CN110687035A

CN110687035A - Annexin V-Light650 apoptosis detection kit

Info

Publication number: CN110687035A
Application number: CN201910956987.7A
Authority: CN
Inventors: 王兴; 杨旭源; 张新慧
Original assignee: Shenyang Ten Thousand Biological Science And Technology Co Ltd
Current assignee: Shenyang Ten Thousand Biological Science And Technology Co Ltd
Priority date: 2019-10-10
Filing date: 2019-10-10
Publication date: 2020-01-14

Abstract

The invention relates to the technical field of medical detection reagents, and discloses an Annexin V-Light 650/PI cell apoptosis detection kit. The kit comprises: (1) DyeLight650 amine reactive dye labeled Annexin V probes; (2) propidium Iodide (PI); (3) and (3) dyeing buffer Binding buffer. The method is characterized in that: the method comprises the steps of preparing Annexin V protein, adding a fluorescent dye DyeLight650 for labeling after purification to obtain Annexin V-Light650, digesting cells to prepare cell suspension, respectively dyeing Annexin V-Light650 and PI, and finally detecting by a flow cytometer to quickly analyze apoptosis. The existing Annexin V detection kit is marked by Fluorescein Isothiocyanate (FITC), and the kit adopts a fluorescent dye Dylight650 to replace FITC, so that green fluorescent protein carried by a cell carrier can be effectively prevented from interfering with the experimental result. The kit also has the advantages of large cell detection amount, simple operation, high sensitivity, strong specificity, good repeatability, reliable result and the like.

Description

Annexin V-Light650 apoptosis detection kit

Technical Field

The invention relates to the technical field of cell biology, in particular to a novel apoptosis detection reagent prepared based on modern biochemical technology and protein technology and a corresponding apoptosis detection kit.

Background

Apoptosis (apoptosis) is the normal death of cells, relates to a series of gene activation, expression, regulation and other effects, does not cause inflammation and self-damage, and is a death process actively strived for cells to better adapt to the living environment. In embryonic development and in vivoThe stability of the environment, the protection of multicellular organisms, external and internal injuries play an important role. The disturbance of the apoptotic process is directly or indirectly related to the development of many diseases, such as tumors, autoimmune diseases, neurodegenerative diseases, and the like. Apoptotic cells have their unique morphological and biochemical characteristics: nuclear chromatin is condensed, and DNA is degraded and broken widely; the cell membrane is completely shrunk and generates the bubbling phenomenon, the cell membrane wraps the organelles and the nuclear fragments to form the nucleosome, the cell is shrunk, and the apoptotic corpuscle is finally formed. The conventional detection methods for apoptosis include morphological observation, agarose gel electrophoresis, end labeling, ELISA, cell analyzer, etc. The Annexin V detection method is designed for the earliest stages of apoptosis, in which asymmetric loss of cytoplasmic membrane phospholipids results in exposure of the intramembrane Phosphatidylserine (PS) from the inner layer to the outer layer of the cell membrane. Annexin V is Ca²⁺The protein dependent on 36KD has high affinity with PS on cell membrane, so that the Annexin V high affinity PS can be used for early detecting the occurrence of apoptosis, has the advantages of large cell processing amount, high sensitivity, rapidness and the like, and is a currently accepted apoptosis cell detection method. However, most of the detection kits available on the market use FITC to label Annexin V, FITC is a green fluorophore, and if the cells to be detected express green fluorescent proteins such as GFP, the apoptosis results are interfered, so that improvement is needed.

Disclosure of Invention

The invention aims to provide an Annexin V-Light 650/PI apoptosis detection kit which is high in sensitivity, strong in specificity, simple to operate, good in repeatability and high in efficiency, and is mainly different from the Annexin V in that a red fluorescent dye Light650 is adopted to mark the Annexin V so as to solve the problems in the background technology.

The purpose of the invention is realized by the following technical scheme:

an Annexin V-Light 650/PI apoptosis detection kit, which comprises: (1) DyeLight650 amine reactive dye labeled Annexin V probes; (2) propidium Iodide (PI); (3) and (3) dyeing buffer Binding buffer. Wherein the annexin V-Light650 can be specifically combined with the everted phosphatidylserines, cells with early apoptosis can be identified, and PI can enter the interior of cells with necrosis or middle and late apoptosis and is combined with nucleic acid in cell nucleus.

