CN109096394B

CN109096394B - Nano antibody of B subunit of anti-staphylococcal protein A, nucleic acid molecule and application

Info

Publication number: CN109096394B
Application number: CN201811106346.4A
Authority: CN
Inventors: 陈波; 罗紫豪
Original assignee: Chengdu Apak Biotechnology Co ltd
Current assignee: Chengdu Apak Biotechnology Co ltd
Priority date: 2018-09-21
Filing date: 2018-09-21
Publication date: 2021-11-05
Anticipated expiration: 2038-09-21
Also published as: CN109096394A

Abstract

The invention discloses a nano antibody for resisting a B subunit of staphylococcal protein A, a nucleic acid molecule and application, and relates to the technical field of genetic engineering antibodies. The amino acid sequence of the nano antibody disclosed by the invention is shown in SEQ ID NO.1, the nano antibody has the activity of being specifically combined with staphylococcal protein A, and has wide application prospects: (1) the kit is used for detecting protein A residue and purification, (2) serving as a universal label for protein purification and detection, and being used for protein purification, (3) used for purifying and detecting B subunit label protein of the protein A; in addition, the nano antibody also has the characteristics of small molecular weight, high affinity, stable structure and performance and the like.

Description

Nano antibody of B subunit of anti-staphylococcal protein A, nucleic acid molecule and application

Technical Field

The invention relates to the technical field of nano antibodies, in particular to a nano antibody for resisting a B subunit of staphylococcal protein A, a nucleic acid molecule and application.

Background

Staphylococcal Protein A (SPA) is a protein isolated from the cell wall of staphylococcus aureus. SPA includes 5 homeodomains, A, B, C, D, E, each with the ability to bind independently to the Fc region of most mammalian iggs. The current alkali-resistant SPA is mainly focused on B domains (B domains or B subunits).

The B subunit is polypeptide containing 58 amino acids, the primary structure does not contain disulfide bonds, the refolding time is only 3 mus, and the refolding capacity is strong; the reporter groups such as fluorescein and biotin can be accurately crosslinked or fused with the specific position of the B subunit without influencing the affinity, so that the reporter groups can be used as a protein label to facilitate the research of protein interaction. However, there is no affinity ligand for the B subunit of staphylococcal protein a on the market, and most mammalian IgG FC ends can serve as affinity ligands for the B subunit, but both have low affinity and weak FC stress tolerance. Secondly, protein A is present in some of the fillers commonly used in the purification of biopharmaceuticals (e.g. antibodies, recombinant proteins, vaccines, etc.). Although the staphylococcal protein A is linked covalently in the filler, it is easily leached out together during elution of the biopharmaceutical by chromatography. The biological medicine is polluted by the staphylococcal protein A, so that a lot of negative effects are generated on the medicine, and in order to reduce the influence of the staphylococcal protein A on the biological medicine, the content of the staphylococcal protein A is a very critical parameter in the purification process of the biological medicine, and a quick and sensitive detection method needs to be established.

Disclosure of Invention

The invention aims to provide a nano antibody for resisting a B subunit of staphylococcal protein A.

It is another object of the present invention to provide an isolated nucleic acid molecule.

It is another object of the present invention to provide a vector.

It is another object of the present invention to provide a host cell.

It is another object of the present invention to provide a conjugate.

The invention also aims to provide a method for preparing the nano antibody.

Another object of the present invention is to provide a reagent for detecting staphylococcal protein A.

The invention also aims to provide application of the nano antibody.

Another objective of the invention is to provide a universal protein purification and detection tag.

The invention is realized by the following steps:

one naturally occurring light chain-deficient antibody, the heavy chain antibody (hcAb), is present in alpaca serum. Single domain heavy chain antibodies (sdabs) refer to genetically engineered antibodies consisting of only heavy chain antibody Variable regions (Variable regions), also known as VHH antibodies (VHH antibodies) or nanobodies (Nb). Compared with the traditional antibody, the single-domain antibody has the advantages of small molecular weight, high stability, good water solubility and the like, and secondly, the light chain is naturally deleted, so that the secondary pollution caused by the shedding of the light chain during elution is avoided like the traditional antibody, therefore, the single-domain antibody can be used as a new generation of affinity purification ligand of staphylococcal protein A and used for the fields of protein purification, protein A detection and the like. The nanometer antibody resisting the B subunit has high affinity, high specificity and high reverse resistance, and is especially suitable for affinity ligand of B domin. However, nanobodies against the B subunit of staphylococcal protein a are currently lacking.

