CN110484516B - Method for marking quantum dots to virus nucleic acid by using CRISPR (clustered regularly interspaced short palindromic repeats) system and application - Google Patents

Abstract

The invention discloses a method for marking quantum dots to virus nucleic acid by using a CRISPR system and application thereof, relates to the field of viruses, and aims to solve the problem that the infectivity of viruses on host cells is possibly influenced by marking the quantum dots to a pseudorabies virus envelope by adopting the existing method in the visual research of the pseudorabies viruses.

Description

Method for marking quantum dots to virus nucleic acid by using CRISPR (clustered regularly interspaced short palindromic repeats) system and application

Technical Field

The invention relates to the field of viruses, in particular to a method for marking quantum dots to virus nucleic acid by using a CRISPR system.

Background

Alpha herpesvirus (Alpha herpesvirinae) can persist in a latent state in the human peripheral nervous system, and when stimulated by certain factors, can cause various infections of the body, which threatens human health for a long time. Pseudorabies virus (PRV) is a double-stranded positive-strand DNA virus, belongs to the sub-family of alphaherpesviruses, can cause acute infection of livestock and wild animals, wherein pigs are the main host and the infection source of the virus, and has the characteristics of high transmission speed, wide transmission range and high mortality rate. Since the 80 s of the last century, china mainly controls the spread of the virus in pig farms by using a Weak live vaccine Bartha-K61 strain introduced with gE gene deletion in Europe and obtains good effect. However, since the end of 2011, porcine pseudorabies caused by PRV variant strains outbreaks in large areas in multiple provinces in China, which causes huge economic loss. In Antongqing, equal to 2013, in Heilongjiang province, a pig farm suspected of being infected by a PRV variant strain is isolated to obtain an HLJ8 strain, through sequence analysis, the applicant finds that the variant strain has different degrees of difference with US6, UL1, UL27, UL43 and UL44 genes of a classical vaccine strain Bartha-K61, and the 5 fragments are all related to the combination and invasion of viruses. It follows that the variability of these 5 fragments may affect the ability of PRV to infect the virus and directly affect the extent of infection of the host. Therefore, the research on the infection behavior of the PRV to the host cell by an effective method has great significance for deeply revealing the pathogenic mechanism of the PRV.

Single particle tracking technology is a powerful tool for real-time, in-situ monitoring of the dynamic process of virus particles in living cells using fluorescence microscopy. Through software analysis, the movement track and the movement rate of the virus in the host cell can be accurately obtained, the cell entry path, the transport kinetics and the interaction between the virus and the host cell are comprehensively disclosed, and an important basis is provided for the elucidation of the infection mechanism of the virus. Currently, single particle tracer technology has been widely applied to the study of virus infection mechanism. In 2003, the fazenda team at harvard university was first successful in taking dynamic images of influenza virus in cells using this technology, and found that the transport of influenza virus in host cells was mainly dependent on microtubules. Subsequent studies have further revealed two pathways for influenza virus entry into host cells. In 2006, arhel et al, pasteur, france, first analyzed the intracellular transport kinetics of Human Immunodeficiency Virus-1 (Human Immunodeficiency Virus-1, HIV-1) using 4D particle tracing software and found that intracellular HIV-1 was directed towards the nucleus primarily by microtubules and actin. A large number of researches show that the single particle tracing technology is an effective tool and has an important promoting effect on further researching the pathogenic mechanism of the virus.

In order to realize tracing of virus particles, a fluorescent probe is firstly needed to label viruses, and in a common fluorescent probe, an organic fluorescent dye and a fluorescent protein have poor optical stability and low fluorescence intensity, so that long-time tracing of virus particles is difficult to realize. Quantum Dots (QDs) are fluorescent inorganic nanomaterials with diameters of about 2-10 nm. The fluorescent probe has the characteristics of easy surface modification, high fluorescence intensity, good optical stability, adjustable fluorescence emission range, wide excitation spectrum, narrow emission spectrum and the like, and is widely used for the research of cell marking, virus particle tracing and living body imaging. Currently, the commonly used labeling methods for quantum dots to viral particles mainly utilize chemical reactions between proteins and active groups on the surface of quantum dots (click chemistry, amino-carboxyamidation), or utilize affinity labeling between biotin and streptavidin. The biotin and streptavidin have strong non-covalent action, have the advantages of good specificity, strong affinity, high stability, low price and the like, and are the most commonly used biological binding systems. In 2008, joo et al at university of south california introduced a Biotin receptor Peptide (BAP) on the surface of HIV and biotinylated it, followed by labeling streptavidin-modified quantum dots (SA-QDs) onto the surface of the virus. By single particle tracer technology, it was found that HIV enters host cells primarily through clathrin-mediated endocytosis. In 2012, the pompano team of wuhan university labels the biotinylated H9N2 influenza virus envelope and nucleic acid with SA-QDs and the fluorescent dye Syto82, respectively, and this two-color labeling method can study the interaction between viruses and cells at the single viral particle level. In subsequent studies, the team proposed a more convenient strategy for tagging viruses. Biotinylated phospholipid (DSPE-PEG 2000-biotin) was first used to modify cell membrane lipids, and then the cells were infected with the virus. When the progeny virus is assembled and released from the cell, DSPE-PEG2000-biotin can be directly assembled to the viral envelope. Although there are more and more methods for labeling the envelope of the virus, since the envelope protein needs to recognize specific receptors on the surface of the host cell at the initial stage of virus infection, it is very likely that the infection of the host cell by the virus will be affected by modifying the envelope with a fluorescent probe. Therefore, the fluorescent probe is used for marking the nucleic acid in the virus, so that the interaction between the virus and the host cell can be reduced to the maximum extent, the behavior of the virus after the envelope is removed can be traced, and more accurate information is provided for the research of a virus pathogenic mechanism. However, since quantum dots cannot penetrate the envelope of the virus, how to label the viral nucleic acid has been a difficult problem to be studied. In 2013, a Pont-Dynasty team specifically labels QDs to genome RNA of HIV lentivirus by means of a DNA probe, so that quantum dots can be assembled and released together with the genome RNA in cells, and the labeling of the quantum dots to virus nucleic acid is realized for the first time. However, this method is cumbersome to operate and has a low labeling efficiency, and more importantly, the DNA probe cannot label double-stranded DNA, and thus cannot label PRV nucleic acid. The development of a virus nucleic acid labeling method with wide application range, high labeling efficiency, strong specificity and simple and convenient operation is a primary task for deeply researching a PRV infection mechanism.

