CN113834930A

CN113834930A - Novel coronavirus neutralizing antibody rapid detection kit based on quantum dot fluorescence and application thereof

Info

Publication number: CN113834930A
Application number: CN202110810070.3A
Authority: CN
Inventors: 范春雷
Original assignee: Hangzhou Meierde Biotechnology Co ltd
Current assignee: Hangzhou Meierde Biotechnology Co ltd
Priority date: 2021-07-18
Filing date: 2021-07-18
Publication date: 2021-12-24

Abstract

The invention belongs to the technical field of biology, and relates to a novel coronavirus neutralizing antibody rapid detection kit based on quantum dot fluorescence and application thereof. The kit comprises related materials such as novel coronavirus spike protein pseudovirus marked by quantum dots, rabbit IgG marked by quantum dots, recombinant human ACE2 protein, anti-human IgG monoclonal antibody, goat anti-rabbit IgG polyclonal antibody, chromatography test paper and the like. The invention quantitatively analyzes whether the anti-new coronavirus S1 protein IgG antibody and the neutralizing antibody are generated in vivo after the infection of the new coronavirus or the vaccination through a ligand-receptor method competition method and a quantum dot fluorescence chromatography, and calculates the inhibition rate of the neutralizing antibody and the yield of the total antibody. Higher yields of total IgG antibodies against the novel coronavirus S protein indicate more antibodies are produced by immunization; higher inhibition by neutralizing antibodies indicates more neutralizing blocking antibodies and greater protection. Thereby judging whether the novel coronavirus is infected or whether the vaccination is successful.

Description

Novel coronavirus neutralizing antibody rapid detection kit based on quantum dot fluorescence and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a novel rapid detection kit for a coronavirus neutralizing antibody based on quantum dot fluorescence and application thereof.

Background

Coronaviruses belong to the phylogenetic group of Coronaviridae (Coronaviridae) coronaviruses (Coronavirus). The coronavirus is positive strand single strand RNA virus with mantle (envelope), the diameter is about 80-120 nm, the genetic material is the largest of all RNA viruses, and the infected host comprises vertebrates such as human, rat, bat, pig, cat, pangolin, dog, wolf, chicken, cattle, snake and bird. 2019 the novel coronavirus (SARS-CoV-19, formerly known by the name 2019-nCoV) is the 7 th coronavirus which can infect human, and the other 6 are HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV and MERS-CoV, respectively. Studies have shown that, among them, SARS-CoV-19, SARS-CoV and HCoV-NL63 infect humans by the virus' envelope spike glycoprotein (S-protein) mediating the interaction of the virus with the ACE2 receptor on the host cell membrane. The common signs of human infection with the novel coronavirus include respiratory symptoms, fever, cough, shortness of breath, dyspnea and the like. In more severe cases, the infection can lead to pneumonia, severe acute respiratory syndrome, renal failure, and even death. Anti-viral IgM antibodies in serum are markers for viral replication and early infection, with subsequent elevation of IgG antibodies, and thus serological IgM/IgG antibodies are often used as indicators for detection of viral infection and to determine recent and past infections. The anti-virus IgG antibody generated after infection usually has the function of preventing the body from being infected again. On the other hand, the most direct and effective method for preventing and treating the new coronary pneumonia is vaccination, and the new coronavirus vaccine is inoculated to induce the organism to generate antibodies for the new coronavirus, so that the organism is protected from being infected by the new coronavirus. However, not all antibodies induced by viruses or vaccines, whether natural immunity after infection with viruses or artificial immunity after vaccination, are protective, but only those antibodies that block the binding of viruses to human cells, which are commonly referred to as neutralizing antibodies. Currently, serological investigation of epidemic diseases in or after an epidemic situation is mainly to detect serum total antibodies; however, if the content of neutralizing antibodies can be detected simultaneously, it is of great significance for prognosis and risk assessment of re-infection. Also, it is important to assess the effectiveness of a vaccine and whether and when it is necessary to re-immunize if the amount of neutralizing antibodies can be detected simultaneously with the detection of total antibodies after vaccination.

Then, how can neutralizing antibodies be detected? The mechanism of the novel coronavirus invading the human body cell is that the novel coronavirus invades the human body cell by the specific binding of the spinous process protein S (ligand) on the surface of the novel coronavirus and an ACE2 receptor on the human cell membrane. Research shows that the S protein of the new coronavirus has very strong binding force with human ACE2 receptor, 15nM affinity (equilibrium dissociation constant) and 10-20 times stronger than SARS virus. The region of the S protein that binds to ACE2 is called the Receptor Binding Domain (RBD). The neutralizing antibody is an antibody which takes RBD as a target and can block the binding of an S protein ligand and an ACE2 receptor. Therefore, we can establish a ligand-receptor competition method detection system to specifically analyze the content of the neutralizing antibody of the new coronavirus in the serum. .

Disclosure of Invention

Aiming at the technical problems in the prior art, the invention provides a novel method for rapidly detecting coronavirus neutralizing antibodies based on quantum dot fluorescence and a kit preparation according to the principle of specific binding of ligands and receptors.