The invention provides a nano antibody which is derived from alpaca serum, is a single domain antibody and has the advantages of small molecular weight, high stability, good water solubility and the like. The nano antibody can be combined with a B subunit of staphylococcal protein A, can be used as a new generation affinity purification ligand of staphylococcal protein A, and is used in the fields of purification, detection and the like of proteins such as staphylococcal protein A.

One aspect of the invention relates to a nano antibody for resisting a B subunit of staphylococcal protein A, and the amino acid sequence of the nano antibody is shown in SEQ ID NO. 1.

Further, in some embodiments of the present invention, the amino acid sequence of the nanobody of the present invention is not limited to the sequence shown in SEQ ID No.1, but may be a derivative sequence obtained by substitution and/or deletion of one or more amino acid residues on the sequence shown in SEQ ID No.1, and having the same biological activity as SEQ ID No.1, such as an activity of specifically binding to staphylococcal protein a or an activity of enhancing or reducing. Such derivative sequences are also within the scope of the present invention.

Another aspect of the invention relates to an isolated nucleic acid molecule encoding the aforementioned nanobody against staphylococcal protein A.

Further, in some embodiments of the invention, the nucleotide sequence of the nucleic acid molecule is as set forth in SEQ ID No. 2.

For those skilled in the art, based on the degeneracy of the codon, it is easy to substitute one or more nucleotides on the basis of the above nucleotide sequence to obtain a derivative sequence, so as to encode the nanobody represented by SEQ ID No.1 provided by the present invention. Therefore, the substitution of one or more nucleotides on the basis of the nucleotide sequence to obtain the corresponding derivative nucleotide sequence for encoding the nanobody provided by the invention also belongs to the protection scope of the invention.

Another aspect of the invention relates to a vector comprising the isolated nucleic acid molecule described above.

Further, in some embodiments of the invention, the vectors described above include, but are not limited to, cloning vectors and expression vectors.

Another aspect of the present invention relates to a host cell comprising the vector described above.

Another aspect of the invention relates to a conjugate comprising the nanobody described above.

Another aspect of the present invention relates to a method for preparing the nanobody, which comprises: culturing the above host cell.

Further, in some embodiments of the present invention, the above preparation method further comprises: and purifying the cell culture to obtain the nano antibody of the B subunit of the anti-staphylococcal protein A.

On the premise of disclosing the amino acid sequence of the nano antibody for resisting B subunit of staphylococcal protein A, the technicians in the field can easily obtain the nano antibody for resisting staphylococcal protein A by methods of genetic engineering technology, chemical synthesis and the like, and the corresponding preparation methods thereof belong to the protection scope of the invention.

Another aspect of the invention relates to a reagent for detecting staphylococcal protein A, which comprises the nanobody or the conjugate.

Another aspect of the invention relates to the application of the anti-staphylococcal protein A nanobody in detecting staphylococci.

The invention further relates to application of the anti-staphylococcal protein A nano antibody in detecting staphylococci by taking the B subunit of the staphylococcal protein A as a target.

The invention further relates to the application of the anti-staphylococcal protein A nanobody as a general protein label in protein purification, co-immunoprecipitation or affinity detection.

The invention further relates to the application of the nano antibody for resisting the B subunit of the staphylococcal protein A as an affinity purification ligand of the B subunit in the purification and detection of the B subunit tagged protein.

The invention further relates to the application of the nano-antibody as an affinity ligand in purifying the B subunit of the staphylococcal protein A.

The invention has the following beneficial effects:

the nano antibody for resisting the B subunit of the staphylococcal protein A provided by the invention has the activity of being specifically combined with the staphylococcal protein A, especially the activity of being combined with the B subunit of the staphylococcal protein A, and has wide application prospects, such as: (1) the kit is used for detecting protein A residue and purification, (2) serving as a universal label for protein purification and detection, and being used for protein purification and detection, (3) used for purifying and detecting a B subunit label protein of the protein A; in addition, the nano antibody also has the characteristics of small molecular weight, high affinity, stable structure and performance and the like.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 shows the result of electrophoresis of an eluate in example 1 of the present invention.