In recent years, the CRISPR system has been widely used in various biological fields as a highly efficient gene editing technique. In this system, cas9 protein and small fragment guide RNA (sgRNA) form Cas9/gRNA, and when the gRNA specifically recognizes a PAM targeting region, the Cas9 protein unwinds double-stranded DNA downstream of PAM, and then the gRNA binds to a target sequence and cleaves the DNA through Cas 9. It was also found that mutations of two amino acids in the Cas9 protein can inactivate its endonuclease activity, which means that the endonuclease activity inactivated Cas9 (dCas 9) protein does not cleave it after sgRNA binding to the target sequence. In 2013, chen et al fused a green fluorescent protein sequence in dCas9, so that the CRISPR system can perform fluorescent labeling on specific nucleic acid sites in cells. Since then, there are several studies to label chromosomal sites using the CRISPR system.

Disclosure of Invention

The invention aims to solve the problem that in the visual research of pseudorabies virus, the infectivity of the virus to host cells is possibly influenced by marking quantum dots on a pseudorabies virus envelope by adopting the existing method at present, and provides a method for marking the quantum dots on virus nucleic acid by using a CRISPR system and application thereof.

The invention discloses a method for labeling quantum dots to viral nucleic acid by using a CRISPR system, which is carried out according to the following steps:

1. construction of pET-28a-rdCas9-BAP-BirA recombinant plasmid: amplifying cDNA of Cas9 by PCR to obtain an N-end modified nuclear localization signal, and modifying another nuclear localization signal and cDNA of biotin receptor peptide Cas9 at the C end; cloning the modified fragment into a pET-28a vector; cloning a biotinylation enzyme sequence containing a T7 promoter onto a pET-28a vector to obtain pET-28a-rdCas9-BAP; amplifying cDNA of Cas9 on pET-28a-rdCas9-BAP-birA, and simultaneously carrying out point mutation twice by adopting a PCR method to inactivate biotinylation enzyme containing a T7 promoter so as to obtain pET-28a-rdCas9-BAP-birA recombinant plasmid;

2. preparation and purification of rdCas9 and gRNA: transforming pET-28a-rdCas9-BAP-birA into E.coli BL21 competent cells, picking positive monoclonals into 5mL LB liquid culture medium containing 10 ug/mL kanamycin, culturing at 37 ℃ and 200r/min, and when OD of bacterial liquid ₆₀₀ After reaching 0.6, adding 0.1mM IPTG and 80 mu M biotin, then placing the bacterial liquid at 16 ℃ for overnight culture, centrifugally collecting bacteria, re-suspending the bacteria by precooled isometric PBS, crushing the bacteria by using an ultrasonic probe in ice bath, centrifugally collecting supernatant after the crushed bacterial liquid is centrifuged at 4 ℃ to obtain biotinylated rdCas9; purifying biotinylated rdCas9 using an AKTA protein purification system to obtain rdCas9-Bio;

wherein, the affinity column selected by the purification system is a HisTrap HP prepacked column, and the eluent is 20mM Tris hydrochloride, 250mM sodium chloride and 300mM imidazole;

gRNA _EGFP and gRNA _US2 The in vitro transcription and purification of (2) are carried out by adopting a gRNA synthesis kit;

3. labeling of PRV nucleic acids with quantum dots: HEK293T cells were plated in T75 flasks and after 80% cells grew, 49.3. Mu.g of rdCas9-Bio and 9.9. Mu.g of gRNA from the previous step _US2 Transfecting with CRISPRMAX transfection reagent, culturing at 37 deg.C for 6 hr, discarding cell culture solution, washing with PBS 3 times, and mixing 20nM streptavidin modified quantum dotsAfter transfection with Lipofectamine 2000, continuously culturing at 37 ℃ for 4 hours, then changing the cell culture solution to DMEM with 2% serum, inoculating HLJ8 strain, continuously culturing at 37 ℃, and collecting cell supernatant every 12 hours until 48 hours; the collected supernatant was mixed at 4 ℃ and centrifuged at 3,000 Xg for 30 minutes, and the supernatant was filtered using a 0.45 μm filter, followed by removal of excess SA-QDs using a 100kDa ultrafiltration centrifuge tube, and the resulting PRV-QDs were resuspended in PBS pH 7.4 and stored at 4 ℃ for further use, completing the labeling of the quantum dots to viral nucleic acids using the CRISPR system.

The invention has the following beneficial effects:

the invention provides a method for marking quantum dots to virus nucleic acid by using a CRISPR system, which is used for researching an infection way and a dynamic process of PRV to host cells. The research result provides a new field for deeply clarifying the pathogenic mechanism of PRV.