A novel coronavirus spike protein pseudovirus containing marked quantum dots, wherein the preparation method of the mark comprises the following steps:

1) sequentially connecting the C terminal of the novel coronavirus spike protein with an artificially designed sequence containing a transmembrane sequence and a protein fixed-point biotinylation sequence, and marking the sequence as nCoVS-TM-AVI; the artificially designed sequence is subjected to gene synthesis after codon optimization of a host cell and is subcloned under a CMV promoter of a lentivirus expression vector pCDH-CMV-MCS-EF1-copGFP to construct a plasmid for expressing a novel coronavirus spike protein S-fixed point biotinylation sequence fusion protein, and the plasmid is marked as pMLD-nCoVS;

2) co-transfecting the plasmid pMLD-nCoVS constructed in the step 1), a pH1 plasmid and a pH2 plasmid to a lentivirus packaging line cell 293V to prepare nCoVS.CopGFP lentivirus, transfecting a new 293V cell, picking high-expression clone under a fluorescence microscope, and establishing an nCoVS.CopGFP/293V stable transfer cell line;

3) co-transfecting the plasmid pMLD-nCoVS constructed in the step 1), a pH1 plasmid and a pH2 plasmid to the step 2), establishing an nCoVS.copGFP/293V stable cell line, and collecting culture supernatants once after 48 hours and 72 hours of transfection; mixing the supernatants, centrifuging at 4 deg.C and 4000g for 10 min, and removing precipitate; taking the supernatant, centrifuging at 4 ℃ for 20 minutes at 20000g, and discarding the precipitate; taking the supernatant, filtering the supernatant through a filter membrane with the aperture of 0.45 mu m, centrifuging the supernatant for 90 minutes at the temperature of 4 ℃ at 85000g, and discarding the supernatant; precipitating to obtain the novel coronavirus spike protein pseudovirus, and resuspending with PBS (phosphate buffer solution) with pH of 7.4 to prepare pseudovirus suspension containing the novel coronavirus spike protein S with the concentration being not less than 1 mg/ml;

4) purifying the novel coronavirus spike protein pseudovirus resuspension prepared in the step 3) by using magnetic beads coupled with an anti-novel coronavirus spike protein S antibody, and preparing pseudovirus PBS suspension containing the novel coronavirus spike protein S with the concentration being not less than 1 mg/ml;

5) biotinylating the C-terminal of the S protein of the novel coronavirus spike protein pseudovirus prepared in the step 4) by using Biotin protein ligase to obtain a biotinylated novel coronavirus spike protein pseudovirus, and marking the biotinylated novel coronavirus spike protein pseudovirus as nCoVSpsvirus-Biotin;

6) coupling streptavidin SA to the carboxyl quantum dot microspheres to obtain QM-SA; co-incubating nCoVSpsvirus-Biotin obtained in the step 5) with QM-SA to obtain the novel coronavirus spike protein pseudovirus firmly labeled with quantum dots, and labeling the pseudovirus as QM-nCoVSpsvirus.

Wherein, in the step 1), the novel coronavirus Spike protein gene is a gene sequence which is encoded by Spike glycoprotein (GeneID:43740568) in GenBank: NC-045512.2; the artificially designed sequence containing the transmembrane sequence is TLTERLREKISRAFYNHGLLCASYPIPIILFTGFCILACCYPLLKLPL(ACCCTGACAGAGCGGCTGAGAGAGAAGATCAGCCGGGCCTTCTACAACCACGGCCTGCTGTGCGCCTCCTATCCCATCCCTATCATCCTGTTCACAGGCTTTTGTATCCTGGCCTGCTGTTACCCTCTGCTGAAGCTGCCACTG); the protein fixed-point biotinylation sequence is biotin protein ligase BirA, and the recognition site sequence is GLNDIFEAQKIEWHE; the codon-optimized host is human; the nucleic acid sequence of the artificially designed sequence expressing the novel coronavirus spike protein and the protein fixed-point biotinylation sequence label after being optimized by the human host cell codon is shown as SEQ ID NO: 1, and the amino acid sequence of the fusion protein expressed by the constructed plasmid is shown as SEQ ID NO. 2.

The application of the novel coronavirus spike protein pseudovirus containing the marked quantum dots in preparing a novel coronavirus neutralizing antibody rapid detection kit.

In addition, the invention provides a novel kit for rapidly detecting a coronavirus neutralizing antibody based on quantum dot fluorescence.

A novel coronavirus neutralizing antibody rapid detection kit based on quantum dot fluorescence comprises novel coronavirus spike protein pseudoviruses containing marked quantum dots.

Preferably, the kit further comprises an immunochromatographic test strip, wherein the immunochromatographic test strip comprises a bottom lining, a nitrocellulose membrane, a sample pad, a release pad and absorbent paper; the sample pad, the release pad, the nitrocellulose membrane and the absorbent paper are assembled on the bottom lining in a lap joint mode, the release pad and the absorbent paper are respectively overlapped and pressed at two ends of the nitrocellulose membrane, a detection area is formed on the surface of the nitrocellulose membrane, and the sample pad is overlapped and pressed on the release pad; two test line zones (lines T1 and T2) adjacent to the release liner and one control line zone (line C) adjacent to the absorbent paper were provided on the nitrocellulose membrane in the test zone.