As a further embodiment of the invention, a tube containing 80. mu.g/ml Annexin V-Light650 was used.

As a further embodiment of the invention, a tube containing 25. mu.g/ml PI is used.

As a further embodiment of the present invention, a 10 × Binding buffer tube is included.

Compared with the prior art, the invention has the beneficial effects that: at present, various commercially available Annexin V apoptosis detection kits are generally used for carrying out traditional fluorophore FITC labeling on Annexin V, and detection is limited by factors such as green fluorescence, fluorescence intensity, detection sensitivity and the like. The kit adopts unique Annexin V marked by DyeLight650 amine reactive dye (an excellent substitute of FITC) to detect apoptotic cells, and simultaneously contains PI red fluorescent dye for staining necrotic cells. The components in the kit are particularly optimized, so that the kit is particularly suitable for flow cytometry analysis, and has the advantages of high sensitivity, strong specificity, simple operation, good repeatability and high efficiency.

Drawings

FIG. 1 is a flow chart of the construction of inducible prokaryotic expression plasmid PGEX4.1-Annexin V.

FIG. 2 is an electrophoresis diagram of Annexin V protein induced expression. Lane 1: marker, lane 2: post IPTG induction mycoprotein, lane 3: post IPTG induction mycoprotein, lane 4: and (3) after IPTG induction, obtaining mycoprotein.

FIG. 3 is an electrophoresis diagram of Annexin V protein purification. Lane 1: marker, lane 2: before protein purification, lane 3: before protein purification, lane 4: after protein purification, lane 5: and (4) purifying the protein.

FIG. 4 is the analysis of the detection result of the kit of the present invention combined with the detection of apoptosis by flow cytometry. A: THP-1 cells were untreated, B: cisplatin treatment was performed for 12 h. Wherein the lower left quadrant (LL) is live cells, the upper left quadrant (UL) is necrotic cells, the lower right quadrant (LR) is early apoptotic cells, and the upper right quadrant (UR) is late apoptotic cells.

The specific implementation mode is as follows:

the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and of course, the embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the scope of the present invention.

Preparation of Annexin V protein

1. Construction of Annexin V plasmid

Designing two PCR primers according to Annexin V sequence, wherein the forward primer is CGCGGATCCATGGCACAGGTTCTCAGAG, cleavage site BamHI: GGATCC. Reverse primer: CCGCTCGAGTTCTCCACAGAGCAGCAGA, cleavage site XhoI: CTCGAG. And (3) carrying out PCR amplification by taking the cDNA as a template, wherein the amplified product is completely correct through sequencing. The Annexin V DNA fragment is purified by a conventional method, is subjected to double digestion by BamHI and XhoI, and is directionally cloned to a prokaryotic expression vector PGEX4.1 which is also subjected to double digestion by BamHI and XhoI, so that a recombinant plasmid PGEX4.1-Annexin V (see figure 1) is obtained.

2. Preparation of engineering bacteria (Annexin V plasmid transformation competent cell)

Take 200. mu.l of competent cell BL21 suspension from-70 deg.C refrigerator, put on ice and thaw for 1-2 min. Adding plasmid DNA solution (content is not more than 50ng, volume is not more than 10 μ l), shaking gently, and standing on ice for 30 min. Heating in 42 deg.C water bath for 90s, and rapidly freezing on ice for 2min without shaking the bacteria liquid. 200 mul LB liquid culture medium (without antibiotic) is added into the tube, after mixing evenly, the bacteria is cultured for 1h under shaking at the temperature of 37 ℃ and the speed of 225rpm, the bacteria are recovered to the normal growth state, and the antibiotic resistance gene coded by the plasmid is expressed. Shaking the above bacterial liquid, spreading on LB agar plate containing ampicillin (Amp), standing for 30min with front side upward, and performing inverted culture at 37 deg.C for 12-16h after the bacterial liquid is completely absorbed by culture medium. Obtaining the monoclonal bacteria containing the recombinant expression plasmid PGEX4.1-annexinV, namely the engineering bacteria BL 21.