In view of the characteristics of excellent specificity and easy reconstruction of a CRISPR system, dCas9 protein marked by quantum dots and gRNA specific to PRV are cotransfected to cells infected with PRV, the virus nucleic acid released into the cells is specifically marked, and then the PRV marked by the quantum dots is obtained through assembly and release. The novel marking method does not modify the envelope of PRV at all, the smaller particle size of the quantum dot does not greatly influence the size of virus particles, and the infection capacity of PRV on host cells can be reduced to the maximum extent. In a word, the method for marking the viral nucleic acid by using the CRISPR system has the characteristics of simple and convenient operation, wide application range, strong specificity and the like, and has wide application prospect; the research on the dynamic process of the quantum marker PRV infecting host cells is helpful for deeply disclosing the pathogenic mechanism of the PRV, which has important significance for promoting the research and development of novel vaccines for porcine pseudorabies and improving the effective prevention and control of China on the porcine pseudorabies.

Drawings

Fig. 1 is a schematic diagram of a method of labeling SA-QDs to viral nucleic acids using CRISPR technology during PRV assembly;

FIG. 2 is a diagram showing the sequencing result of a plasmid expressing recombinant protein rdCas 9-BirA;

FIG. 3 is an electrophoresis diagram of the restriction enzyme identification result of the plasmid expressing recombinant protein rdCas 9-BirA;

FIG. 4 is a SDS-PAGE picture of the recombinant protein rdCas9-BirA after purification;

FIG. 5 is a western blot of the recombinant protein rdCas9-BirA after purification;

FIG. 6 is agarose gel electrophoresis analysis of rCas9-Bio, rdCas9-Bio and gRNA _EGFP (ii) an extracellular gene editing activity profile of (a);

FIG. 7 fluorescence microscopy and flow cytometry analysis of rCas9-Bio and gRNA _EGFP Editing activity maps for intracellular genes; wherein A is a fluorescence microscope analysis result graph; b is a result graph of flow cytometry analysis;

FIG. 8 shows fluorescence microscopy and flow cytometry analysis of rdCas9-bio and gRNA _EGFP Editing activity maps for intracellular genes; wherein A is a fluorescence microscope analysis result graph; b is a result graph of flow cytometry analysis;

FIG. 9 is a photograph taken by transmission electron microscopy of SA-QDs, wild type PRV (HLJ 8 strain) and PRV-QD;

FIG. 10 is a graph of the fluorescence spectra of SA-QDs and PRV-QDs; wherein, the dotted line is the fluorescence spectrum of PRV-QD, which is realized as the fluorescence spectrum of SA-QDs;

FIG. 11 is a graph showing growth curves of wild-type PRV (strain HLJ 8) and PRV-QD, in which 1 is a graph showing wild-type PRV (strain HLJ 8) and 2 is a graph showing PRV-QD;

FIG. 12 is a graph of fluorescence co-localization analysis of wild type PRV (HLJ 8 strain) and PRV-QD after labeling the cyst membrane with DiO; wherein, A is a laser confocal microscope result picture, B is a fluorescence intensity correlation picture, and C is a fluorescence signal co-localization degree analysis picture;

FIG. 13 is a graph of fluorescence co-localization analysis of wild type PRV (strain HLJ 8) and PRV-QD after labeling the envelope with monoclonal antibodies against PRV envelope protein gB; wherein, A is a laser confocal microscope result picture, B is a fluorescence intensity correlation picture, and C is a fluorescence signal co-localization degree analysis picture;

FIG. 14 is a graph of single particle tracer analysis of the manner of invasion of PRV-QDs by Vero cells; wherein, A is a tracing graph of a confocal microscope on virus particles, B is an instantaneous movement rate graph, and in the B graph, 1 is PRV-QD and 2 is DiO;

FIG. 15 is a diagram of single particle tracer analysis of the trafficking pathway of PRV-QD in Vero cells; wherein, A is a tracing graph of a confocal microscope to virus particles, and B is an instantaneous movement rate graph;

FIG. 16 is a graph of single particle tracer analysis of the invasion of PRV-QDs into Vero nuclei; wherein, A is a tracing graph of a confocal microscope to virus particles, and B is an instantaneous movement rate graph.

Detailed Description

The first embodiment is as follows: the method for labeling the quantum dots to the viral nucleic acid by using the CRISPR system of the present embodiment is characterized by being performed according to the following steps:

1. construction of pET-28a-rdCas9-BAP-BirA recombinant plasmid: amplifying cDNA of Cas9 by PCR, modifying a section of nuclear localization signal at the N end of the amplified fragment, and modifying another section of nuclear localization signal and a section of biotin receptor peptide at the C end of the amplified fragment; cloning the modified fragment into a pET-28a vector; cloning a biotinylation enzyme (BirA) sequence containing a T7 promoter onto a pET-28a vector to obtain pET-28a-rdCas9-BAP; amplifying cDNA of Cas9 on pET-28a-rdCas9-BAP-birA, and simultaneously carrying out point mutation twice by adopting a PCR method to inactivate biotinylation enzyme containing a T7 promoter so as to obtain pET-28a-rdCas9-BAP-birA;

2. preparation and purification of rdCas9 and gRNA: transforming pET-28a-rdCas9-BAP-birA into E.coli BL21 competent cells, picking positive monoclonals into 5mL LB liquid culture medium containing 10 ug/mL kanamycin, culturing at 37 ℃ and 200r/min, and when OD of bacterial liquid ₆₀₀ After reaching 0.6, adding 0.1mM IPTG and 80 mu M biotin, then placing the bacterial liquid at 16 ℃ for overnight culture, centrifugally collecting bacteria, re-suspending the bacteria by precooled isometric PBS, crushing the bacteria by using an ultrasonic probe in ice bath, centrifugally collecting supernatant after the crushed bacterial liquid is centrifuged at 4 ℃ to obtain biotinylated rdCas9; purifying biotinylated rdCas9 by using an AKTA protein purification system to obtain rdCas9-Bio;

wherein, the affinity column selected by the purification system is a HisTrap HP prepacked column, and the eluent is 20mM Tris hydrochloride, 250mM sodium chloride and 300mM imidazole;

gRNA _EGFP and gRNA _US2 The in vitro transcription and purification of (A) was performed using a gRNA Synthesis Kit (cat # A29377, full name Precision gRNA Synthesis Kit) using primer sequences such as Seq ID No: 2-7;