The preparation method of the kit comprises the steps of coupling rabbit IgG to carboxyl quantum dot microspheres to obtain QM-RIgG; spray the QM-ncovisrus and QM-rhigg mixture onto a release pad; the detection test paper strip is characterized in that line areas T1, T2 and C are respectively coated with humanized ACE2 protein, anti-human IgG antibody and goat anti-rabbit IgG antibody (GAR) on a nitrocellulose membrane, and a novel neutralizing antibody of the coronavirus spike protein in serum and plasma and a total antibody detection test paper strip are obtained.

The novel serum and plasma coronavirus spike protein neutralizing antibody and total antibody detection test strip is quantitatively analyzed by a dry fluorescence chromatography analyzer; providing indexes such as negative/positive and inhibition rate of a neutralizing antibody, negative/positive and yield rate of an anti-novel coronavirus S protein total IgG antibody;

wherein the inhibition rate of the neutralizing antibody is calculated according to formula 1; the negative/positive judgment of the SARS-CoV-2 neutralizing antibody in the sample can be set according to the inhibition rate, and the specific detection limit can be set in the range of 10-100% inhibition rate;

equation 1:

the negative/positive judgment of the SARS-CoV-2 neutralizing total IgG antibody can be set according to the acquisition rate, and the specific detection limit can be set in the range of the acquisition rate of more than 200%;

equation 2:

the kit is used for evaluating serum protective antibodies of a patient with the new coronary pneumonia after recovery and a vaccinee.

Experiments show that the recombinant human ACE2 protein has strong binding force with S-protein of coronavirus. According to the competitive immunochromatography principle, the fluorescent quantum dots are marked by the novel coronavirus spike protein pseudovirus and sprayed on a release pad of a test strip, and the fluorescent quantum dots can be combined with an anti-novel coronavirus spike protein antibody (including a neutralizing antibody) in a serum or plasma sample and carry the fluorescent quantum dots when in detection; a recombinant human ACE2 protein is coated on a T1 detection line of a test strip, a novel coronavirus spike protein pseudovirus marked by quantum dots in chromatography is captured by combining with a spike protein RBD structure domain (ligand-receptor binding principle), if a detection sample does not contain a neutralizing antibody, a T1 line has a stronger quantum dot fluorescence signal, if the detection sample contains the neutralizing antibody, the quantum dot fluorescence signal of the ACE2 marked by the quantum dots is neutralized, the T1 line quantum dot fluorescence signal is weakened, and the competition relationship is in inverse proportion to the ACE2 protein formation quantity effect; an anti-human IgG antibody is coated on a T2 detection line of the test strip and is used for capturing a human IgG antibody in a chromatography sample, and a novel coronavirus spike pseudovirus marked by a quantum dot in chromatography is captured in the human anti-novel coronavirus spike protein antibody by being combined with a spike protein RBD structure domain (ligand-receptor combination principle); the quantum dot fluorescence signal of the T2 line is stronger if the more antibodies against the novel coronavirus spike protein in the test sample, and the quantum dot fluorescence signal of the T2 line is weaker if the less antibodies against the novel coronavirus spike protein in the test sample.

The invention discloses a method for quickly detecting a novel coronavirus neutralizing antibody based on quantum dot fluorescence and preparation of a kit. The invention quantitatively analyzes whether the anti-new coronavirus S1 protein IgG antibody and the neutralizing antibody are generated in vivo after the infection of the new coronavirus or the vaccination through a ligand-receptor method competition method and a quantum dot fluorescence chromatography, and calculates the inhibition rate of the neutralizing antibody and the yield of the total antibody. Higher yields of total IgG antibodies against the novel coronavirus S protein indicate more antibodies are produced by immunization; higher inhibition by neutralizing antibodies indicates more neutralizing blocking antibodies and greater protection. Therefore, whether the novel coronavirus is infected or whether the vaccination is successful or not is judged, and whether a protective antibody is generated in vivo after the novel coronavirus is infected or the vaccine is vaccinated or not is quantitatively analyzed, so that first-hand data are provided for serological epidemic disease census and vaccination guidance in the later stage of the novel coronavirus.

The invention has the advantages that the principle of the interaction of ligand and receptor is adopted, the neutralizing antibody of the anti-novel coronavirus spike protein in the sample can be detected, and the quantitative analysis of quantum dot fluorescence and the detection of the total antibody of the anti-novel coronavirus spike protein in the sample are combined, besides the advantages of fast, simple, convenient, cheap and stable colloidal gold immunochromatography, the realization of home detection and the like are kept. The invention has another advantage that the novel coronavirus spike pseudovirus is adopted for detection, so that the real condition of the effect of the antibody on the virus can be reflected. The invention can rapidly screen and evaluate whether natural immunity is generated after the infection of new coronavirus and artificial immunity effect after the vaccination.

Drawings

FIG. 1 is a pMLD-nCoVS plasmid map;

FIG. 2 is a diagram of a novel coronavirus neutralizing antibody rapid detection method based on quantum dot fluorescence and a kit principle.

FIG. 3SEQ ID NO: 1

FIG. 4SEQ ID NO 2

FIG. 5 analysis of transmembrane segment of SEQ ID NO. 2 sequence

Detailed Description

The present invention is further illustrated by the following examples, which should not be construed as limiting the scope of the invention.

In the following examples, lentiviral packaging cells 293V were purchased from Biotech, Inc., of the Kyoto, Beijing, Hipposhu industry; the recombinant coronavirus spike protein S1 was provided by Mierde Biotech, Hangzhou.

Example 1 pMLD-nCoVS plasmid construction

The gene designs the nucleic acid sequence of nCoVS-TM-AVI fusion protein, and the sequence is shown as SEQ ID NO: 1 (figure 3), EcoR I and Not I restriction enzymes are respectively designed at two ends, and the amino acid sequence after expression is shown as SEQ ID NO:2 (figure 4); the amino acid sequence was analyzed by protein analysis softwareTMHMM Server v.2.0(http:// www.cbs.dtu.dk/services/TMHMM /) ensures that both the S1 functional domain and the C-terminal biotinylated domain are displayed outside the membrane (FIG. 5); after the gene synthesis sequence, the gene is cloned under the CMV promoter of a lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP by connecting enzyme cutting sites EcoR I and Not I to construct a eukaryotic expression plasmid pMLD-nCoVS (shown in figure 1).

EXAMPLE 2 establishment of nCoVS-TM-AVI. copGFP/293 Stable transgenic cell line

The pMLD-nCoVS plasmid, the pH1 plasmid and the pH2 plasmid are co-transfected into a lentivirus packaging line cell 293V to prepare nCoVS-TM-AVI.CopGFP lentivirus, and then transfected into a HEK293 cell, and the cell is selected and cloned under a fluorescence microscope to establish an nCoVS-TM-AVI.CopGFP/293 stable transfer cell line. The method comprises the following specific steps:

1) cell plating was performed on 5 15cm dis the day before the experiment to ensure that the cells reached 70% -80% confluency before transfection.

2) 1-2 h before transfection, the culture medium in the dish is replaced by a serum-free antibiotic-free DMEM culture medium.

3) A15 mL centrifuge tube was prepared, 5mL of 1 XHBS was added, and then 100. mu.g of pMLD-nCoVS plasmid and 100. mu.g of PH1/PH2 mixed plasmid (PH1: PH 2: 3:1) were sequentially added and gently mixed.

4) 4mL of PEI working solution (10. mu.M) was added, gently mixed, and incubated at 37 ℃ for 20 min.

5) The transfection complex liquid is divided into 5 parts equally, and is added into 5 15cm dish to be transfected evenly, and the complex is distributed evenly by slight shaking.

6) The medium was changed 6h after transfection, with DMEM complete medium (+ 10% FBS + 1% penicillin/streptomycin double antibody).

7) The supernatant was collected after 48h of transfection, centrifuged at 8000g for 15min and frozen in a freezer at-80 ℃.

8) Supernatants were collected at 72h of transfection, and after centrifugation at 8000g for 15min, supernatants collected at 48h of transfection were pooled, passed through a 0.45 μm filter and centrifuged at 85000g for 2 h.

9) The supernatant was discarded and the pellet resuspended in 1mL complete medium (+ 10% FBS + 1% double antibody) and infected with HEK293 cells (1 well in 6-well plates, 60% -70% confluency of cells).

10) Infected HEK293 cells were passaged to 2 6-well plates for 12 wells after 2 days of culture; the single cells to be dispersed form a clone cell mass (about 1 week), and the clone cell mass with high expression of green fluorescent protein is picked under a fluorescence microscope for amplification culture to establish a nCoVS-TM-AVI.

Example 3 preparation of nCoVSpsvirus pseudovirus

1) Co-transfecting a pMLD-nCoVS plasmid and a pH1 plasmid to an nCoVS-TM-AVI. copGFP/293V stable transfer cell line to be established, and collecting culture supernatants once at 48 hours and 72 hours after transfection; mixing the supernatants, centrifuging at 4 deg.C and 4000g for 10 min, and removing precipitate; taking the supernatant, centrifuging at 4 ℃ for 20 minutes at 20000g, and discarding the precipitate; taking the supernatant, filtering the supernatant through a filter membrane with the aperture of 0.45 mu m, centrifuging the supernatant for 90 minutes at the temperature of 4 ℃ at 85000g, and discarding the supernatant; precipitating to obtain the novel coronavirus spike protein pseudovirus, and resuspending the pseudovirus by using a PBS solution with the pH value of 7.4 to prepare a pseudovirus suspension containing the novel coronavirus spike protein S with the concentration being not less than 1 mg/ml.