3. Annexin V inducible expression

Picking single colony to 10ml LB liquid culture medium (containing antibiotics), shaking at 37 deg.C, activating overnight; the next day, the activated bacterial liquid was inoculated into 200ml of a medium with ampicillin resistance, the ratio of inoculation was 1:1000, shaking was carried out at 37 ℃ for 4-6 hours, and isopropyl thiogalactoside (IPTG,1:1000) was added as an inducer to induce expression overnight at 20-25 ℃ at room temperature (see FIG. 2).

4. Annexin V protein purification

And (3) resuspending the centrifuged bacteria with PBS (containing EDTA), centrifuging for 2-3 times at 4 ℃ and 12000rpm for 3-5 min, washing, then resuspending with 20-30 ml of PBS, adding 300 mul of PMSF and 600 mul of Triton-100, carrying out ultrasonic crushing in an ice bath (working: 4s, interval: 4s, power: 20%, time: 20-30min), and taking the bacterium liquid as a basis of becoming transparent and non-sticky. Annexin V protein was filtered through a 0.45 μm filter. Taking out the purification column at 4 ℃, placing the purification column on a conical flask, directly adding 2 column volumes of 1 XPBS buffer solution after the ethanol in the column flows out, adding an antigen protein sample after the ethanol flows out, loading for 2 times, and adding 3 column volumes of 1 XPBS buffer solution. 10ml glutathione eluate was added to the column, 500. mu.l were applied to the first tube and 1ml of each remaining tube. 2ml of 6M guanidine hydrochloride eluent was added, followed by 2 tubes of 1ml each. The column was equilibrated with 3 column volumes of 1 XPBS buffer immediately, followed by 1 column volume of 20% ethanol, leaving the appropriate amount of block. Zero-adjusting with glutathione eluent, and detecting A280. Protein samples were collected and electrophoresed through 10% SDS-PAGE, showing a single protein band by Coomassie blue staining and a gray-scale purity of 98% or more (see FIG. 3, lanes 3 and 4).

Reagent in reagent kit

1. Preparation of fluorescently-labeled Annexin V

Dye preparation: dylight650 reagent is moisture sensitive, and is stored in original container at-20 deg.C and dried with desiccant. To avoid deliquescence of the reagents prior to opening, equilibration to room temperature should be carried out. The reagents were dissolved in DMSO to a final concentration of 10 mg/ml. The fluorescent dye is used for marking Annexin V protein, 0.05M borate buffer solution is used as marking buffer solution, the calculated fluorescent dye is dropwise added into a reaction tube containing the protein while stirring, the mixture is uniformly stirred, and the reaction mixture is incubated for 60min at room temperature in a dark place. 1 XPBS (pH 8) buffer was dialyzed overnight. The labeled protein was removed and stored at 4 ℃. Long-term storage at-20 deg.C. Before use, the solution is diluted with a dilution buffer, often in a dilution ratio of 1: 1000.

2. Preparation of Propidium Iodide (PI)

PI is a nucleic acid dye which cannot pass through normal cell membranes, when cells are in a necrotic or apoptotic middle and late stage state, the cells lose membrane integrity, PI enters the interior of the cells, is combined with nucleic acid in cell nuclei, and is detected by a flow cytometer or a fluorescence microscope to reflect information of the complete state of the cell membranes. Therefore, Annexin V-Light650 was used in combination with PI to differentiate cells at different apoptotic stages. The kit of the invention has a concentration of PI (Sigma) of 25. mu.g/ml, and is prepared with 1 XPBS buffer, and the 1 XPBS formulation is: NaCl: 8g, KCl: 0.20g, Na₂HPO₄×H₂O：3.58g，KH₂PO₄: 0.27g, pH adjusted to 7.4 with NaOH, ddH₂And (5) metering the volume of O to 1000ml, and sterilizing under high pressure.

3. Preparation of binding buffer (10 × binding buffer)

The binding of Annexin V and PS requires the presence of calcium ions, and the formula of a binding buffer solution is as follows: 0.1M Hepes, 1.4M NaCl, 25mM CaCl₂pH adjusted to 7.4, ddH with NaOH₂O is added to the volume of 500 ml.