3. labeling of quantum dots to PRV nucleic acids: HEK293T cells were plated in T75 flasks and after 80% cells grew, 49.3. Mu.g of rdCas9-Bio and 9.9. Mu.g of gRNA from the previous step _US2 Using CRISPRMAX (product number is CMAX00, no Chinese name, full name of product: lipofectamine) ^TM CRISPRMAX ^TM Cas9 Transfection Reagent) Transfection (Transfection according to the commercial instructions), after 6 hours of incubation at 37 ℃, cell culture fluid was discarded and washed 3 times with PBS, 20nM streptavidin-modified quantum dots were transfected with Lipofectamine 2000 (11668019, no chinese name, full name: lipofectamine ^TM 2000Transfection Reagent) Transfection (Transfection according to the commercial instructions) was continued for 4 hours at 37 ℃, then the cell culture broth was changed to DMEM with 2% serum, and strain HLJ8 (GenBank access No. kt824771, MOI = 10) was added, and continued to be cultured at 37 ℃, and cell supernatant was collected every 12 hours until 48 hours; the collected supernatant was mixed at 4 ℃ and centrifuged at 3,000 Xg for 30 minutes, and the supernatant was filtered using a 0.45 μm filter, followed by removal of excess SA-QDs using a 100kDa ultrafiltration centrifuge tube, and the resulting PRV-QDs were resuspended in PBS pH 7.4 and stored at 4 ℃ for further use, completing the labeling of the quantum dots to viral nucleic acids using the CRISPR system.

The second embodiment is as follows: the first difference between the present embodiment and the specific embodiment is: the sites of the two point mutations are D10A and H840A respectively. The rest is the same as the first embodiment.

The third concrete implementation mode: the first difference between the present embodiment and the specific embodiment is: the amino acid sequence of the nuclear localization signal in the step one is PKKKRKV; the amino acid sequence of the biotin receptor peptide is GLNDIFEAQKIEWHE. The rest is the same as the first embodiment.

The fourth concrete implementation mode: the first difference between the present embodiment and the specific embodiment is: the cDNA of Cas9 on pX330-U6-Chimeric _ BB-CBh-hSpCas9 was amplified by PCR. The rest is the same as the first embodiment.

The fifth concrete implementation mode is as follows: the first difference between the present embodiment and the specific embodiment is: the method for obtaining the cDNA of the Cas9 comprises the following steps: using Cas9-F1:5 'GCTAGCCCCAAGAAGAGAAGAGGAAGGTGGGCCACCATGGACAAG-3' as upstream primer, cas9-R1:5 'CGCTTCAAAAATATCGTTCAGGCCAGCCACCTTCCTTCCTTCTTCTT-3' is taken as a downstream primer, after PCR amplification is carried out according to the following PCR system and PCR amplification conditions, the PCR product is taken as a template, and Cas9-F2:5' GCTAGCCCCAAGAAGAGAAGGAAGGTGGCCACCATGGACAAG-3 ' is taken as an upstream primer, cas9-R2 ' 5' GCGGCCGCTCATTCATGCATCCATTCAATTTTCTGCGCTTCAAAAAAAT-3 ' is taken as a downstream primer to carry out PCR amplification continuously according to the PCR system and the PCR amplification conditions, and the obtained product is the cDNA of the Cas9;

PCR system for cDNA amplification of Cas9 was 50 μ L:

PCR amplification conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s or 15s, extension at 72 ℃ for 5s, 30-35 cycles, and finally extension at 72 ℃ for 5min.

The rest is the same as the first embodiment.

The sixth specific implementation mode: the first difference between the present embodiment and the specific embodiment is: cloning the modified fragment into a pET-28a vector, and specifically operating as follows:

double digestion of cDNA of pET-28a vector and Cas9 with NheI and NotI,

after cloning cDNA containing Cas9 to pET-28a vector, recovering glue, connecting the vector and the cDNA of Cas9 at 16 ℃ overnight by using T4 ligase, transforming the cDNA into DH5 alpha, coating the DH5 alpha on a Kannan resistant solid LB culture dish for culture, performing sequencing identification, and completing the cDNA clone of Cas9 to pET-28a vector after the cDNA clone is qualified.

The rest is the same as the first embodiment.

The seventh concrete implementation mode: the first difference between the present embodiment and the specific embodiment is: cloning the modified fragment into a pET-28a vector, and specifically operating as follows:

respectively carrying out double enzyme digestion on a pET-28a vector and a synthesized biotin receptor peptide containing a T7 promoter by using KpnI and SpeI, cloning the synthesized biotin receptor peptide containing the T7 promoter to the pET-28a vector for gumming recovery, then connecting the vector and the biotin receptor peptide of the T7 promoter at 16 ℃ overnight by using T4 ligase, transforming DH5 alpha, coating the mixture on a Carna-resistant solid LB culture dish for culture, carrying out sequencing identification, and identifying the qualified biotin receptor peptide of the T7 promoter to the pET-28a vector.

The rest is the same as the first embodiment.