2) Purifying by using magnetic beads coupled with the novel coronavirus spike protein antibody to prepare novel coronavirus spike protein pseudovirus resuspension; centrifuging the eluted nCoVS pseudovirus suspension at 4 ℃ at 85000g for 90 minutes, and removing the supernatant; the precipitate is resuspended in Biotin protein ligase (BirA enzyme) ligation buffer (10mM ATP,10mM MgOAc, 50. mu. M D-Biotin) to prepare pseudovirus suspension containing novel coronavirus spinous process protein S with concentration ≧ 1 mg/ml. Biotinylating nCoVS pseudovirus site-specific by BirA enzyme according to product instruction, i.e. connecting Biotin to lysine (K) in GLNDIFEAQKIEWHE sequence to obtain biotinylation nCoVS pseudovirus, and marking it as nCoVSpsvirus-Biotin;

example 4 preparation of fluorescence-labeled QM-nCoVSpsvirus and QM-RIgG by Quantum dots

Streptavidin (SA) is coupled to carboxyl quantum dot microspheres, and nCoVSpsvirus-Biotin can firmly mark quantum dot fluorescence through an SA-Biotin system. The method comprises the following specific steps:

1) coupling Streptavidin (SA) to the carboxyl quantum dot microspheres according to the method of the product specification to obtain QM-SA;

2) similarly, rabbit IgG is also coupled to the carboxyl quantum dot microspheres to obtain QM-RIgG which is used for a test strip quality control system;

3) QM-SA and nCoVSvirous-Biotin were mixed at a molar ratio of 1:4 in PBS buffer at pH7.4 (QM-SA was calculated as labeled SA), and incubated at 37 ℃ for 1 hour with shaking at 150rpm to obtain QM-nCoVSvirous;

4)8000g, centrifugation at 4 ℃ for 30 minutes, supernatant removal, precipitation with PB buffer (pH7.0, 1% BSA, 8% sucrose, 0.05% NaN)₃) And (4) resuspending.

Example 5 fast detection method of novel coronavirus neutralizing antibody based on quantum dot fluorescence and preparation of kit

The QM-nCoVSpsvirus and QM-RIgG prepared in the above examples were mixed and sprayed on a release liner, and dried at 37 ℃ for 12 hours for further use.

1) Two detection line zones (lines T1 and T2) adjacent to the release pad and one control line zone (line C) adjacent to the absorbent paper were provided on the nitrocellulose membrane. The recombinant humanized ACE2 protein, the anti-human IgG antibody and the goat anti-rabbit IgG antibody (GAR) are respectively diluted to 0.5mg/mL by coating diluent (150mM PB, pH 7.4), and are respectively and uniformly sprayed and scribed on a nitrocellulose membrane detection line area (T1 and T2 lines) and a control line area (C line) by the membrane liquid amount of 30 mu L/30cm, dried at 37 ℃ for 12h, and sealed for later use.

2) The test paper is prepared by overlapping and assembling a sample pad, a release pad, a nitrocellulose membrane and absorbent paper on a bottom liner, wherein the release pad and the absorbent paper are respectively overlapped and pressed at two ends of the nitrocellulose membrane, a detection area is formed on the surface of the nitrocellulose membrane (a T1 line area is close to the release pad, a T2 line is in the middle, and a C line area is close to the absorbent paper), the sample pad is overlapped and pressed on the release pad, a test paper board is formed after the assembly, the test paper board is cut into a strip shape with the width of 3mm, and the test paper is prepared based on quantum dot fluorescence and used for rapidly detecting the coronavirus neutralizing antibody (figure 2).

Example 6 application of novel coronavirus neutralizing antibody rapid detection kit based on quantum dot fluorescence

The novel kit for rapidly detecting the coronavirus neutralizing antibody based on the quantum dot fluorescence, which is developed based on the technical scheme of the invention, can be applied to rapid detection and evaluation of the serological neutralizing antibody and the total IgG antibody after SARS-CoV-2 infection and novel coronavirus vaccination, and detection samples comprise whole blood, plasma and serum.

The detection result of the kit is quantitatively analyzed by using a dry fluorescence analyzer, and the indexes of the negative/positive inhibition rate of a neutralizing antibody, the negative/positive inhibition rate of an anti-novel coronavirus S protein total IgG antibody, the yield rate and the like are provided.

The inhibition rate of neutralizing antibodies was calculated according to equation 1; the negative/positive judgment of the neutralizing antibody against SARS-CoV-2 in the sample can be set according to the inhibition rate, and the specific detection limit can be set within the range of 10% -100% of the inhibition rate, as shown in Table 1.

TABLE 1 negative/positive determination of SARS-CoV-2 neutralizing antibody in a test sample

The yield of total IgG antibody was calculated according to equation 2; the determination of the negative/positive of SARS-CoV-2S protein total IgG antibody in the sample can be determined based on the yield, as shown in Table 2.

TABLE 2 determination of the Total IgG negative/positive for SARS-CoV-2S protein in the test sample

Taking 7 parts of serum of healthy volunteers without new crown disease history and inoculated with new planted pernicia and 7 parts of serum of volunteers after twice inoculation of new planted pernicia and over 7 days, detecting by using the kit developed by the technical scheme of the invention, and the results are shown in Table 3.