Three, assemble kit

The prepared fluorescently-labeled Annexin V, Propidium Iodide (PI) and binding buffer (10 XBingding buffer) are respectively loaded into tubes, and one tube is placed in a kit, namely the kit provided by the invention.

The kit can be made into packages with different sizes such as 20T, 50T, 100T and the like according to the requirement of the using amount, wherein the concentration and the volume of the reagent contained in each tube of a small package for 20 experiments are respectively as follows: containing Annexin V-Light 650100. mu.l.times.1 tubes at a concentration of 80. mu.g/ml, PI 200. mu.l.times.1 tubes at a concentration of 25. mu.g/ml and PI 10 ml.times.1 tubes at a concentration of 10. mu.g/ml. By analogy with the dosage ratio, medium-sized kits of 50 times, 100 times and the like can be assembled.

The kit is effective when stored at 4 ℃ in a dark place for 6 months, and can be stored at-20 ℃ if not used for a long time.

Fourth, kit using method

1. Labeling cells

(1) Directly centrifuging the suspension cells (1500rpm, 5min) and collecting; digesting adherent cells by trypsin (which can contain EDTA) for too long time, and adding a complete culture medium to terminate the reaction;

(2) rinsing the cells twice with PBS, counting the cells, centrifuging (1500rpm, 5min) and collecting 1-5 × 10⁵(ii) individual cells;

(3) adding 500. mu.l Binding buffer to resuspend the cells;

(4) 5 mul Annexin V-Light650 is added and mixed evenly to complete the process of cell fluorescent labeling.

2. Flow cytometer detection analysis

And adding 10 mu l of Propidium Iodide into the cell suspension, uniformly mixing, and carrying out a dark reaction at room temperature for 5-15 min. Detecting by a flow cytometer within 1h, detecting Annexin V-Light650 fluorescence signals by a FL4 channel, and detecting propidiumIodide fluorescence signals by a FL2 or FL3 channel; each test requires simultaneous detection of Annexin V-Light650 single positive tubes and Propidium Iodide (PI) single positive tubes for determination of fluorescence compensation values and the position of the cross quadrant gate.

When analyzed, on a sample dual-fluorescently labeled two-dimensional dot-matrix plot (see fig. 4), 4 unique cell populations are shown: (1) a viable cell population (LL quadrant) showing Annexin V-Light650 staining negative PI staining negative; (2) early apoptotic cells (LR quadrant): cells showing Annexin V-Light650 staining positive and PI staining negative; (3) late apoptotic cells (UR quadrants): cells showing double positive Annexin V-Light650 and PI staining; (4) necrotic cells (UL quadrant): shows that Annexin V-Light650 staining is negative and PI staining is positive.

The invention has the advantages and positive effects that:

the kit can effectively and rapidly detect early apoptotic cells, the cells are clearly grouped, fluorescent dye Dylight650 is used for detecting the annexin V protein, the green fluorescent protein carried by a cell carrier can be effectively prevented from interfering the experimental result, and convenience is brought to the subsequent detection work. The apoptosis detection kit has the advantages of simple production process, convenient operation, high cell treatment capacity, high sensitivity and the like.

Example 1: preparation of fluorescent marker protein Annexin V-Light650

Taking out the frozen engineering bacteria from a refrigerator at the temperature of 70 ℃ below zero, placing the engineering bacteria at the room temperature for melting, taking the sterilized inoculating loop dipped with bacterial liquid, inoculating the bacterial liquid on a 1.5% LB agarose plate (containing 100 mu g/ml of ampicillin), carrying out overnight culture at the temperature of 37 ℃, selecting a monoclonal, inoculating the monoclonal into 10ml of liquid LB culture liquid containing antibiotic ampicillin (yeast extract powder is 0.05%, tryptone is 0.1%, sodium chloride is 0.1%, and pH is neutral), culturing for 12h at the temperature of 37 ℃ to serve as seed liquid, then inoculating the seed liquid into the LB culture liquid according to the proportion of 1:1000 for amplification culture, carrying out shake culture at the temperature of 37 ℃ for 4-6h, adding an inducer IPTG into the bacterial liquid according to the proportion of 1:1000, and inducing protein expression overnight at the room temperature.

Centrifuging the bacteria liquid after heat induction culture at 12000rpm for 5min to collect thalli, adding PBS buffer solution to resuspend cells, washing for 3 times, adding a small amount of PBS to resuspend the washed cells, then adding PMSF and Triton-100, performing conventional ultrasonic disruption, and filtering with a 0.45-micrometer filter membrane to remove impurities. The purification column was washed with PBS buffer, drained, and protein samples were added, loaded 2 times, and PBS buffer (3 column volumes) was added. 10ml glutathione eluate was added to the column, 500. mu.l were applied to the first tube and 1ml of each remaining tube. Then 2ml of 6M guanidinium hydrochloride eluent was added, followed by 2 tubes. 1ml per tube.

And (3) carrying out ultrafiltration on the purified Annexin V protein, centrifuging at a low temperature of 8000rpm, carrying out ultrafiltration to 2ml, replacing with 0.05M boric acid, and carrying out ultrafiltration to 1 ml. And dropwise adding the calculated fluorescent dye into a reaction tube containing 1ml of Annexin V protein, stirring and dropwise adding, uniformly stirring, and incubating the reaction mixture at room temperature in a dark place for 60 min. The reaction mixture was transferred into a dialysis bag and dialyzed overnight against 1 × PBS (pH 8) buffer. And diluting the labeled Annexin V protein with a dilution buffer according to the ratio of 1:1000, and labeling the cell sample after dilution.

Example 2: detecting apoptosis

Human monocyte (THP-1) is selected, inoculated on a culture plate for overnight culture, added with apoptosis inducer cisplatin (cissplatin), cultured for 12h conventionally, and added with PBS with the same volume as the control group. The cells were collected by centrifugation at 1500rpm for 5min, the supernatant was carefully aspirated, the cells were washed twice with PBS, the cells were collected by centrifugation at 1500rpm for 5min, the supernatant was carefully aspirated, approximately 50. mu.l of PBS remained, and 500. mu.l of BindingBuffer was added to each tube of the cell sample to gently resuspend the cells. Add 5. mu.l Annexin V-FITC and mix well, add 10. mu.l Propidium Iodid and mix well. Incubate for 15min at room temperature in the dark, and then detect by up-flow. The results are shown in FIG. 4, in which the non-induced group of apoptotic cells accounted for 2.9% of the total number of cells tested, and the number of viable cells was 96.1%; the cisplatin-induced apoptotic cells accounted for 17.4% of the total number of cells tested, and the number of viable cells was 75.3%. The live cells, early apoptotic cells, late apoptotic cells and necrotic cells are grouped clearly, so that the kit is a high-sensitivity and rapid apoptosis detection kit.

Sequence listing

<110> Shenyang Wan class Biotech Co., Ltd

<120> Annexin V-Light 650/PI cell apoptosis detection kit

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>963

<212>DNA

<213> human (Homo sapiens)

<400>1

atggcacagg ttctcagagg cactgtgact gacttccctg gatttgatga gcgggctgat 60

gcagaaactc ttcggaaggc tatgaaaggc ttgggcacag atgaggagag catcctgact 120

ctgttgacat cccgaagtaa tgctcagcgc caggaaatct ctgcagcttt taagactctg 180

tttggcaggg atcttctgga tgacctgaaa tcagaactaa ctggaaaatt tgaaaaatta 240

attgtggctc tgatgaaacc ctctcggctt tatgatgctt atgaactgaa acatgccttg 300

aagggagctg gaacaaatga aaaagtactg acagaaatta ttgcttcaag gacacctgaa 360

gaactgagag ccatcaaaca agtttatgaa gaagaatatg gctcaagcct ggaagatgac 420

gtggtggggg acacttcagg gtactaccag cggatgttgg tggttctcct tcaggctaac 480

agagaccctg atgctggaat tgatgaagct caagttgaac aagatgctca ggctttattt 540

caggctggag aacttaaatg ggggacagat gaagaaaagt ttatcaccat ctttggaaca 600

cgaagtgtgt ctcatttgag aaaggtgttt gacaagtaca tgactatatc aggatttcaa 660

attgaggaaa ccattgaccg cgagacttct ggcaatttag agcaactact ccttgctgtt 720

gtgaaatcta ttcgaagtat acctgcctac cttgcagaga ccctctatta tgctatgaag 780

ggagctggga cagatgatca taccctcatc agagtcatgg tttccaggag tgagattgat 840

ctgtttaaca tcaggaagga gtttaggaag aattttgcca cctctcttta ttccatgatt 900

aagggagata catctgggga ctataagaaa gctcttctgc tgctctgtgg agaagatgac 960

taa 963

<210>2

<211>320

<212>PRT

<213> human (Homo sapiens)

<400>2

Met Ala Gln Val Leu Arg Gly Thr Val Thr Asp Phe Pro Gly Phe Asp

1 5 10 15

Glu Arg Ala Asp Ala Glu Thr Leu Arg Lys Ala Met Lys Gly Leu Gly

20 25 30

Thr Asp Glu Glu Ser Ile Leu Thr Leu Leu Thr Ser Arg Ser Asn Ala

35 40 45

Gln Arg Gln Glu Ile Ser Ala Ala Phe Lys Thr Leu Phe Gly Arg Asp

50 55 60

Leu Leu Asp Asp Leu Lys Ser Glu Leu Thr Gly Lys Phe Glu Lys Leu

65 70 75 80

Ile Val Ala Leu Met Lys Pro Ser Arg Leu Tyr Asp Ala Tyr Glu Leu

85 90 95

Lys His Ala Leu Lys Gly Ala Gly Thr Asn Glu Lys Val Leu Thr Glu

100 105 110

Ile Ile Ala Ser Arg Thr Pro Glu Glu Leu Arg Ala Ile Lys Gln Val

115 120 125

Tyr Glu Glu Glu Tyr Gly Ser Ser Leu Glu Asp Asp Val Val Gly Asp

130 135 140

Thr Ser Gly Tyr Tyr Gln Arg Met Leu Val Val Leu Leu Gln Ala Asn

145 150 155 160

Arg Asp Pro Asp Ala Gly Ile Asp Glu Ala Gln Val Glu Gln Asp Ala

165 170 175

Gln Ala Leu Phe Gln Ala Gly Glu Leu Lys Trp Gly Thr Asp Glu Glu

180 185 190

Lys Phe Ile Thr Ile Phe Gly Thr Arg Ser Val Ser His Leu Arg Lys

195 200 205

Val Phe Asp Lys Tyr Met Thr Ile Ser Gly Phe Gln Ile Glu Glu Thr

210 215 220

Ile Asp Arg Glu Thr Ser Gly Asn Leu Glu Gln Leu Leu Leu Ala Val

225 230 235 240

Val Lys Ser Ile Arg Ser Ile Pro Ala Tyr Leu Ala Glu Thr Leu Tyr

245 250 255

Tyr Ala Met Lys Gly Ala Gly Thr Asp Asp His Thr Leu Ile Arg Val

260 265 270

Met Val Ser Arg Ser Glu Ile Asp Leu Phe Asn Ile Arg Lys Glu Phe

275 280 285

Arg Lys Asn Phe Ala Thr Ser Leu Tyr Ser Met Ile Lys Gly Asp Thr

290 295 300

Ser Gly Asp Tyr Lys Lys Ala Leu Leu Leu Leu Cys Gly Glu Asp Asp

305 310 315 320

Claims

1. A kit for detecting apoptosis comprises protein for detection of fluorescent marker, DNA dye and binding buffer solution, and is characterized in that the fluorescent marker is Dylight 650.

2. The apoptosis detection kit of claim 1, wherein the fluorescently labeled detection protein is Annexin V-Light650 and the DNA dye is PI.

3. The method for preparing the protein Annexin V for detecting the apoptosis detection kit of claim 1, which comprises the steps of Annexin V plasmid construction, engineering bacterium preparation, Annexin V induced expression and Annexin V protein purification, and is characterized in that the constructed expression plasmid is PGEX4.1-Annexin V.

4. The method for preparing the protein Annexin V for the detection of the apoptosis detection kit of claim 3, wherein the prepared engineering bacterium is BL21(PGEX4.1-Annexin V).