The specific implementation mode is eight: the first difference between the present embodiment and the specific embodiment is: using D10A-F:5 'and 3' of GTACTCCATTGGGCTCGCTATCGGCACAAAACAGCG-: 5' CGCTGTTTGTGCCGATAGCGAGCCCAATGGAGTAGC-. And taking the identified plasmid with successful mutation as a template, continuing to take the sequence shown in H840A-F:5' CCGACTACGACGTGGATGCCATCGTGCCCAGTCT-: 5 'AGACTGGCACGATGGCATGGCATGGCATCGTCGTAGTCGG-3' is taken as a downstream primer, PCR amplification is continuously carried out according to the following PCR system and PCR amplification conditions, dpnI is used for removing a template, the product is directly transformed into DH5 alpha, after the product is coated on a Carna resistant solid LB culture dish for culture, a single clone is picked out and sequenced for identification, and the two point mutations are completed when the product is qualified;

the PCR system was 50. Mu.L:

PCR amplification conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s or 15s, extension at 72 ℃ for 5s, 30-35 cycles, and finally extension at 72 ℃ for 5min.

The rest is the same as the first embodiment.

The specific implementation method nine: the first difference between the present embodiment and the specific embodiment is: the HLJ8 strain is a PRV infected HLJ8 strain. The rest is the same as the first embodiment.

The specific implementation mode is ten: the first difference between the present embodiment and the specific embodiment is: the nucleotide sequence of the biotinylation enzyme of the T7 promoter is shown as Seq ID No:1 is the same as the first embodiment.

The concrete implementation mode eleven: the embodiment is the application of the marked virus by adopting the method of the first embodiment, which is used for single particle tracing, in particular to single particle tracing of virus and single particle tracing of pseudorabies virus.

The invention is not limited to the above embodiments, and one or a combination of several embodiments may also achieve the object of the invention.

The beneficial effects of the present invention are demonstrated by the following examples:

example 1

The method for labeling the quantum dots to the virus nucleic acid by the CRISPR system comprises the following steps:

construction of pET-28a-rCas9/rdCas9-BAP-BirA recombinant plasmid: the cDNA of Cas9 on pX 330-U6-nucleic _ BB-CBh-hSpCas9 (purchased from Addge company plasmid # 42230) was amplified by PCR, while a Nuclear Localization Signal (NLS) was modified at the N-terminus of the fragment, another NLS and a biotin receptor peptide (BAP) were modified at the C-terminus. Cloning the amplified fragment into pET-28a vector. In order to carry out biotinylation modification on the Cas9 protein while expressing the protein, a biotinylation enzyme (BirA) sequence (Seq ID No: 1) containing a T7 promoter is cloned into pET-28a-rCas9-BAP obtained in the last step. To label the virus, we performed two point mutations (D10A and H840A) using PCR while amplifying the cDNA of Cas9, and then obtained pET-28a-rdCas9-BAP-birA with inactivated endonuclease activity in the same way.

Preparation and purification of rdCas9/rCas9 and gRNA: pET-28a-rdCas9-BAP-birA or pET-28a-rCas9-BAP-birA is transformed into E.coli BL21 competent cells, and positive monoclonals are picked into 5mL LB liquid medium containing 10. Mu.g/mL kanamycin and cultured at 37 ℃ at 200 r/min. OD of bacterial liquid ₆₀₀ After reaching 0.6, 0.1mM IPTG (isopropyl thiogalactoside), and 80. Mu.M biotin were added. After the bacterial liquid is cultured at 16 ℃ overnight, bacteria are collected by centrifugation, precooled isometric PBS is used for resuspending the bacteria, and an ultrasonic probe is used for crushing the bacteria in an ice bath. The disrupted lysate was centrifuged at 4 ℃ and the supernatant collected and purified using an AKTA protein purification system for biotinylated rdCas9 or rCas9 (rdCas 9-Bio or rCas 9-Bio). The affinity column used in the purification system was a HisTrap HP pre-packed column (purchased from GE Healthcare) and the eluent was 20mM Tris hydrochloride, 250mM sodium chloride and 300mM imidazole. The concentration of the purified rdCas9-Bio or rCas9-Bio was determined after dialysis using the BCA protein assay kit (Thermo Scientific) and identified using SDS-PAGE and western blot (see FIGS. 4 and 5). gRNA _EGFP And gRNA _US2 The in vitro transcription and purification of (A) was performed strictly in accordance with the instructions of the gRNA Synthesis Kit (Invitrogen) (cat # A29377, full name Precision gRNA Synthesis Kit).

rdCas9-Bio, rCas9-Bio and gRNA activity assays: to verify the DNA editing activity of rCas9-Bio and the specificity of the gRNAs, we first linearized pDC315-EGFP with the restriction enzyme ScaI (NEB), and then 300ng of the linearized pDC315-EGFP, 50nM of rCas9-Bio,50nM of the gRNA _EGFP The reaction system was prepared in 20. Mu.L with cutsmart buffer (NEB) in water, and the mixture was digested at 37 ℃ for 2 hours and then analyzed by 1% agarose gel electrophoresis. To further evaluate whether the complex of rCas9-Bio/rdCas9-Bio and gRNA can act on the target gene in the cell, we transfected pDC315-EGFP with lentiviral vector and fluorescence-sorted by flow cytometry to obtain HEK293T cell line that can stably express EGFP. HEK293T-EGFP cells were then plated in six-well plates until the cells grew toAfter 80%, 6.25. Mu.g of rCas9-Bio/rdCas9-Bio and 1.2. Mu.g of gRNA were added _EGFP Transfection of the reagent (Invitrogen) with CRISPRMAX (Cat number CMAX00, no Chinese name; full name: lipofectamine) ^TM CRISPRMAX ^TM Cas9 Transfection Reagent) and cultured at 37 ℃ for 48 hours, followed by detection of changes in fluorescence intensity of HEK293T-EGFP cells using a fluorescence microscope and a flow cytometer, respectively (see fig. 7 and 8).

Labeling of PRV nucleic acids with quantum dots: HEK293T cells were plated in T75 flasks and after 80% cells had grown 49.3. Mu.g dCas9-Bio and 9.9. Mu.g gRNA _US2 Using CRISPRMAX (product number is CMAX00, no Chinese name, full name of product: lipofectamine) ^TM CRISPRMAX ^TM Cas9 Transfection Reagent) Transfection. After 6 hours of incubation at 37 ℃ the cell culture broth was discarded and washed 3 times with PBS, and 20nM streptavidin-modified quantum dots (SA-QDs, 610nM, purchased from GmbH Quantum dot technology development, inc.) were applied to Lipofectamine 2000 (Invitrogen) (11668019, no Chinese name; full name of trade name: lipofectamine) ^TM 2000Transfection Reagent) was cultured at 37 ℃ for 4 hours, and then the cell culture solution was changed to DMEM with 2% serum, and the HLJ8 strain of PRV (GenBank access No. kt824771, MOI = 10) was inoculated and cultured at 37 ℃. Cell supernatants were collected every 12 hours after inoculation, up to 48 hours after inoculation. The collected supernatant was centrifuged at 3,000 Xg for 30 minutes at 4 ℃ and the supernatant was filtered using a 0.45 μm filter, followed by removal of excess SA-QDs using a 100kDa ultrafiltration centrifuge tube, and the resulting PRV-QDs were resuspended in PBS pH 7.4 and stored at 4 ℃ until use, completing the method for labeling quantum dots to viral nucleic acids using the CRISPR system.

Characterization of PRV-QD: the forms of SA-QDs, PRV and PRV-QDs were characterized by transmission electron microscopy, and fluorescence spectra of PRV-QDs and SA-QDs were detected by fluorescence spectrophotometer, respectively (see FIGS. 9 and 10). The change of PRV replication capacity after quantum dot labeling was compared by detecting the virus titer at 0,12,24,48,72, and 96 hours after the Vero cells were inoculated with PRV and PRV-QD, respectively, and plotting the growth curve (see FIG. 11).

Immunofluorescence analysis: the PRV and PRV-QD were respectively dropped onto the adhesion slide, after being coated uniformly, incubated at 37 ℃ for 30 minutes, then washed with precooled PBS, and fixed with 4% paraformaldehyde for 30 minutes. Subsequently, for labeling the viral envelope, the sample was incubated with 5 μ M DiO (cell membrane green fluorescent probe) at room temperature for 15 minutes, rinsed with pre-cooled PBS, air dried and then mounted with an anti-quenching mounting tablet. To specifically label viral envelope proteins and analyze the labeling efficiency of quantum dots for PRV, PRV and PRV-QD were incubated with adherently cultured Vero cells for 1 hour at 4 ℃ and then further incubated for 10 minutes at 37 ℃. The cells were then washed with pre-cooled PBS, fixed with 4% paraformaldehyde at room temperature for 20 minutes, incubated with 0.1% Triton X-100 at room temperature for 20 minutes, and blocked with 1% bovine serum albumin and 10% FBS at room temperature for 30 minutes. After the cells were washed with PBS, they were incubated at 37 ℃ for 2 hours using a monoclonal antibody against PRV envelope protein gB (prepared in the laboratory), and then incubated at 37 ℃ for 45 minutes using Alexa Fluor488 secondary antibody (1. Mu.g/mL), and then precooled PBS was added to the cells and left to test at 4 ℃. Samples were examined using zeiss LSM800 laser confocal and analysed for fluorescence intensity correlation between green fluorescence (DiO or gB) and red fluorescence (PRV-QD) and for fluorescence co-localisation using ImageJ software (see figures 12 and 13).

Single particle tracing of PRV-QD: to study the route of PRV entry into Vero cells, PRV-QD with a DiO-labeled cyst membrane was incubated with adherent Vero cells at 4 ℃ for 30 minutes, then washed 3 times with precooled PBS, then DMEM medium containing 2% fbs was added to the cells, and the cells were placed on a zeiss LSM800 laser confocal microscope with cell incubator for live cell imaging observation. To examine whether PRV was transported along microtubules within Vero cells, vero cells were transfected with pEGFP-MAP4 plasmid, 36 hours after transfection, the cell culture solution was changed to DMEM containing PRV-QD and 2% FBS, and live cells were imaged using a confocal laser microscope. To explore the dynamic process of PRV entry into the nucleus, we incubated PRV-QD with adherent Vero cells for 4 hours at 37 ℃, the supernatant was changed to 2% fbs-containing DMEM medium, and 2 drops of NucBlue Live reagents (Invitrogen) were added to the medium to stain the nucleus, which was then incubated for 30 minutes at 37 ℃ and followed by Live cell imaging using laser confocal microscopy (see fig. 14 to 16).

Sequence listing

<110> Harbin veterinary institute of Chinese academy of agricultural sciences

<120> method for labeling quantum dots to virus nucleic acid by using CRISPR system and application

<160> 7

<210> 1

<211>1131

<212> DNA

<213> Artificial synthesis.

<400> 1

ttaggtaccc gaaattaata cgactcacta taggggaatt gtgagcggat aacaattccc 60

catcttagta tattagttaa gtagccgcca ccatgaagga taacaccgtg ccactgaaat 120

tgattgccct gttagcgaac ggtgaatttc actctggcga gcagttgggt gaaacgctgg 180

gaatgagccg ggcggctatt aataaacaca ttcagacact gcgtgactgg ggcgttgatg 240

tctttaccgt tccgggtaaa ggatacagcc tgcctgagcc tatccagtta cttaatgcta 300

aacagatatt gggtcagctg gatggcggta gtgtagccgt gctgccagtg attgactcca 360

cgaatcagta ccttcttgat cgtatcggag agcttaaatc gggcgatgct tgcattgcag 420

aataccagca ggctggccgt ggtcgccggg gtcggaaatg gttttcgcct tttggcgcaa 480

acttatattt gtcgatgttc tggcgtctgg aacaaggccc ggcggcggcg attggtttaa 540

gtctggttat cggtatcgtg atggcggaag tattacgcaa gctgggtgca gataaagttc 600

gtgttaaatg gcctaatgac ctctatctgc aggatcgcaa gctggcaggc attctggtgg 660

agctgactgg caaaactggc gatgcggcgc aaatagtcat tggagccggg atcaacatgg 720

caatgcgccg tgttgaagag agtgtcgtta atcaggggtg gatcacgctg caggaagcgg 780

ggatcaatct cgatcgtaat acgttggcgg ccatgctaat acgtgaatta cgtgctgcgt 840

tggaactctt cgaacaagaa ggattggcac cttatctgtc gcgctgggaa aagctggata 900

attttattaa tcgcccagtg aaacttatca ttggtgataa agaaatattt ggcatttcac 960

gcggaataga caaacagggg gctttattac ttgagcagga tggaataata aaaccctgga 1020

tgggcggtga aatatccctg cgtagtgcag aaaaataatg agcaataact agcataaccc 1080

cttggggcct ctaaacgggt cttgaggggt tttttgctga aaactagtcg g 1131

<210> 2

<211>21

<212> DNA

<213> Artificial sequence

<220>

<223> nuclear localization signal.

<400> 2

CCCAAGAAGAAGAGGAAGGTG 21

<210> 3

<211>45

<212> DNA

<213> Artificial sequence

<220>

<223> Biotin receptor peptide.

<400> 3

GGCCTGAACGATATTTTTGAAGCGCAGAAAATTGAATGGCATGAA 45

<210> 4

<211>37

<212> DNA

<213> Artificial sequence

<220>

<223> gRNAEGFP-Fwd。

<400> 4

TAATACGACTCACTATAGCTGAAGCACTGCACGCCGT 37

<210> 5

<211>34

<212> DNA

<213> Artificial sequence

<220>

<223> gRNAEGFP-Rev。

<400> 5

TTCTAGCTCTAAAACACGGCGTGCAGTGCTTCAG 34

<210> 6

<211>37

<212> DNA

<213> Artificial sequence

<220>

<223> gRNAUS2-Fwd。

<400> 6

TAATACGACTCACTATAGCCGTGGTCACGCTGATGGA 37

<210> 7

<211>34

<212> DNA

<213> Artificial sequence

<220>

<223> gRNAUS2-Rev。

<400> 7

TTCTAGCTCTAAAACTCCATCAGCGTGACCACGG 34

Claims (10)

1. A method for labeling quantum dots to viral nucleic acids with a CRISPR system, characterized by the following steps:

1. construction of pET-28a-rdCas9-BAP-BirA recombinant plasmid: amplifying the cDNA of the Cas9 by PCR to obtain a modified nuclear localization signal at the N end of the fragment, and modifying another nuclear localization signal and the cDNA of the biotin receptor peptide Cas9 at the C end; cloning the modified fragment into a pET-28a vector to obtain a pET-28a-rCas9-BAP vector; cloning a biotinylation enzyme sequence containing a T7 promoter to a pET-28a-rCas9-BAP carrier to obtain pET-28a-rCas9-BAP-BirA; amplifying cDNA of Cas9 on pET-28a-rCas9-BAP-birA, and simultaneously carrying out point mutation twice by adopting a PCR method to inactivate the endonuclease of the Cas9 protein to obtain pET-28a-rdCas9-BAP-birA;

2. preparation and purification of rdCas9 and gRNA: transformation of pET-28a-rdCas9-BAP-birA intoE. coliIn BL21 competent cells, positive monoclonals were picked up to 5mL of LB liquid medium containing 10. Mu.g/mL kanamycinCulturing at 37 deg.C and 200r/min until OD of bacterial liquid ₆₀₀ After reaching 0.6, adding 0.1mM IPTG and 80 mu M biotin, then placing the bacterial liquid at 16 ℃ for overnight culture, centrifugally collecting bacteria, re-suspending the bacteria by precooled isometric PBS, crushing the bacteria by using an ultrasonic probe in ice bath, centrifugally collecting supernatant after the crushed bacterial liquid is centrifuged at 4 ℃, and obtaining biotinylated rdCas9; purifying biotinylated rdCas9 by using an AKTA protein purification system to obtain rdCas9-Bio;

wherein, the affinity column selected by the purification system is a HisTrap HP prepacked column, and the eluent is 20mM Tris hydrochloride, 250mM sodium chloride and 300mM imidazole;

in vitro transcription and purification of grnas targeting the US2 sequence of PRV was performed using a gRNA synthesis kit;

3. labeling of quantum dots to PRV nucleic acids: laying HEK293T cells in a T75 culture bottle, after the cells grow to 80%, transfecting 49.3 mu g of rdCas9-Bio obtained in the previous step and 9.9 mu g of gRNA of a US2 sequence targeted to PRV by using a CRISPRMAX transfection reagent, after culturing for 6 hours at 37 ℃, discarding cell culture solution, washing for 3 times by using PBS, transfecting 20nM streptavidin-modified quantum dots by using Lipofectamine 2000, continuously culturing for 4 hours at 37 ℃, then changing the cell culture solution into DMEM with 2% serum, inoculating an HLJ8 strain, continuously culturing at 37 ℃, and collecting cell supernatant every 12 hours until 48 hours; and (3) mixing the collected supernatant evenly at 4 ℃, centrifuging at 3,000 Xg for 30 minutes, filtering the supernatant by using a 0.45 mu m filter membrane, then removing excessive streptavidin modified quantum dots by using a 100kDa ultrafiltration centrifuge tube, resuspending the obtained PRV-QD in PBS with pH 7.4, and storing at 4 ℃ for later use, namely finishing the labeling of the quantum dots to viral nucleic acid by using a CRISPR system.