Sequence listing

<110> Hangzhou Meide Biotechnology Ltd

<120> novel rapid detection kit for coronavirus neutralizing antibody based on quantum dot fluorescence and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4103

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaattcatgt tcgtgttcct ggtgctgctg cctctggtgt cctcccagtg tgtgaacctg 60

accaccagaa cccagctgcc tcctgcctac accaatagct tcaccagagg cgtgtactac 120

cccgataagg tgtttaggtc cagcgtgctg cactccaccc aggacctgtt tctgcctttc 180

tttagcaatg tgacctggtt ccacgccatc cacgtgagcg gcaccaacgg caccaagagg 240

tttgacaacc ctgtgctgcc cttcaatgat ggcgtgtact ttgcctccac cgagaagtcc 300

aacatcatca ggggctggat ctttggcacc accctggact ccaagaccca gagcctgctg 360

atcgtgaata acgccaccaa tgtggtcatt aaggtgtgcg agtttcagtt ctgcaatgac 420

cctttcctgg gcgtgtacta tcacaagaac aacaagagct ggatggagag cgagtttaga 480

gtgtacagct ccgccaacaa ttgtaccttt gagtacgtgt cccagccctt cctgatggat 540

ctggagggca agcagggcaa ctttaagaat ctgagagagt ttgtgttcaa gaatatcgac 600

ggctacttca agatctacag caagcacacc cccatcaacc tggtgaggga cctgcctcag 660

ggcttttccg ccctggagcc tctggtggac ctgcccatcg gcatcaacat caccagattc 720

cagaccctgc tggccctgca cagaagctac ctgacccccg gcgattcctc cagcggctgg 780

accgctggcg ccgctgctta ctacgtgggc tacctgcagc ccaggacctt tctgctgaag 840

tacaacgaga acggcaccat caccgacgcc gtggattgcg ccctggaccc tctgtccgag 900

acaaagtgca ccctgaagtc cttcaccgtg gagaagggca tctaccagac cagcaatttc 960

agggtgcagc ccaccgagag catcgtgagg tttcctaata tcaccaacct gtgccctttt 1020

ggcgaggtgt tcaatgccac cagattcgcc agcgtgtacg cctggaatag gaagaggatc 1080

tccaactgcg tggccgacta ctccgtgctg tacaactccg cctcctttag caccttcaag 1140

tgttacggcg tgagccctac caagctgaac gatctgtgct tcaccaacgt gtacgccgac 1200

agctttgtga tcaggggcga cgaggtgaga cagatcgccc ctggccagac cggcaagatc 1260

gccgattaca attacaagct gcctgacgat ttcaccggct gcgtgatcgc ctggaatagc 1320

aacaacctgg atagcaaggt gggcggcaat tacaattacc tgtacaggct gttcagaaag 1380

tccaacctga agcccttcga gagggacatc agcaccgaga tctaccaggc cggcagcacc 1440

ccttgtaatg gcgtggaggg cttcaattgc tacttccccc tgcagagcta cggcttccag 1500

cctaccaatg gcgtgggcta ccagccctac agagtggtgg tgctgagctt cgagctgctg 1560

cacgcccccg ccaccgtgtg tggacctaag aagagcacca acctggtgaa gaataagtgt 1620

gtgaacttca attttaacgg cctgaccggc accggcgtgc tgaccgagtc caataagaag 1680

tttctgcctt tccagcagtt tggcagggac atcgccgaca ccaccgatgc cgtgagggac 1740

ccccagaccc tggagatcct ggacatcacc ccctgcagct ttggcggcgt gagcgtgatc 1800

acccctggca ccaacaccag caatcaggtg gccgtgctgt accaggacgt gaattgcacc 1860

gaggtgcccg tggccatcca cgccgatcag ctgaccccca cctggagggt gtacagcacc 1920

ggcagcaatg tgtttcagac cagggccggc tgcctgatcg gcgctgagca cgtgaataat 1980

tcctacgagt gtgacatccc tatcggcgcc ggcatctgcg cctcctacca gacccagacc 2040

aattccccca gaagagccag atccgtggcc agccagagca tcatcgccta caccatgtcc 2100

ctgggcgccg agaacagcgt ggcctacagc aataatagca tcgccatccc caccaatttt 2160

accatcagcg tgaccaccga gatcctgcct gtgtccatga ccaagaccag cgtggattgc 2220

accatgtaca tctgcggcga ttccaccgag tgcagcaatc tgctgctgca gtacggcagc 2280

ttctgcaccc agctgaacag ggccctgacc ggcatcgccg tggagcagga caagaacacc 2340

caggaggtgt tcgcccaggt gaagcagatc tacaagaccc ctcccatcaa ggatttcggc 2400

ggcttcaact tcagccagat cctgcctgat cctagcaagc ccagcaagag atcctttatc 2460

gaggatctgc tgttcaataa ggtgaccctg gccgacgccg gcttcatcaa gcagtacggc 2520

gactgtctgg gcgacatcgc cgccagggat ctgatctgcg cccagaagtt caacggcctg 2580

accgtgctgc cccccctgct gacagacgag atgatcgccc agtacaccag cgccctgctg 2640

gccggaacca tcacctccgg ctggaccttc ggcgccggag ctgctctgca gatccccttt 2700

gccatgcaga tggcctacag gtttaacggc atcggcgtga cccagaacgt gctgtacgag 2760

aatcagaagc tgatcgccaa ccagttcaat agcgccatcg gcaagatcca ggactccctg 2820

tccagcaccg cctccgccct gggaaagctg caggacgtgg tgaatcagaa cgcccaggcc 2880

ctgaataccc tggtgaagca gctgtcctcc aattttggcg ccatctccag cgtgctgaat 2940

gatatcctga gcagactgga taaggtggag gccgaggtgc agatcgacag gctgatcacc 3000

ggcagactgc agagcctgca gacctacgtg acccagcagc tgatcagggc cgccgagatc 3060

agagccagcg ccaacctggc cgccaccaag atgtccgagt gtgtgctggg ccagtccaag 3120

agagtggact tttgcggcaa gggctaccac ctgatgagct tccctcagag cgccccccac 3180

ggcgtggtgt ttctgcacgt gacctacgtg cctgcccagg agaagaactt taccaccgcc 3240

cctgccatct gtcacgatgg caaggcccac ttccctaggg agggcgtgtt tgtgagcaac 3300

ggcacccact ggttcgtgac ccagagaaac ttttacgagc cccagatcat caccaccgac 3360

aacacctttg tgtccggcaa ttgcgacgtg gtcattggca tcgtgaataa caccgtgtac 3420

gaccccctgc agcctgagct ggatagcttc aaggaggagc tggacaagta ctttaagaat 3480

cacacctccc ctgatgtgga cctgggcgat atctccggca tcaatgccag cgtggtgaac 3540

atccagaagg agatcgacag actgaatgag gtggccaaga atctgaatga gagcctgatc 3600

gacctgcagg agctgggcaa gtacgagcag tacatcaagt ggccctggta catctggctg 3660

ggctttatcg ccggcctgat cgccatcgtg atggtgacca tcatgctgtg ttgtatgacc 3720

agctgttgca gctgcctgaa gggctgttgc agctgtggct cctgttgtaa gtttgatgag 3780

gatgattccg agcccgtgct gaagggcgtg aagctgcact acaccggctc cggcggctcc 3840

ggaggaagcg ctggaggagg actgaacgat atctttgagg cccagaagat cgagtgggga 3900

tccaccctga cagagcggct gagagagaag atcagccggg ccttctacaa ccacggcctg 3960

ctgtgcgcct cctatcccat ccctatcatc ctgttcacag gcttttgtat cctggcctgc 4020

tgttaccctc tgctgaagct gccactggga ctgaacgata tcttcgaggc ccagaagatc 4080

gagtggcacg agtaggcggc cgc 4103

<210> 2

<211> 1363

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val

1 5 10 15

Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe

20 25 30

Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu

35 40 45

His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp

50 55 60

Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp

65 70 75 80

Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu

85 90 95

Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser

100 105 110

Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile

115 120 125

Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr

130 135 140

Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr

145 150 155 160

Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu

165 170 175

Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe

180 185 190

Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr

195 200 205

Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu

210 215 220

Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr

225 230 235 240

Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser

245 250 255

Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro

260 265 270

Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala

275 280 285

Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys

290 295 300

Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val

305 310 315 320

Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys

325 330 335

Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala

340 345 350

Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu

355 360 365

Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro

370 375 380

Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe

385 390 395 400

Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly

405 410 415

Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys

420 425 430

Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn

435 440 445

Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe

450 455 460

Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys

465 470 475 480

Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly

485 490 495

Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val

500 505 510

Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys

515 520 525

Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn

530 535 540

Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu

545 550 555 560

Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val

565 570 575

Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe

580 585 590

Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val

595 600 605

Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile

610 615 620

His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser

625 630 635 640

Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val

645 650 655

Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala

660 665 670

Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala

675 680 685

Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser

690 695 700

Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile

705 710 715 720

Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val

725 730 735

Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu

740 745 750

Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr

755 760 765

Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln

770 775 780

Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe

785 790 795 800

Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser

805 810 815

Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly

820 825 830

Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp

835 840 845

Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu

850 855 860

Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly

865 870 875 880

Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile

885 890 895

Pro Phe Ala Met Met Ala Gly Ala Tyr Arg Phe Asn Gly Ile Gly Val

900 905 910

Thr Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe

915 920 925

Asn Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser

930 935 940

Ala Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu

945 950 955 960

Asn Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser

965 970 975

Val Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val

980 985 990

Gln Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr

995 1000 1005

Val Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn

1010 1015 1020

Leu Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys Arg

1025 1030 1035 1040

Val Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro Gln Ser

1045 1050 1055

Ala Pro His Gly Val Val Phe Leu His Val Thr Tyr Val Pro Ala Gln

1060 1065 1070

Glu Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His Asp Gly Lys Ala

1075 1080 1085

His Phe Pro Arg Glu Gly Val Phe Val Ser Asn Gly Thr His Trp Phe

1090 1095 1100

Val Thr Gln Arg Asn Phe Tyr Glu Pro Gln Ile Ile Thr Thr Asp Asn

1105 1110 1115 1120

Thr Phe Val Ser Gly Asn Cys Asp Val Val Ile Gly Ile Val Asn Asn

1125 1130 1135

Thr Val Tyr Asp Pro Leu Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu

1140 1145 1150

Leu Asp Lys Tyr Phe Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly

1155 1160 1165

Asp Ile Ser Gly Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu Ile

1170 1175 1180

Asp Arg Leu Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp

1185 1190 1195 1200

Leu Gln Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro Trp Tyr

1205 1210 1215

Ile Trp Leu Gly Phe Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr

1220 1225 1230

Ile Met Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Lys Gly Cys

1235 1240 1245

Cys Ser Cys Gly Ser Cys Cys Lys Phe Asp Glu Asp Asp Ser Glu Pro

1250 1255 1260

Val Leu Lys Gly Val Lys Leu His Tyr Thr Gly Ser Gly Gly Ser Gly

1265 1270 1275 1280

Gly Ser Ala Gly Gly Gly Leu Asn Asp Ile Phe Glu Ala Gln Lys Ile

1285 1290 1295

Glu Trp Gly Ser Thr Leu Thr Glu Arg Leu Arg Glu Lys Ile Ser Arg

1300 1305 1310

Ala Phe Tyr Asn His Gly Leu Leu Cys Ala Ser Tyr Pro Ile Pro Ile

1315 1320 1325

Ile Leu Phe Thr Gly Phe Cys Ile Leu Ala Cys Cys Tyr Pro Leu Leu

1330 1335 1340

Lys Leu Pro Leu Gly Leu Asn Asp Ile Phe Glu Ala Gln Lys Ile Glu

1345 1350 1355 1360

Trp His Glu

Claims

1. A novel coronavirus spike protein pseudovirus containing marked quantum dots, wherein the preparation method of the mark comprises the following steps:

2. The novel coronavirus spike pseudovirus of claim 1, characterized in that: in the step 1), the novel coronavirus Spike protein gene is a gene sequence which is encoded by Spike glycoprotein (GeneID:43740568) in NC-045512.2 in GenBank; the artificially designed sequence containing the transmembrane sequence is TLTERLREKISRAFYNHGLLCASYPIPIILFTGFCILACCYPLLKLPL(ACCCTGACAGAGCGGCTGAGAGAGAAGATCAGCCGGGCCTTCTACAACCACGGCCTGCTGTGCGCCTCCTATCCCATCCCTATCATCCTGTTCACAGGCTTTTGTATCCTGGCCTGCTGTTACCCTCTGCTGAAGCTGCCACTG); the protein fixed-point biotinylation sequence is biotin protein ligase BirA, and the recognition site sequence is GLNDIFEAQKIEWHE; the codon-optimized host is human;

wherein, the nucleic acid sequence of the artificially designed sequence expressing the novel coronavirus spike protein and the protein fixed-point biotinylation sequence label after being optimized by the human host cell codon is shown as SEQ ID NO: 1, and the amino acid sequence of the fusion protein expressed by the constructed plasmid is shown as SEQ ID NO. 2.

3. Use of the novel coronavirus spike pseudovirus containing labeled quantum dots according to claim 1 or 2 for preparing a novel coronavirus neutralizing antibody rapid detection kit.

4. A novel coronavirus neutralizing antibody rapid detection kit based on quantum dot fluorescence is characterized in that: a novel coronavirus spike protein pseudovirus comprising the labeled quantum dots according to claim 1 or 2.

5. The kit of claim 4, wherein: the immunochromatography test strip comprises a bottom lining, a nitrocellulose membrane, a sample pad, a release pad and absorbent paper; the sample pad, the release pad, the nitrocellulose membrane and the absorbent paper are assembled on the bottom lining in a lap joint mode, the release pad and the absorbent paper are respectively overlapped and pressed at two ends of the nitrocellulose membrane, a detection area is formed on the surface of the nitrocellulose membrane, and the sample pad is overlapped and pressed on the release pad; two test line zones (lines T1 and T2) adjacent to the release liner and one control line zone (line C) adjacent to the absorbent paper were provided on the nitrocellulose membrane in the test zone.

6. The method of claim 4, wherein the QM-RIgG is obtained by coupling rabbit IgG to carboxyl quantum dot microspheres; spray the QM-ncovisrus and QM-rhigg mixture onto a release pad; the detection test paper strip is characterized in that line areas T1, T2 and C are respectively coated with humanized ACE2 protein, anti-human IgG antibody and goat anti-rabbit IgG antibody (GAR) on a nitrocellulose membrane, and a novel neutralizing antibody of the coronavirus spike protein in serum and plasma and a total antibody detection test paper strip are obtained.

7. The method of using the kit of claim 4, wherein the test strip for detecting neutralizing antibodies and total antibodies against novel coronavirus spike proteins in serum and plasma is quantitatively analyzed by a dry-type fluorescence chromatography analyzer; providing indexes such as negative/positive and inhibition rate of a neutralizing antibody, negative/positive and yield rate of an anti-novel coronavirus S protein total IgG antibody;

equation 1:

the yield of total IgG antibody was calculated according to equation 2; the negative/positive judgment of the SARS-CoV-2 neutralizing total IgG antibody in the detection sample can be set according to the yield, and the specific detection limit can be set in the yield range of more than 200%;

equation 2:

8. use of the kit according to claim 4 for the evaluation of seroprotective antibodies in convalescent patients with new coronary pneumonia and in vaccinees.