7-CVN and Im7 according to claim 1, wherein in step (4), the mass-to-volume ratio of CL7-CVN bound to Im7-Beads is 2.5-20 μmol/mL.
9. The method for the isolation and enrichment of enveloped viruses based on the CL7-CVN and Im7 system of claim 1, wherein the total incubation time in step (4) is 40-100 min.
10. A method for detecting enveloped viruses, which is characterized in that Im7-Beads enriched enveloped virus nucleic acid as claimed in any one of claims 1-9 is extracted, the enriched virus copy number is detected by using fluorescence quantitative PCR, and the enrichment efficiency of enveloped viruses is calculated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010058494.4A CN111206021B (en) | 2020-01-19 | 2020-01-19 | Method for separating, enriching and detecting enveloped viruses based on CL7-CVN and Im7 system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010058494.4A CN111206021B (en) | 2020-01-19 | 2020-01-19 | Method for separating, enriching and detecting enveloped viruses based on CL7-CVN and Im7 system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111206021A true CN111206021A (en) | 2020-05-29 |
| CN111206021B CN111206021B (en) | 2022-03-22 |
Family
ID=70787353
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010058494.4A Active CN111206021B (en) | 2020-01-19 | 2020-01-19 | Method for separating, enriching and detecting enveloped viruses based on CL7-CVN and Im7 system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111206021B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111662934A (en) * | 2020-06-12 | 2020-09-15 | 湖北大学 | Method for producing ethanol by fermenting cellulose with pichia pastoris and application |
| CN112661861A (en) * | 2021-01-26 | 2021-04-16 | 湖北大学 | Recombinant polymerase, encoding gene, preparation method, vector, kit and application |
| CN113355341A (en) * | 2021-05-13 | 2021-09-07 | 湖北省生物农药工程研究中心 | Fusion tag-based chitosanase expression promoting method and recombinant fusion chitosanase |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101104851A (en) * | 2006-07-14 | 2008-01-16 | 金宁一 | Preparation for antiviral protein CV-N |
| CN106986956A (en) * | 2017-04-14 | 2017-07-28 | 西南大学 | A kind of preparation method for being crosslinked synanthrin |
-
2020
- 2020-01-19 CN CN202010058494.4A patent/CN111206021B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101104851A (en) * | 2006-07-14 | 2008-01-16 | 金宁一 | Preparation for antiviral protein CV-N |
| CN106986956A (en) * | 2017-04-14 | 2017-07-28 | 西南大学 | A kind of preparation method for being crosslinked synanthrin |
Non-Patent Citations (4)
| Title |
|---|
| JIE QIAO等: "One-step production of bioactive human lipopolysaccharide binding protein from LPS-eliminated E. coli", 《PROTEIN EXPRESSION AND PURIFICATION》 * |
| WANG, B等: "Design of fusion protein for efficient preparation of cyanovirin-n and rapid enrichment of pseudorabies virus", 《BIOTECHNOLOGY LETTERS》 * |
| 杨清玲等: "《分子生物学实验指导》", 31 December 2016, 中国科学技术出版社 * |
| 马小涵等: "交联菊糖制备工艺的优化及理化性质", 《食品与机械》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111662934A (en) * | 2020-06-12 | 2020-09-15 | 湖北大学 | Method for producing ethanol by fermenting cellulose with pichia pastoris and application |
| CN112661861A (en) * | 2021-01-26 | 2021-04-16 | 湖北大学 | Recombinant polymerase, encoding gene, preparation method, vector, kit and application |
| CN113355341A (en) * | 2021-05-13 | 2021-09-07 | 湖北省生物农药工程研究中心 | Fusion tag-based chitosanase expression promoting method and recombinant fusion chitosanase |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111206021B (en) | 2022-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111206021B (en) | Method for separating, enriching and detecting enveloped viruses based on CL7-CVN and Im7 system | |
| CN101983238B (en) | Method for concentration of virus | |
| CN112159854B (en) | Primer composition for detecting CRISPR/Cas12a of escherichia coli O157-H7 and detection method | |
| US7754873B2 (en) | Isolation of nucleic acid using colored buffers | |
| CN109402069A (en) | A kind of pseudovirion and its preparation method and application | |
| CA2794710C (en) | Reagent for assaying anti-treponema pallidum antibody | |
| CN112457414A (en) | Cat herpesvirus type I gB-gD recombinant protein and preparation method and application thereof | |
| CN110484516B (en) | Method for marking quantum dots to virus nucleic acid by using CRISPR (clustered regularly interspaced short palindromic repeats) system and application | |
| CN116287139A (en) | Method for detecting staphylococcus aureus | |
| CN109929040B (en) | EB virus BFRF3-BZLF1 fusion protein, gene, vector containing same, host cell, test strip, production method and application thereof | |
| CN110687035A (en) | Annexin V-Light650 apoptosis detection kit | |
| CN107058363A (en) | The method and its application of small-molecule peptide efficient secretory expression are realized based on amyloid | |
| CN114774337A (en) | HCoV-229E virus detection system based on engineering escherichia coli | |
| CN114774425A (en) | MERS-CoV virus detection system based on engineering escherichia coli | |
| CN111518778A (en) | Recombinant RecA enzyme, RAA reaction system, kit and application thereof | |
| CN112457413A (en) | Method for expressing antibacterial peptide by SUMO fusion | |
| CN113740529B (en) | Babesia canis antibody latex agglutination detection kit and preparation method and application thereof | |
| CN116375852B (en) | Recombinant fluorescent nano antibody and application thereof in preparation of rabies virus detection reagent | |
| CN112521463B (en) | Ehrlichia canis MAP2-P30-gp19 recombinant protein and preparation method and application thereof | |
| CN112941079B (en) | Aptamer for high-specificity detection of legionella pneumophila and detection method and application thereof | |
| CN112813197B (en) | Method for detecting coronavirus nucleic acid in situ by molecular beacon based on artificial vesicle | |
| CN113215166B (en) | Nucleic acid aptamer and application thereof | |
| JP5211041B2 (en) | Fusion protein of protein G and avidins | |
| CN109096394B (en) | Nano antibody of B subunit of anti-staphylococcal protein A, nucleic acid molecule and application | |
| WO2024032020A1 (en) | Enhanced monomeric staygold protein and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |