CN111172249A - rhTSG-6 fluorescent quantitative RT-qPCR detection kit and application thereof - Google Patents

Abstract

The invention discloses an rhTSG-6 fluorescent quantitative RT-qPCR detection kit and application thereof, which detects the phenomenon that the copy number of VSV virus N gene segment nucleic acid in an MDBK cell/VSV system is reduced due to the inhibition effect of an rhTSG-6 protein standard product based on a fluorescent quantitative RT-qPCR method so as to confirm that rhTSG-6 has obvious antiviral activity and dose dependence, and the kit comprises: rhTSG-6 protein standard, recombinant plasmid standard containing VSV N gene segment; RT-PCR reaction solution; the RT-PCR reaction solution is as follows: SYBR Premix Ex Taq 10MIU II (2X) 10. mu.L, 10. mu.M forward primer 0.8. mu.L, 10. mu.M reverse primer 0.8. mu. L, cDNA template 2. mu.L, sterile water was added to 20. mu.L. The rhTSG-6 antiviral activity detection kit has the characteristics of simplicity, convenience, easiness in operation, visual result, high sensitivity, strong specificity, high stability and the like.

Description

rhTSG-6 fluorescent quantitative RT-qPCR detection kit and application thereof

Technical Field

The invention belongs to the technical field of biological detection, relates to an rhTSG-6 fluorescent quantitative RT-qPCR detection kit and application thereof, and particularly relates to the rhTSG-6 fluorescent quantitative RT-qPCR detection kit and application thereof in detection of rhTSG-6 antiviral activity.

Background

tumor necrosis factor α -stimulating gene 6 (TSG-6) is an inflammation-associated secretory protein, is produced by mesenchymal stem cells or stromal cells (MSCs) in response to inflammatory signals, and is highly expressed in a variety of inflammatory diseases or inflammatory-like pathological processes.

more and more researches show that in the inflammation processes of hepatitis, arthritis, retinitis, tissue injury, keloid and the like, TSG-6 has the functions of inhibiting the expression of inflammatory factors TNF- α, IL-1 β, IL-6 and the like, inhibiting neutrophil infiltration and the like, and plays a stronger anti-inflammatory role.

Disclosure of Invention

The invention provides an rhTSG-6 fluorescent quantitative RT-qPCR detection kit and application thereof, in particular to application of rhTSG-6 in detection of antiviral activity. The rhTSG-6 antiviral activity phenomenon detection takes the copy number of the rhTSG-6 virus N gene fragment inhibiting VSV as the result of detecting the activity, namely, the diluted recombinant plasmid standard containing the VSV N gene fragment is taken as a template of the fluorescent quantitative RT-qPCR reaction, and after a reaction program is set, the fluorescent quantitative RT-qPCR reaction is carried out. A standard curve was constructed by using the logarithm of the copy number of a recombinant plasmid containing a VSV N gene fragment as the X-axis and the number of reaction cycles (CT value) as the Y-axis. When the antiviral activity of a sample to be detected is detected, the sample to be detected acts on the MDBK cells for 24h, and then the MDBK cells which act are infected by VSV. Extracting total RNA, and performing reverse transcription to obtain corresponding cDNA for performing fluorescent quantitative RT-qPCR reaction. And obtaining the antiviral activity of the sample to be detected from the standard curve according to the obtained reaction cycle number. The invention detects the phenomenon that the number of copies of the VSV virus N gene segment nucleic acid in an MDBK cell/VSV system is reduced due to the inhibition effect of the rhTSG-6 protein standard substance based on a fluorescent quantitative RT-qPCR method, so as to prove that the rhTSG-6 has obvious antiviral activity and dose dependence.

The kit can accurately quantify VSV virus copy number to reflect rhTSG-6 antiviral activity, overcomes the defect that the common RT-PCR method cannot quantify, and has the characteristics of simplicity, easy operation, visual result, high sensitivity, strong specificity and good re-reading property.

The technical scheme adopted by the invention is as follows:

a fluorescent quantitative RT-qPCR detection kit of recombinant human tumor necrosis factor α induced protein 6 comprises an rhTSG-6 protein standard substance, a recombinant plasmid standard substance containing VSV N gene segments, an RT-PCR reaction solution, a PCR reaction solution and a kit body, wherein the rhTSG-6 protein standard substance is a recombinant plasmid standard substance containing VSV N gene segments;

furthermore, the gene SEQUENCE of the VSV N gene fragment is shown in SEQUENCE testing 400 (4);

the RT-qPCR reaction solution is as follows: SYBR Premix Ex Taq 10MIU II (2X) 10. mu.L, 10. mu.M forward primer 0.8. mu.L, 10. mu.M reverse primer 0.8. mu. L, cDNA template 2. mu.L, sterile water was added to 20. mu.L.

The preparation method of the cDNA comprises the following steps: acting MDBK cells for 24h by using rhTSG-6 protein standard solution, and then infecting the acted MDBK cells by using VSV virus suspension; the total RNA of these infected cells is extracted and then reverse transcribed to obtain cDNA. The titer of the VSV virus suspension is 100TCID₅₀0.1 mL; the time for MDBK cells after VSV virus infection was 24 h.

The upstream primer is as follows: 5'-CGG AAT AAA CAT CGG GAA AG-3', respectively;

the downstream primer is as follows: 5'-CCA AGT AGA TAC AAA GGC AAC C-3' are provided.

The preparation method of the recombinant plasmid standard substance containing the VSV N gene segment comprises the following steps:

(1) amplifying a VSV N gene segment from the VSV virus by using an RT-PCR method by using an upstream primer and a downstream primer;

(2) connecting the VSV N gene segment to pMD18T vector to construct recombinant plasmid pMD18T-VSV N;

(3) the recombinant plasmid pMD18T-VSV N is transformed into Escherichia coli DH5 α, proliferated in LB culture medium containing 100 mu g/mL Amp, extracted by a cracking method, and purified by a kit to obtain a recombinant plasmid standard product containing the VSV N gene segment.

Further, in the step (1), the RT-PCR reaction system is as follows: premix Taq (2X) 12.5. mu.L, 10. mu.M forward primer 0.5. mu.L, 10. mu.M reverse primer 0.5. mu. L, cDNA template 1. mu.L, and sterile water was added to 25. mu.L;

in the step (2), the connection reaction system is as follows: pMD18-T Vector 1. mu.L, VSV N gene fragment 2. mu.L, 5. mu.L of sterile water solution of LSolution I2. mu.L, reaction conditions are 16 ℃ reaction time 2 h.

the invention also provides the application of the fluorescent quantitative RT-qPCR detection kit for the recombinant human tumor necrosis factor α -induced protein 6 in the detection of the rhTSG-6 antiviral activity.

further, the method for detecting the antiviral activity of the rhTSG-6 by using the fluorescent quantitative RT-qPCR detection kit of the recombinant human tumor necrosis factor α induced protein 6 comprises the following steps:

(a) the recombinant plasmid standard containing the VSV N gene fragment was diluted to 2.96X 10⁹、2.96×10⁸、2.96×10⁷、2.96×10⁶、2.96×10⁵、2.96×10⁴、2.96×10³、2.96×10²、2.96×10¹copies/μL；

(b) Setting a reaction program by taking the diluted recombinant plasmid standard containing the VSV N gene segment as a template of the fluorescent quantitative RT-qPCR reaction, and carrying out the fluorescent quantitative RT-qPCR reaction; the fluorescent quantitative RT-qPCR reaction system is as follows: SYBRPremix Ex Taq 10MIU II (2X) 10. mu.L, 10. mu.M upstream primer 0.8. mu.L, 10. mu.M downstream primer 0.8. mu. L, cDNA template 2. mu.L, sterile water to 20. mu.L;

(c) the number of reaction cycles (C) was determined by taking the logarithm of the copy number of a recombinant plasmid containing a VSV N gene fragment as the X axis_TValue) is the Y-axis, a standard curve is constructed;

(d) when the antiviral activity of a sample to be detected is carried out, the sample to be detected acts on MDBK cells for 24h, the MDBK cells which act are infected by VSV, total RNA is extracted, and then cDNA is obtained after reverse transcription; and (c) performing the fluorescent quantitative RT-qPCR reaction in the step (b), and obtaining the antiviral activity of the sample to be detected from the standard curve according to the obtained reaction cycle number.

Further, in the step (b), the fluorescent quantitative RT-qPCR reaction program is as follows: 30S at 95 ℃, 1 cycle; 5S at 95 ℃, 30S at 58 ℃ and 40 cycles.

In the step (c), the recombinant plasmid standard containing the VSV N gene fragment is diluted to 2.96 x 10⁸～2.96×10³Has good linear relation in the order of magnitude range of copies/mu L, and the correlation coefficient is R²＝0.95。

the fluorescent quantitative RT-qPCR detection kit for the recombinant human tumor necrosis factor α -induced protein 6 has the advantages of rapidness and quantifiability when detecting the rhTSG-6 antiviral activity, can directly reflect the rhTSG-6 antiviral activity of different batches of different samples by detecting the proliferation kinetics of VSV on MDBK cells, has more visual results compared with the traditional crystal violet staining, can simultaneously detect a large number of samples, has high flux, and can greatly reduce the risk of RNA, cDNA or PCR product pollution.

The invention discovers for the first time that rhTSG-6 has antiviral activity in vivo and in vitro. And the fluorescent quantitative RT-qPCR detection kit of the rhTSG-6 is developed by utilizing the discovery, and the blank in the field is filled.

Drawings

FIG. 1 shows the result of PCR identification of the optimized recombinant human TSG-6 gene, wherein the ratio of lane M: DNA MarkerDL 2000; lane 1: negative control; lanes 2-5: the PCR identification result of the optimized recombinant human TSG-6 gene;

FIG. 2 shows the results of the double restriction enzyme identification of the recombinant plasmid pET32 a-rhTSG-6; wherein M is DNA MarkerDL 2000; lane 1 shows the results of double digestion with BamHI and HindIII on the recombinant plasmid pET32a-rhTSG-6, lanes 2 and 3 show the results of single digestion with BamHI and HindIII on the recombinant plasmid pET32a-rhTSG-6, respectively, and lane 4 shows the negative control of recombinant plasmid pET32 a-rhTSG-6;

FIG. 3 shows SDS-PAGE results of recombinant human TSG-6 protein induced by expression using 1.0mM IPTG at 30 ℃; wherein M is a protein marker, a lane 1 is empty carrier thallus total protein obtained by induction under the same condition, and a lane 2 is total protein expressed by thallus after the recombinant human TSG-6 engineering bacteria are induced for 5 hours; lane 3 is the precipitate after the thallus is broken after being induced by the recombinant human TSG-6 engineering bacteria for 5h, and lane 4 is the supernatant after the thallus is broken after being induced by the recombinant human TSG-6 engineering bacteria for 5 h.

FIG. 4 shows the result of detecting the expression of recombinant human TSG-6 protein, wherein M is protein marker, Lane 1 is empty vector total protein obtained by induction under the same conditions, Lane 2 is the supernatant of disrupted recombinant human TSG-6 engineering bacteria after 5h induction, Lane 3 is the precipitate of disrupted recombinant human TSG-6 engineering bacteria after 5h induction;

FIG. 5 shows the result of identifying recombinant human TSG-6 protein by Western Blot; wherein M is a protein marker, a lane 1 is total protein obtained by crushing empty vector thalli, and a lane 2 is a recombinant human TSG-6 protein sample;

FIG. 6 shows the SDS-PAGE result after the purification of the recombinant human TSG-6 protein; wherein M is a protein marker, Lane 2 is a recombinant human TSG-6 protein solution before purification, Lane 3 is a purified recombinant human TSG-6 protein standard;

FIG. 7 shows the fluorescence signals of the detection of the sensitivity of the absolute fluorescent quantitative PCR of the VSV N gene at standard concentrations of 2.96X 10 from left to right⁸、2.96×10⁷、2.96×10⁶、2.96×10⁵、2.96×10⁴、2.96×10³copies/μL；

FIG. 8 is a standard curve for absolute fluorescence quantification of the VSV N gene;

FIG. 9 shows the results of proliferation kinetics of the rhTSG-6 protein standard solutions at concentrations of 100ng/mL, 10ng/mL, and 1ng/mL for inhibiting VSV virus at 6h and 24h, respectively.

Detailed Description

The present invention will be described in detail with reference to examples.

The preparation method of the rhTSG-6 protein standard substance comprises the following steps:

(1) the recombinant human TSG-6 gene shown in SEQUENCE LISTING400 <1 > reported in Genebank is subjected to codon optimization, and the recombinant human TSG-6 gene shown in SEQUENCE LISTING400 <2 > is obtained by using a chemical synthesis method, wherein the Codon Adaptation Index (CAI) before optimization is 0.73, and the CAI after optimization is 0.97. The amino acid SEQUENCE of the recombinant human TSG-6 protein encoded by the recombinant human TSG-6 gene shown in SEQUENCE testing 400 (2) is shown in SEQUENCE testing 400 (3).

(2) Subcloning the recombinant human TSG-6 gene obtained in the step (1) into a pET-32a expression vector, converting the expression vector into BL21 escherichia coli, coating an LB plate containing ampicillin for overnight culture, selecting a single colony on the LB plate to perform PCR and BamH I and HindIII double enzyme digestion identification, and if the result is positive, indicating that the construction of the expression vector is successful, obtaining recombinant human TSG-6 recombinant bacteria; the PCR amplification and double digestion products show a single band near 800bp by agarose gel electrophoresis of lane No. 1, as shown in FIGS. 1 and 2;

the PCR identification primer is:

F1：GGATCCTGGGGTTTTAAAGATGGC(BamHⅠ)；

R1：AAGCTTTTACAGATGACTAAAGCGAC(HindⅢ)。

(3) selecting recombinant human TSG-6 recombinant bacteria, carrying out shake culture in an LB culture medium containing 100 mu g/mL ampicillin, carrying out amplification culture in the LB culture medium containing 100 mu g/mL ampicillin for 2-3 h, adding 1.0mM IPTG (isopropyl-beta-thiogalactoside) with final concentration when OD (OD) value is measured to be 0.6-0.8, carrying out induced expression at 30 ℃ for 5h, and collecting bacteria; through SDS-PAGE electrophoretic analysis, as shown in figure 3, the mycoprotein after IPTG induced expression for 5h can see a dominant expression band at the 45kD position, and the expression amount reaches 60%; through Western blot identification, as shown in figure 5, the mycoprotein after IPTG induced expression for 5h can perform specific reaction with rabbit anti-human TSG-6 polyclonal antibody, a specific band appears at about 45kD, and the specificity is high;

the Western blot identification method comprises the following steps: rabbit anti-human TSG-6 polyclonal antibody of Abcam company is used as a primary antibody (diluted 1: 500), and goat anti-rabbit IgG labeled by HRP of China fir Jinqiao company is used as a secondary antibody (diluted 1: 50000).

(4) Resuspending the thallus collected in the step (3) by using 200mL of PBS, and ultrasonically breaking the bacterial precipitate at 4 ℃, wherein the ultrasonic conditions are as follows: power: 400W, working for 3s, performing ultrasonic treatment for 6min at intervals of 3s, and repeating for 3-4 times; centrifuging at 12000r/min for 20min to separate supernatant and precipitate, washing, denaturing and renaturing the separated inclusion body precipitate to obtain the renaturated product, i.e. the recombinant human TSG-6 protein crude product. The precipitate, supernatant and thallus were separately collected and examined by SDS-PAGE electrophoresis, as shown in FIG. 4. The recombinant protein is expressed as inclusion body through SDS-PAGE electrophoretic analysis.

The method for washing, denaturation and renaturation comprises the following steps:

washing, namely using a washing buffer solution (50mmol/L Tris, 100mmol/L NaCl, 2mol/L urea, 1mmol/LEDTA, 0.5 percent TritonX-100 and pH8.0) to carry out heavy suspension on the inclusion body (10g) at a wet-weight-volume ratio of 1: 20, washing for 2h, centrifuging at 12000r/min for 20min, taking the precipitate, and repeating the washing once again;

② denaturation, namely weighing the wet weight (4.8g) of the washed precipitate, then re-suspending the precipitate (240ml) by a dissolving buffer solution (50mmol/L Tris, 100mmol/L NaCl, 7mol/L guanidine hydrochloride, 0.1 percent β -mercaptoethanol and pH of 8.45) according to the wet weight-to-volume ratio of 1: 50, placing the precipitate on a magnetic stirrer overnight, and fully dissolving the precipitate;

and thirdly, diluting and renaturing, namely preparing a renaturation buffer solution (50mmol/L Tris, 100mmol/L NaCl, 1mmol/L GSH, 0.2mmol/L GSSG and pH8.0) for renaturation, taking the dissolved protein solution, centrifuging at 12000r/min for 20min, taking supernatant, adding the renaturation buffer solution (250 ml renaturation buffer solution) with the same volume, standing for 3h at 4 ℃, adding the renaturation buffer solution for diluting to 4 times of the original volume (500 ml renaturation buffer solution is added), standing for 3h at 4 ℃, finally adding the renaturation buffer solution for diluting to 5 times of the original volume (250 ml renaturation buffer solution is added), and standing for 3h at 4 ℃.

(5) Filtering the crude product of the recombinant human TSG-6 protein, passing through a His-tag affinity chromatographic column, performing gradient Elution by using an Elution buffer (50mM Tris-Cl and 500mM imidazole with pH of 8.0), collecting the protein showing the ultraviolet absorption peak of the recombinant human TSG-6 protein, dialyzing in a Tris-HCl buffer solution with the volume of 10 times for more than 6 hours at 4 ℃, removing high-concentration imidazole by dialysis twice, adjusting the pH to 5.0, passing through an anion exchange chromatographic column by using 1M NaCl eluent to collect a flow-through solution, namely rhTSG-6 complete antigen, and detecting by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), wherein the result is shown in figure 6, and the purity of the obtained protein is more than 90 percent.

(6) Mixing the rhTSG-6 complete antigen obtained in the step (5) with a freeze-drying protective agent according to the equal volume of 1: 1, and then freezing and drying to obtain the recombinant human TSG-6 protein standard product with the specification of 40 mu g/per unit (namely, the rhTSG-6 content in each rhTSG-6 standard product is 40 mu g); the lyoprotectant is PBS mixed solution of glycerol, mannitol and sucrose, and the final concentrations of the three in 10mmol/L PBS buffer solution are 100mL/L of glycerol, 0.12g/mL of mannitol and 0.025g/mL of sucrose.

Example 1

A fluorescent quantitative RT-qPCR detection kit of recombinant human tumor necrosis factor α induced protein 6 comprises an rhTSG-6 protein standard substance, a recombinant plasmid standard substance containing VSV N gene segments, an RT-PCR reaction solution, a PCR reaction solution and a kit body, wherein the rhTSG-6 protein standard substance is a recombinant plasmid standard substance containing VSV N gene segments;

the gene SEQUENCE of the VSV N gene fragment is shown in SEQUENCE LISTING400 (4);

the RT-PCR reaction solution is as follows: SYBR Premix Ex Taq 10MIU II (2X) 10. mu.L, 10. mu.M forward primer 0.8. mu.L, 10. mu.M reverse primer 0.8. mu. L, cDNA template 2. mu.L, sterile water was added to 20. mu.L.

The preparation method of the cDNA comprises the following steps: MDBK cells were treated with rhTSG-6 protein standard solution at a concentration of 100ng/mL for 24h, and 100TCID was used₅₀0.1mL MDBK cells infected by VSV virus for 24h, extracting total RNA, and carrying out reverse transcription to obtain cDNA.

The upstream primer is as follows: 5'-CGG AAT AAA CAT CGG GAA AG-3', respectively;

the downstream primer is as follows: 5'-CCA AGT AGA TAC AAA GGC AAC C-3' are provided.

The preparation method of the recombinant plasmid standard substance containing the VSV N gene segment comprises the following steps:

(1) amplifying a VSV N gene segment from the VSV virus by using an RT-PCR method by using an upstream primer and a downstream primer; the RT-PCR reaction system is as follows: premix Taq (2X) 12.5. mu.L, 10. mu.M forward primer 0.5. mu.L, 10. mu.M reverse primer 0.5. mu. L, cDNA template 1. mu.L, and sterile water was added to 25. mu.L;

(2) connecting the VSV N gene segment to pMD18T vector to construct recombinant plasmid pMD18T-VSV N; the connection reaction system is as follows: pMD18-T Vector 1 mul, VSV N gene segment 2 mul, 5 mul LSolution I sterilized water 2 mul, reaction condition is 16 ℃ reaction for 2 h;

(3) transforming the recombinant plasmid pMD18T-VSV N into Escherichia coli DH5 α, proliferating in LB culture medium containing 100 mug/mL Amp, extracting by cracking method, purifying by kit to obtain recombinant plasmid standard containing VSV N gene fragment, and measuring OD by spectrophotometry₂₆₀The concentration of recombinant plasmid standards containing the VSV N gene fragment was quantified.

The method for calculating the concentration of the recombinant plasmid standard containing the VSV N gene segment comprises the following steps: recombinant plasmid standards containing the VSV N gene fragment were subjected to 10^-1、10^-2、10^-3、10^-4～10^-7for example, it is known that the total length of the DH5 α/pMD18T vector is 2692bp, the fragment length of the inserted VSV N gene is 147bp, the average molecular weight of each base is 330, (each base/bp is 660) the plasmid stock solution is about 92. mu.g/mL, and the Afugardro constant (number of particles per mol) is 6.02X 10²³And/mol. Then the absolute template amount per 1. mu.L is (92. mu.g/mL. times.1. mu.L. times.6.02X 10)²³/mol)/[(2692+147)bp+660g/(mol×bp)]＝2.96×10¹⁰copies/. mu.L. Accordingly, 10^-3～10^-7The number of template molecules of the plasmid was 2.96X 10⁷～10³copies/μL。

Example 2

the method for detecting the antiviral activity of rhTSG-6 by using the fluorescent quantitative RT-qPCR detection kit of the recombinant human tumor necrosis factor α induced protein 6 in the embodiment 1 comprises the following steps:

(a) the recombinant plasmid standard containing the VSV N gene fragment was diluted to 2.96X 10⁹、2.96×10⁸、2.96×10⁷、2.96×10⁶、2.96×10⁵、2.96×10⁴、2.96×10³、2.96×10²、2.96×10¹copies/μL；

(b) Setting a reaction program by taking the diluted recombinant plasmid standard containing the VSV N gene segment as a template of the fluorescent quantitative RT-qPCR reaction, and carrying out the fluorescent quantitative RT-qPCR reaction; the fluorescent quantitative RT-qPCR reaction system is as follows: SYBRPremix Ex Taq 10MIU II (2X) 10. mu.L, 10. mu.M upstream primer 0.8. mu.L, 10. mu.M downstream primer 0.8. mu. L, cDNA template 2. mu.L, sterile water to 20. mu.L; the fluorescent quantitative RT-qPCR reaction program is as follows: 30s at 95 ℃ for 1 cycle; 5s at 95 ℃, 30s at 58 ℃ and 40 cycles.

(c) Constructing a standard curve according to the linear relation between the logarithm value of the copy number of the recombinant plasmid standard substance containing the VSV N gene segment and the reaction cycle number, wherein the linear equation of the standard curve is as follows: y is-3.069 log (conc) +35.66, conc is the plasmid copy number of the recombinant plasmid standard containing the VSV N gene fragment; as shown in fig. 8; as can be seen from the figure, the recombinant plasmid standard containing the VSVN gene fragment was diluted to 2.96X 10⁸～2.96×10³Has good linear relation in the order of magnitude range of copies/mu L, and the correlation coefficient is R²＝0.95；

(d) When the antiviral activity of a sample to be detected is carried out, the sample to be detected acts on MDBK cells for 24h, the MDBK cells which act are infected by VSV, total RNA is extracted, and then cDNA is obtained after reverse transcription; and (c) performing the fluorescent quantitative RT-qPCR reaction in the step (b), and obtaining the antiviral activity of the sample to be detected from the standard curve according to the obtained reaction cycle number.

Example 3

A method of detecting rhTSG-6 antiviral activity, comprising the steps of:

1) MDBK cells were treated with rhTSG-6 protein standard solution at a concentration of 100ng/mL for 24h, and 100TCID was used₅₀0.1mL of MDBK cells infected by VSV virus suspension for 24h, extracting total RNA, and carrying out reverse transcription to obtain cDNA;

2) designing a pair of specific primers, wherein an upstream primer is as follows: 5'-CGG AAT AAA CAT CGG GAA AG-3', respectively; the downstream primer is: 5'-CCA AGT AGA TAC AAA GGC AAC C-3', amplifying VSV N gene segment from VSV virus by RT-PCR method; the RT-PCR reaction system is as follows: premix Taq (2X) 12.5. mu.L, 10. mu.M forward primer 0.5. mu.L, 10. mu.M reverse primer 0.5. mu. L, cDNA template 1. mu.L, and sterile water was added to 25. mu.L;

3) connecting the VSV N gene segment to pMD18T vector to construct recombinant plasmid pMD18T-VSV N; the connection reaction system is as follows: pMD18-T Vector 1 mul, VSV N gene segment 2 mul, 5 mul LSolution I sterilized water 2 mul, reaction condition is 16 ℃ reaction for 2 h;

4) transforming the recombinant plasmid pMD18T-VSV N into Escherichia coli DH5 α, proliferating in LB culture medium containing 100 mug/mL Amp, extracting by a cracking method, and purifying by a kit to obtain a recombinant plasmid standard product containing VSV N gene segments;

5) the recombinant plasmid standard containing the VSV N gene fragment was diluted to 2.96X 10⁹、2.96×10⁸、2.96×10⁷、2.96×10⁶、2.96×10⁵、2.96×10⁴、2.96×10³、2.96×10²、2.96×10¹copies/μL；

6) Setting a reaction program by taking the diluted recombinant plasmid standard containing the VSV N gene segment as a template of the fluorescent quantitative RT-qPCR reaction, and carrying out the fluorescent quantitative RT-qPCR reaction; the fluorescent quantitative RT-qPCR reaction system is as follows: SYBRPremix Ex Taq 10MIU II (2X) 10. mu.L, 10. mu.M upstream primer 0.8. mu.L, 10. mu.M downstream primer 0.8. mu. L, cDNA template 2. mu.L, sterile water to 20. mu.L; the fluorescent quantitative RT-qPCR reaction program is as follows: 30S at 95 ℃, 1 cycle; at 95 ℃ for 5s and at 58 ℃ for 30s, and 40 cycles;

7) constructing a standard curve according to the linear relation between the logarithm value of the copy number of the recombinant plasmid standard substance containing the VSV N gene segment and the reaction cycle number, wherein the linear equation of the standard curve is as follows: y is-3.069 log (conc) +35.66, conc is the plasmid copy number of the recombinant plasmid standard containing the VSV N gene fragment; as shown in fig. 8; as can be seen from the figure, the recombinant plasmid standard containing the VSV N gene fragment was diluted to 2.96X 10⁸～2.96×10³Has good linear relation in the order of magnitude range of copies/mu L, and the correlation coefficient is R²＝0.95；

8) When the antiviral activity of a sample to be detected is carried out, the sample to be detected acts on MDBK cells for 24h, the MDBK cells which act are infected by VSV, total RNA is extracted, and then cDNA is obtained after reverse transcription; and then carrying out the fluorescent quantitative RT-qPCR reaction in the step 6), and obtaining the antiviral activity of the sample to be detected from the standard curve according to the obtained reaction cycle number.

Comparative example 1

Otherwise, as in example 3 except that in step 1), MDBK cells were treated with 10ng/mL rhTSG-6 protein standard solution for 24h, and 100TCID was used₅₀0.1mL MDBK cells infected by VSV virus for 24h, extracting total RNA, and carrying out reverse transcription to obtain cDNA.

Comparative example 2

Otherwise, as in example 3 except for step 1), MDBK cells were treated with a 1ng/mL rhTSG-6 protein standard solution for 24h using 100TCID₅₀0.1mL MDBK cells infected by VSV virus for 24h, extracting total RNA, and carrying out reverse transcription to obtain cDNA.

Comparative example 3

The other same as example 3 except that in step 1), MDBK cells were treated with 100TCID for 24h using rhTSG-6 protein standard solution with concentration of 100ng/mL₅₀0.1mL MDBK cells infected by VSV virus for 6h, extracting total RNA, and carrying out reverse transcription to obtain cDNA.

Comparative example 4

Otherwise, as in comparative example 1 except that in step 1), MDBK cells were treated with 10ng/mL rhTSG-6 protein standard solution for 24h, and 100TCID was used₅₀0.1mL MDBK cells infected by VSV virus for 6h, extracting total RNA, and carrying out reverse transcription to obtain cDNA.

Comparative example 5

The other steps are the same as comparative example 1 except that in the step (1), MDBK cells are acted for 24h by rhTSG-6 protein standard solution with the concentration of 1ng/mL, and 100TCID is used₅₀0.1mL MDBK cells infected by VSV virus for 6h, extracting total RNA, and carrying out reverse transcription to obtain cDNA.

The results of the fluorescent quantitative RT-qPCR reactions of example 3 and comparative examples 1 to 5 are shown in FIG. 9, which shows that the difference of the virus copy number after the rhTSG-6 protein standard solution treatment to the virus copy number of VSV virus group is not obvious at 6h after VSV infection; the virus copy number after the treatment of the rhTSG-6 protein standard solution at the 24 th hour of the challenge is obviously different from the virus copy number of a VSV virus control group, and the results show that the virus liquid with the concentration can obviously inhibit the VSV virus proliferation, and the virus copy number after the treatment of the rhTSG-6 protein standard solution at the 1ng/mL and 10ng/mL is not obviously different from the virus copy number of the VSV virus group at 6h or 24 h.

The above detailed description of the fluorescence quantitative RT-qPCR detection kit of rhTSG-6 and the application thereof with reference to the examples is illustrative and not restrictive, and several examples can be cited according to the limited scope, thus all changes and modifications that do not depart from the general concept of the present invention are within the scope of the present invention.

SEQUENCE LISTING

<110> Wu lake Tianming Biotechnology Limited

<120> rhTSG-6 fluorescent quantitative RT-qPCR detection kit and application thereof

<130>1

<160>3

<170>PatentIn version 3.3

<210>1

<211>780

<212>DNA

<213> TSG-6 Gene before optimization

<400>1

tggggattca aggatggaat ttttcataac tccatatggc ttgaacgagc agccggtgtg 60

taccacagag aagcacggtc tggcaaatac aagctcacct acgcagaagc taaggcggtg 120

tgtgaatttg aaggcggcca tctcgcaact tacaagcagc tagaggcagc cagaaaaatt 180

ggatttcatg tctgtgctgc tggatggatg gctaagggca gagttggata ccccattgtg 240

aagccagggc ccaactgtgg atttggaaaa actggcatta ttgattatgg aatccgtctc 300

aataggagtg aaagatggga tgcctattgc tacaacccac acgcaaagga gtgtggtggc 360

gtctttacag atccaaagca aatttttaaa tctccaggct tcccaaatga gtacgaagat 420

aaccaaatct gctactggca cattagactc aagtatggtc agcgtattca cctgagtttt 480

ttagattttg accttgaaga tgacccaggt tgcttggctg attatgttga aatatatgac 540

agttacgatg atgtccatgg ctttgtggga agatactgtg gagatgagct tccagatgac 600

atcatcagta caggaaatgt catgaccttg aagtttctaa gtgatgcttc agtgacagct 660

ggaggtttcc aaatcaaata tgttgcaatg gatcctgtat ccaaatccag tcaaggaaaa 720

aatacaagta ctacttctac tggaaataaa aactttttag ctggaagatt tagccactta 780

<210>2

<211>783

<212>DNA

<213> optimized TSG-6 Gene

<400>2

tggggtttta aagatggcat ttttcataat agcatctggc tggaacgcgc cgccggcgtt 60

tatcatcgtg aagcccgtag tggcaaatat aaactgacct atgcagaagc caaagcagtg 120

tgcgaatttg aaggcggtca tctggcaacc tataaacagc tggaagcagc ccgtaaaatt 180

ggctttcatg tgtgcgcagc cggttggatg gccaaaggtc gcgtgggcta tccgattgtg 240

aaaccgggcc cgaattgcgg ttttggcaaa accggtatta ttgattatgg tattcgtctg 300

aatcgtagtg aacgttggga tgcctattgt tataatccgc atgcaaaaga atgcggtggc 360

gtttttaccg atccgaaaca gatttttaaa agcccgggct ttccgaatga atatgaagat 420

aatcagatct gctactggca tattcgtctg aaatatggtc agcgcattca tctgagtttt 480

ctggattttg atctggaaga tgatccgggc tgcctggcag attatgttga aatctatgat 540

agctatgacg atgttcatgg ttttgtgggt cgctattgtg gtgacgaact gccggatgat 600

attattagta ccggcaatgt gatgaccctg aaatttctga gtgatgccag cgtgaccgca 660

ggcggttttc agattaagta tgttgcaatg gaccctgtga gcaaaagcag ccagggcaaa 720

aataccagta ccaccagtac cggtaataag aattttctgg ccggtcgctt tagtcatctg 780

taa 783

<210>3

<211>260

<212>PRT

<213> amino acid sequence of recombinant human TSG-6

<400>3

Trp Gly Phe Lys Asp Gly Ile Phe His Asn Ser Ile Trp Leu Glu Arg

1 5 10 15

Ala Ala Gly Val Tyr His Arg Glu Ala Arg Ser Gly Lys Tyr Lys Leu

20 25 30

Thr Tyr Ala Glu Ala Lys Ala Val Cys Glu Phe Glu Gly Gly His Leu

35 40 45

Ala Thr Tyr Lys Gln Leu Glu Ala Ala Arg Lys Ile Gly Phe His Val

50 55 60

Cys Ala Ala Gly Trp Met Ala Lys Gly Arg Val Gly Tyr Pro Ile Val

65 70 75 80

Lys Pro Gly Pro Asn Cys Gly Phe Gly Lys Thr Gly Ile Ile Asp Tyr

85 90 95

Gly Ile Arg Leu Asn Arg Ser Glu Arg Trp Asp Ala Tyr Cys Tyr Asn

100 105 110

Pro His Ala Lys Glu Cys Gly Gly Val Phe Thr Asp Pro Lys Gln Ile

115 120 125

Phe Lys Ser Pro Gly Phe Pro Asn Glu Tyr Glu Asp Asn Gln Ile Cys

130 135 140

Tyr Trp His Ile Arg Leu Lys Tyr Gly Gln Arg Ile His Leu Ser Phe

145 150 155 160

Leu Asp Phe Asp Leu Glu Asp Asp Pro Gly Cys Leu Ala Asp Tyr Val

165 170 175

Glu Ile Tyr Asp Ser Tyr Asp Asp Val His Gly Phe Val Gly Arg Tyr

180 185 190

Cys Gly Asp Glu Leu Pro Asp Asp Ile Ile Ser Thr Gly Asn Val Met

195 200 205

Thr Leu Lys Phe Leu Ser Asp Ala Ser Val Thr Ala Gly Gly Phe Gln

210 215 220

Ile Lys Tyr Val Ala Met Asp Pro Ala Ser Lys Ser Ser Gln Gly Lys

225 230 235 240

Asn Thr Ser Thr Thr Ser Thr Gly Asn Tyr Asn Phe Leu Ala Gly Arg

245 250 255

Phe Ser His Leu

260

Claims (9)

1. A fluorescent quantitative RT-qPCR detection kit of recombinant human tumor necrosis factor α induced protein 6 is characterized in that the kit comprises an rhTSG-6 protein standard substance, a recombinant plasmid standard substance containing VSV N gene segments, an RT-PCR reaction solution, a PCR reaction solution and a kit body, wherein the rhTSG-6 protein standard substance comprises a recombinant plasmid standard substance containing VSV N gene segments;

the gene SEQUENCE of the VSV N gene fragment is shown in SEQUENCE LISTING400 (4);

the RT-PCR reaction solution is as follows: SYBR Premix Ex Taq 10MIU II (2X) 10. mu.L, 10. mu.M forward primer 0.8. mu.L, 10. mu.M reverse primer 0.8. mu. L, cDNA template 2. mu.L, sterile water to 20. mu.L;

the preparation method of the cDNA comprises the following steps: and (3) allowing the rhTSG-6 protein standard solution to act on the MDBK cells for 24h, then infecting the MDBK cells after the action by the VSV virus suspension, extracting total RNA of the infected cells, and performing reverse transcription to obtain cDNA.

2. the fluorescent quantitative RT-qPCR detection kit for the recombinant human tumor necrosis factor α -induced protein 6 according to claim 1,

the upstream primer is as follows: 5'-CGG AAT AAA CAT CGG GAA AG-3', respectively;

the downstream primer is as follows: 5'-CCA AGT AGA TAC AAA GGC AAC C-3' are provided.

3. the kit for the quantitative fluorescent RT-qPCR assay of recombinant human TNF-alpha inducible protein 6 according to claim 1, wherein the titer of the viral suspension of VSV virus is 100TCID₅₀0.1 mL; the time for MDBK cells after VSV virus infection was 24 h.

4. the fluorescent quantitative RT-qPCR detection kit for the recombinant human tumor necrosis factor α -induced protein 6 according to any one of claims 1 to 3, wherein the preparation method of the recombinant plasmid standard containing the VSV N gene fragment comprises the following steps:

(1) amplifying a VSV N gene segment from the VSV virus by using an RT-PCR method by using an upstream primer and a downstream primer;

(2) connecting the VSV N gene segment to pMD18T vector to construct recombinant plasmid pMD18T-VSV N;

(3) the recombinant plasmid pMD18T-VSV N is transformed into Escherichia coli DH5 α, proliferated in LB culture medium containing 100 mu g/mL Amp, extracted by a cracking method, and purified by a kit to obtain a recombinant plasmid standard product containing the VSV N gene segment.

5. the kit for the fluorescent quantitative RT-qPCR detection of recombinant human TNF-alpha inducible protein 6 according to claim 4, wherein in step (1), the RT-PCR reaction system is Premix Taq (2X) 12.5 μ L, 10 μ M upstream primer 0.5 μ L, 10 μ M downstream primer 0.5 μ L, cDNA template 1 μ L, and sterile water is added to 25 μ L;

6. the kit for the fluorescent quantitative RT-qPCR detection of recombinant human tumor necrosis factor α -induced protein 6 according to claim 4, wherein in the step (2), the ligation reaction system comprises 1 μ L of pMD18-T Vector, 2 μ L of VSV N gene fragment, and 2 μ L of 5 μ L of sterile water LSolution I, and the reaction condition is 16 ℃ for 2 h.

7. the use of the fluorescent quantitative RT-qPCR detection kit for recombinant human TNF-alpha inducible protein 6 according to any of claims 1-6 for detecting the antiviral activity of rhTSG-6.

8. the use of claim 7, wherein the method for detecting the antiviral activity of rhTSG-6 by using the fluorescent quantitative RT-qPCR detection kit for recombinant human tumor necrosis factor α -induced protein 6 comprises the following steps:

(a) the recombinant plasmid standard containing the VSV N gene fragment was diluted to 2.96X 10⁹、2.96×10⁸、2.96×10⁷、2.96×10⁶、2.96×10⁵、2.96×10⁴、2.96×10³、2.96×10²、2.96×10¹copies/μL；

(b) Setting a reaction program by taking the diluted recombinant plasmid standard containing the VSV N gene segment as a template of the fluorescent quantitative RT-qPCR reaction, and carrying out the fluorescent quantitative RT-qPCR reaction; the fluorescent quantitative RT-qPCR reaction system is as follows: SYBR PremixEx Taq 10MIU II (2X) 10. mu.L, 10. mu.M upstream primer 0.8. mu.L, 10. mu.M downstream primer 0.8. mu. L, cDNA template 2. mu.L, sterile water to 20. mu.L;

(c) constructing a standard curve according to the linear relation between the logarithm value of the copy number of the recombinant plasmid standard substance containing the VSV N gene segment and the reaction cycle number;

(d) when the antiviral activity of a sample to be detected is carried out, the sample to be detected acts on MDBK cells for 24h, the MDBK cells which act are infected by VSV, total RNA is extracted, and then cDNA is obtained after reverse transcription; and (c) performing the fluorescent quantitative RT-qPCR reaction in the step (b), and obtaining the antiviral activity of the sample to be detected from the standard curve according to the obtained reaction cycle number.

9. The use of claim 8, wherein in step (b), the fluorescent quantitative RT-qPCR reaction procedure is: 30s at 95 ℃ for 1 cycle; 5s at 95 ℃, 30s at 58 ℃ and 40 cycles.

Images