FIG. 2 shows the West-blob detection result in embodiment 4 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

Screening of Nanobodies against subunit B of staphylococcal protein A

1, immunization:

taking healthy adult alpaca, mixing the B subunit of staphylococcal protein A with an adjuvant, immunizing by intradermal or subcutaneous multi-point injection on the back, wherein the immunization program is shown in table 1, and collecting alpaca peripheral blood for constructing a phage display library in the seventh day after the third boosting immunization.

TABLE 1 alpaca immunization procedure

2, alpaca lymphocyte separation:

adding 6mL of lymphocyte separation solution into a 15mL centrifuge tube, adding an equal volume of whole blood sample, and centrifuging at the normal temperature of 800g for 20 min;

carefully sucking the white blood cells suspended in the middle layer into a new centrifugal tube, adding PBS (2 times the volume of the white blood cells) into the centrifugal tube, adding 800g of PBS, and centrifuging the mixture for 15min at normal temperature;

carefully discarding the supernatant, adding erythrocyte lysate, and lysing erythrocytes; centrifuging at normal temperature for 15min at 450g, removing supernatant, counting, and counting according to 10 g⁷One lymph nodeCells were lysed well by adding 2mL Trizol for future use.

3, extracting total RNA:

adding 1/5 volumes of chloroform into the lysate, shaking vigorously for 20s for full emulsification, and standing on ice for 10 min; centrifuging at 4 deg.C and 12000g for 10min, and transferring the supernatant to another fresh centrifuge tube;

adding isopropanol with the same volume, mixing well, and standing on ice for 10 min; centrifuging at 12000g at 4 deg.C for 10min, removing supernatant, adding 75% ethanol, and mixing;

centrifuging at 4 deg.C and 12000g for 10min, and removing supernatant; drying at room temperature for 5min, adding appropriate amount of RNase-free water to dissolve the precipitate, and storing at-80 deg.C after the RAN precipitate is completely dissolved.

4, cDNA synthesis:

the reverse transcription system is as follows:

step 1: the reaction solution was prepared as shown in the following table

Mixing, keeping at 65 deg.C for 5min, and rapidly ice-cooling;

step 2: preparing cDNA reaction solution according to the system in the following table;

after mixing, reverse transcription is carried out according to the following conditions: 10min at 25 ℃; 50min at 50 ℃; 5min at 85 ℃; after centrifugation, 1. mu.L of RNase H37 ℃ was added to each tube for 20 min.

5 antibody Gene amplification

The nested first round PCR system was as follows:

5×HS buffer	10μL
		Alpvh-LD	1μL
CH₂-R	1μL
		enzyme	0.5μL
dNTP	4μL
		cDNA	0.5/1/2/4μL
ddH₂O	Make up to 25 mu L

Reaction procedure: 94 ℃ for 5 min; 30 cycles of 98 ℃ for 10s, 55 ℃ for 15s and 72 ℃ for 1 min; after the reaction is finished, performing gel electrophoresis, and tapping to recover target fragments of about 750 bp.

Wherein: the sequence of Alpvh-LD (5 '-3') is as follows: CTTGGTGGTCCTGGCTGC, respectively;

CH₂-the R sequence (5 '-3') is as follows: GGTACGTGCTGTTGAACTGTTCC are provided.

The nested second round PCR system is as follows

94 ℃ for 5 min; 30 cycles of 98 ℃ for 10s, 57 ℃ for 15s and 72 ℃ for 45 s.

Wherein the sequence (5 '-3') of AlpVh-F1 is as follows:

CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC；

AlpVHH-R1(5’-3’):

CATGCCATGACTCGCGGCCGGCCTGGCCATGGGGGTCTTCGCTGTGGTGCG；

AlpVHH-R2(5’-3’):

CATGCCATGACTCGCGGCCGGCCTGGCCGTCTTGTGGTTTTGGTGTCTTGGG。

and after the second round of reaction is finished, performing gel electrophoresis, recovering a target fragment by using the PCR product recovery kit, wherein the target fragment is about 500bp, and performing double enzyme digestion.

6, constructing a library:

6.1 vector and cleavage of the target fragment

The target fragment double enzyme digestion system (160. mu.L system) is as follows:

segment of interest	15ug
		SfiI enzyme	5μL
ddH₂O	4μL
		cutsmart	10μL
Total	160μL

The digestion was carried out overnight at 50 ℃.

The vector double enzyme system (160. mu.L) was as follows:

pcomb3XSS	50μL(25μg)
		sfiI enzyme	5μL
ddH₂O	90μL
		cutsmart	8μL

6.2 ligation of the vector to the fragment of interest

The 50 μ L ligation system was as follows:

ligation was performed overnight at 16 ℃ and 5. mu.L (1/10 amount) of 3M CH was added₃COONa (pH 5.2) and 125. mu.L (2.5 times) of cold absolute ethanol, standing at-20 deg.C for 30-60min, centrifuging at 12000g to recover precipitate, washing the precipitate with 70% cold ethanol, drying at room temperature, and dissolving in 15. mu.L of deionized water.

7, electric conversion:

(1) melting 1100 μ L of competent cell TG on ice, adding 1 μ L of ligation product, mixing, and standing on ice for 30 min;

(2) transferring the mixed solution into an electric shock cup of 0.2cm, and adjusting electric shock parameters: the voltage is 2.5kV, the electric field intensity is 2.5kV/cm, and the electric shock is converted;

(3) immediately adding 1mL of SOC culture medium into the electric shock cup, suspending cells, and culturing at 37 ℃ for 1h at 180r/min for cell recovery;

(4) resuscitated cultures were diluted in 10-fold gradient and spread evenly on SOB-AG plates and cultured overnight at 37 ℃ in an inverted format.

8, affinity panning of the anti-protein nano antibody:

1) diluting B subunit of staphylococcal protein A with PBS to final concentration of 2 μ g/mL, adding into enzyme-labeled well at 100 μ L/well, and coating at 4 deg.C for 12 h;

2) discarding the coating solution, washing with PBS for 3 times, adding 300 μ L of 3% BSA-PBS blocking solution into each well, and blocking at 37 deg.C for 1 h;

3) PBS wash 6 times, add 100 u L packaging phage library, phage number is about 2X 10¹¹cfu, incubation at 37 ℃ for 1 h;

4) unbound phage were aspirated, washed 10 times with PBST and 3 times with PBS;

5) adding 100 mu L Gly-HCl eluent, incubating at 37 deg.C for 8min, and eluting specifically bound phage; transferring the eluate to a sterile centrifuge tube, and rapidly neutralizing with 50. mu.L of Tris-HCl neutralization buffer;

7) and (3) taking 10 mu L of the eluate, performing gradient dilution, measuring the titer, calculating the elutriation recovery rate, mixing the rest eluates, performing amplification and purification, and using the mixture for the next round of affinity elutriation.

8) The library amplification results were subjected to the next round of panning, with the panning conditions changed, and the panning conditions for each round are shown in table 2.

TABLE 2 affinity panning conditions

9 identification of specific phage clones:

1) from the third round of panning, the eluted product titer plates (colony count 30-200) were picked, 48 single colonies were randomly picked with sterilized toothpicks and inoculated into 1mL of 2 XYT-GA for amplification.

2) Adjusting the pH value of a B subunit of staphylococcal protein A to 14, heating at 100 ℃ for 20min, inactivating, diluting to 2 mu g/mL, adding to an enzyme-labeled hole at 100 mu L/hole, and coating at 4 ℃ for 12 h;

3) discarding the coating solution, washing with PBST for 3 times, adding 300 μ L of 3% skimmed milk into each well, and sealing at 37 deg.C for 2 h;

4) PBST is washed for 3 times, culture supernatant of 100 mu L/hole is added, and incubation is carried out for 1h at 37 ℃;

5) PBST is washed for 5 times, and horseradish peroxidase-labeled anti-M13 antibody (diluted with 3% skimmed milk at a ratio of 1: 5000) is added into the PBST for reaction at a temperature of 100 mu L/hole for 1h at 37 ℃;

6) PBST wash plate 6 times. Adding TMB color developing solution for color development, 100 μ L/well, 37 deg.C, 5min, adding stop solution to stop reaction, 50 μ L/well, and measuring optical density at 450 nm. OD₄₅₀Clones greater than 1.0 were positive.