2. The method for labeling quantum dots to viral nucleic acids with CRISPR system according to claim 1, characterized in that the sites of two point mutations are D10A and H840A, respectively.

3. The method for quantum dot labeling with CRISPR system to viral nucleic acids of claim 1 wherein the amino acid sequence of the nuclear localization signal in step one is PKKKRKV; the amino acid sequence of the biotin receptor peptide is GLNDIFEAQKIEWHE.

4. The method for labeling quantum dots to viral nucleic acids with CRISPR system according to claim 1, wherein cDNA of Cas9 on pX 330-U6-polymeric _ BB-CBh-hSpCas9 is amplified by PCR.

5. The method for labeling quantum dots to viral nucleic acid with CRISPR system according to claim 1, characterized in that the cDNA of Cas9 is obtained by: using Cas9-F1:5 'GCTAGCCCCAAGAAGAGAAGAGGAAGGTGGGCCACCATGGACAAG-3' as an upstream primer, cas9-R1:5 'CGCTTCAAAAATATCGTTCAGGCCAGCCACCTTCCTTCCTTCTTCTT-3' is taken as a downstream primer, PCR amplification is carried out according to the following PCR system and PCR amplification conditions, and then the PCR product is taken as a template, and Cas9-F2 is continuously taken as a template: 5 'GCTAGCCCCAAGAAGAGAAGAGGAAGGTGGGCCACCATGGACAAG-3' as upstream primer, cas9-R2:5 'GCGGCCGCTCATTCATGCATCATCATTTTCTGCGCTTCAAAAAAAT-3' is taken as a downstream primer to continue PCR amplification according to the following PCR system and PCR amplification conditions, and the obtained product is the cDNA of the Cas9;

PCR system for cDNA amplification of Cas9 was 50 μ L:

PCR amplification conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s or 15s, extension at 72 ℃ for 5s,30 to 35 cycles, and finally extension at 72 ℃ for 5min.

6. The method of claim 1, wherein the modified fragment is cloned into pET-28a vector by the method comprising the steps of:

use ofNheI andNoti is respectively to pCarrying out double enzyme digestion on the ET-28a carrier and the cDNA of the Cas9,

after cloning the cDNA containing Cas9 to pET-28a vector, gluing and recovering, connecting the vector and the cDNA of Cas9 at 16 ℃ overnight by using T4 ligase, then transforming DH5 alpha, coating the vector on a kanamycin-resistant solid LB culture dish for culture, picking out a single clone and carrying out sequencing identification, and completing the cDNA clone of Cas9 to pET-28a vector after qualified identification.

7. The method of claim 1, wherein the modified fragment is cloned into pET-28a vector by using CRISPR system to label quantum dot to virus nucleic acid, which comprises the following steps:

use ofKpnI andSpei, respectively carrying out double enzyme digestion on a pET-28a vector and a synthesized biotin receptor peptide containing a T7 promoter, cloning the synthesized biotin receptor peptide containing the T7 promoter to the pET-28a vector, carrying out glue recovery, connecting the vector and the biotin receptor peptide containing the T7 promoter at 16 ℃ overnight by using T4 ligase, then transforming DH5 alpha, coating the vector on a kana resistant solid LB culture dish for culture, picking out a single clone, carrying out sequencing identification, and completing cloning of the biotin receptor peptide of the T7 promoter after qualified identification to the pET-28a vector.

8. The method for labeling the quantum dots to the viral nucleic acid by the CRISPR system as claimed in claim 1, wherein the specific operation of performing two point mutations by using the PCR method is as follows: with D10A-F:5 'and 3' of GTACTCCATTGGGCTCGCTATCGGCACAAAACAGCG-: 5' CGCTGTTTGTGCCGATAGCGAGCCCAATGGAGTAC-DpnRemoving a plasmid template, directly transforming a product into DH5 alpha, coating the product on a kana-resistant solid LB culture dish for culture, selecting a monoclonal and carrying out sequencing identification; and taking the identified plasmid with successful mutation as a template, continuing to take the plasmids H840A-F:5' CCGACTACGACGTGGATGCCATCGGTGCCCCAGTCT-: 5 'AGACTGGGGCACGATGGCATGCTCACGTCGTAGTCGG-3' as a downstream primer, the sequence was continued as followsCarrying out PCR amplification on a PCR system and PCR amplification conditions, removing a template by using DpnI, directly converting a product into DH5 alpha, coating the product on a kana resistant solid LB culture dish for culture, picking a monoclonal and carrying out sequencing identification, and finishing two-time point mutation if the identification is qualified;

the PCR system was 50. Mu.L:

PCR amplification conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s or 15s, extension at 72 ℃ for 5s,30 to 35 cycles, and finally extension at 72 ℃ for 5min.

9. Method for quantum dot labeling with CRISPR system to viral nucleic acids according to claim 1 characterized in that the nucleotide sequence of the biotinylation enzyme of T7 promoter is as Seq ID No:1 is shown.

10. Use of a virus marked by the method of claim 1 for single particle tracking.

Images