7) And (3) selecting positive clone for sequencing, wherein the gene sequence is shown as SEQ ID NO.2, and the amino sequence of the coded nano antibody is shown as SEQ ID NO. 1.

10 nano antibody expression and purification of anti-staphylococcal protein A:

(1) subcloning the screened SEQ ID NO.2 into pET-22b⁺On the vector, the restriction sites were NcoI and NotI, and they were designated as VHH-pET22b⁺. Recombinant plasmid VHH-pET22b⁺Transforming Escherichia coli Rosetta DE3 expression strains, selecting a monoclonal strain to inoculate in 4mL LB-Amp culture medium, and culturing at 37 ℃ and 250rpm for 4-5 h;

(2) inoculating 1% (V/V) into 100mL LB-Amp-0.2% Glu medium (shake flask with 500 mL), and culturing at 37 ℃ and 250rpm to OD600 of about 0.5;

(3) adding 0.1mM IPTG to the final concentration, and inducing overnight at 220rpm at 30 ℃;

(4) centrifuging at 12000rpm for 10min, discarding supernatant, collecting thallus, and storing at-20 deg.C;

(5) the above bacteria were added with a binding Buffer (50mM NaH)₂PO₄300mM NaCl); 30mL of Buffer is combined for every 100mL of bacterial liquid;

(6) carrying out ultrasonic crushing on thalli; the ultrasonic conditions are as follows: 25-35 min, 5s ultrasonic interval of 7s and 35% power;

(7) centrifugation at 12000rpm for 20min at 4 ℃ was carried out, and the supernatant was removed and passed through a 0.45 μm filter for purification.

11 purification of Nanobodies against the B subunit of staphylococcal protein A:

(1) all reagents used in the purification process need to pass through a 0.45-micron filter membrane in advance to prevent the column from being blocked;

(2) adding ultrapure water with the volume of 8-10 columns to clean the Ni column;

(3) adding 8-10 column volumes to combine with Buffer (50mM NaH)₂PO₄+500mM NaCl) equilibration column;

(4) adding the sample after the membrane is coated into a Ni column, and collecting effluent liquid;

(5) adding 8-10 column volumes to combine Buffer and column;

(6) eluting the nanobody by binding buffers containing 50mM, 100mM, 250mM and 500mM of imidazole in sequence, wherein the elution volumes of the imidazole concentrations are 5mL, 4mL and 6mL in sequence; collecting the eluent. Electrophoresis was carried out, and the results are shown in FIG. 1. In the figure, M: protein marker, lane 1: purified nanobodies. As can be seen, the molecular weight of the nano antibody is about 15KD, which is consistent with the predicted size.

(7) Adding 5mL of 500mM imidazole solution to thoroughly clean the column;

(8) adding 8-10 column volumes and washing (balancing) a Ni column by combining a Buffer;

(9) cleaning the Ni column by using ultrapure water with the volume of 8-10 columns;

(10) the column was stored in 20% ethanol.

Example 2

This example provides a conjugate containing a nanobody against staphylococcal protein a, which can be used to purify the B subunit of protein a and the tag protein with B subunit. The conjugate comprises the anti-staphylococcal protein A nanobody provided in example 1 and a coupling part, wherein the coupling part is NHS on an agarose microsphere. The preparation method of the conjugate comprises the following steps:

NHS activated agarose was washed 10 times with 0.1M HCl, each time equilibration for 5 min. Coupling buffer 10mM Na₂HPO₄And washing for 10 times at pH 7.4, adding purified 4 mg/mLNHS-activated agarose microspheres of the anti-staphylococcal protein A nanobody, and reacting overnight at 4 ℃ to covalently couple the nanobody to the NHS-activated agarose microspheres.Wash 3 times with the coupled buffer, add 1M Tris buffer pH 8.8, block unreacted active groups. With 10mM Na₂HPO₄Washing for 3 times at pH 7.4 to obtain immunoaffinity adsorption material of B subunit of staphylococcal protein A, i.e. conjugate containing anti-staphylococcal protein A nanometer antibody, adding 20% ethanol into the adsorption material, and storing at 4 deg.C. The immunoaffinity adsorption material can purify and detect the protein with the B subunit label.

Example 3

This example provides a novel universal protein purification and detection tag that allows for convenient purification of proteins with a B subunit, such as staphylococcal protein A. The specific scheme is as follows:

the sequence of SEQ ID NO.2 is cloned between Not I and XhoI restriction sites of a plasmid pet-25b (+), then a target gene is inserted between multiple cloning sites NcoI and NotI, and after the sequencing is correct, the target gene is transferred into a BL21DE3 strain for expression. Then breaking cells, adopting staphylococcal protein A to carry out affinity purification, and adopting pH2.2 Gly-HCL to elute the purified protein to obtain the target protein. This protein can be detected by staphylococcal protein a (hrp conjugated).

Example 4

Universal tag for detecting affinity between proteins

This example provides a convenient and versatile method for studying protein-protein affinity assays. The specific scheme is as follows:

one of the proteins studied was labeled as in example 2, then immobilized to a solid support by a staphylococcal protein a gold membrane, and the interaction force with the other protein or proteins was measured by SPR instrument.

West-blot detection antibody specificity

Transferring 2ng of staphylococcal protein A to PVDF, sealing, adding 0.2 mug/mL purified nano antibody, incubating at room temperature for 2h, adding 1:5000 anti-nano antibody secondary antibody, and incubating at room temperature for 45 min. Then electrophoresis is carried out, and the result is shown in figure 2, and the nano antibody shown in SEQ ID NO.1 can be known from figure 2 to be capable of specifically binding to staphylococcal protein A.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Chengdu Apak Biotechnology Ltd

<120> nano antibody of B subunit of anti-staphylococcal protein A, nucleic acid molecule and application

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 125

<212> PRT

<213> Artificial sequence

<400> 1

Gln Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Val Phe Thr Trp Ser

20 25 30

Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Glu Leu Glu Trp Leu

35 40 45

Ser Gly Ile Ser Phe Arg Gly Asp Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr Leu

65 70 75 80

Gln Leu Asn Ser Leu Lys Thr Glu Asp Thr Ala Met Tyr Tyr Cys Ala

85 90 95

Lys Gly Ser Thr Leu Ala Thr Met Ser Glu Arg Gly Gln Gly Thr Gln

100 105 110

Val Thr Val Ser Ser Ala His His Ser Glu Asp Pro Gln

115 120 125

<210> 2

<211> 375

<212> DNA

<213> Artificial sequence

<400> 2

caggttaaac tggttgaatc tggtggtggt ctggttcagc cgggtggttc tctgcgtctg 60

tcttgcgctg cttctggttt cgttttcacc tggtctggta tgtcttgggt tcgtcaggct 120

ccgggtaaag aactggaatg gctgtctggt atctctttcc gtggtgacac ctactacgct 180

gactctgtta aaggtcgttt caccatctct cgtgacaacg ctaaaaacac cctgtacctg 240

cagctgaact ctctgaaaac cgaagacacc gctatgtact actgcgctaa aggttctacc 300

ctggctacca tgtctgaacg tggtcagggt acccaggtta ccgtttcttc tgctcaccac 360

tctgaagacc cgcag 375

Claims

1. A nano antibody for resisting a B subunit of staphylococcal protein A is characterized in that the amino acid sequence of the nano antibody is shown as SEQ ID NO. 1.

2. An isolated nucleic acid molecule encoding the nanobody of claim 1.

3. The isolated nucleic acid molecule of claim 2, wherein the nucleotide sequence of said nucleic acid molecule is set forth in SEQ ID No. 2.

4. A vector comprising the isolated nucleic acid molecule of claim 2 or 3.

5. A conjugate comprising the nanobody of claim 1.

6. A method of preparing the nanobody of claim 1, comprising: culturing a cell comprising the vector of claim 4.

7. A reagent for detecting staphylococcal protein a, comprising the nanobody of claim 1, or the conjugate of claim 5.

8. Use of the nanobody of claim 1 as a universal tag in protein purification, co-immunoprecipitation and affinity detection.

9. The nanobody of claim 1, used as affinity ligand in the purification of the B subunit of staphylococcal protein a.