CN111154759A - Method for knocking out zebra fish myo7ab gene - Google Patents

Abstract

The invention relates to the technical field of gene knockout, in particular to a method for knocking out zebra fish myo7ab gene. According to the invention, through a CRISPR/Cas9 gene editing technology, a proper targeting site is designed on a zebra fish myo7ab gene, and specific sgRNA and Cas9-mRNA are synthesized in vitro and used for gene editing of zebra fish. The invention can more efficiently and accurately silence specific genes, has simple manufacture and low cost, can simultaneously cut a plurality of sites on target genes and silence any number of single genes, and also provides a method for gene knockout breeding of myo7ab gene-deleted zebra fish.

Description

Method for knocking out zebra fish myo7ab gene

Technical Field

The invention relates to the technical field of gene knockout, in particular to a method for knocking out zebra fish myo7ab gene.

Background

The myo7ab gene is located on the 21 st chromosome of zebra fish, contains 46 exons and 47 introns, has the cDNA full length of 6614bp, codes 2204 amino acids, and the myo7ab gene contains 12 evolutionarily conserved functional domains, and through gene differential expression profiling analysis, genome correlation analysis and the like, the myo7ab gene is found to be expressed in a plurality of tissues in the early stage of human embryo, particularly strongly expressed in the auditory canal. The zebra fish MYO7ab gene and human myosin 7A (MYO7A) are homologous genes, and MYO7A protein is located in inner ear hair cells and tip cilia thereof and can influence development, positioning and functions of the cilia. The MYO7A mutation can cause human Usher syndrome, and can also cause non-syndrome autosomal dominant deafness (DFNA11) and chromosomal recessive hereditary deafness (DFNB 2).

The zebra fish has high homology with genes and signal paths in the human auditory canal development process, and the myo7ab gene is more conservative in evolution, so that research shows that the myo7ab has particularly high early expression level in the zebra fish embryo. Moreover, compared with other animal models, the zebra fish has the advantages of small size, easy feeding, fast development, strong reproductive capacity, in-vitro fertilization, embryo in-vitro development, transparency and the like. Therefore, the interference of the myo7ab gene in zebra fish and the genetic research of the function of zebra fish are helpful to further disclose the whole process of the auditory canal morphogenesis and the molecular mechanism for regulating the process, and the method has great significance in understanding the pathology of auditory canal diseases and developing new treatment schemes in medicine. And the myo7ab gene is interfered, and the function of the gene is researched by genetics, which is helpful for further disclosing the whole process of the morphogenesis of the auricular vesicles and hair cells and the molecular mechanism for regulating the process, and has very important significance in the understanding of the pathogenesis of the congenital deafness and the development of the treatment scheme for gene correction in medicine.

Gene targeting technology originated in the end of the 20 th century 80 s, is an important means for studying gene function by site-directed modification of genome, and can also be used for treating various genetic diseases of human. The technology mainly utilizes modes such as deletion mutation, gene inactivation, chromosome large fragment deletion, exogenous gene introduction and the like to change the genetic information of organisms, and stably expresses mutation characters after inheritance in a germ line, so that the function of specific genes in the organisms in the growth and development process is researched, and the technical means become a research hotspot of modern molecular biology. The traditional gene targeting technology is based on the Embryonic Stem Cell (ESC) and homologous recombination technology, so the targeting technology has extremely low efficiency. In the beginning of 2013, a novel artificial endonuclease clustered regulated complementary amplified polymorphic polypeptides (CRISPR)/CRISPR-associated (Cas)9 can silence specific genes in organism genomes more efficiently and more accurately, is simple to manufacture and low in cost, and can simultaneously shear a plurality of sites on a target gene and silence any number of single genes.

However, the currently-used method for detecting CRISPR/Cas9 mutation applied to gene knockout of zebra fish has certain defects, such as: tail-snipping of zebrafish at F0 and TA cloning, Sanger sequencing, required significant time, reagents and sequencing costs, and sequencing from F0 did not necessarily lead to inheritance to the next generation. Moreover, the CRISPR/Cas9 technology requires more steps, is too high in cost and has relatively high off-target rate.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide a method for knocking out a zebra fish myo7ab gene, wherein the method adopts a cloning free strategy to knock out the zebra fish myo7ab gene, and the off-target rate is low.

The invention provides a gRNA of a targeted zebrafish myo7ab gene, which comprises a promoter element, a target sequence and a framework sequence; wherein the target sequence is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

The sequence of the promoter element is shown as SEQ ID NO. 3; the framework sequence is shown in SEQ ID NO. 4.

In some embodiments, the gRNA targeting the zebrafish myo7ab gene includes two gRNAs shown in SEQ ID NOS: 5-6.

The target sequence is designed aiming at the exon 5 of the zebra fish myo7ab gene, and two edited target sites are designed in the invention, namely a target site a and a target site b. The selection of target site a (transcribed using the T7 promoter) followed the following criteria: 5 ' - (N)20-NGG-3 ', ensuring that the 3 ' end of the target site is NGG; target site b selection followed the following criteria: 5 '-GG- (N) 18-NGG-3' wherein the 5 'GG dinucleotide is part of the T7 promoter to ensure that the 3' end of the target site is NGG; the selected position of the target was within the stem-loop region of the myo7ab gene. The gRNA of the targeted zebra fish myo7ab gene designed by the invention has better specificity, and compared with other gRNAs, the gRNA designed by the invention has lower off-target rate, and a good knockout effect of the zebra fish myo7ab gene is obtained by matching with the cloning free CRISPR/Cas 9.

In the invention, the preparation method of the gRNA targeting the zebra fish myo7ab gene comprises the following steps:

step 1: using the synthesized DNA as a template, and respectively amplifying by using two pairs of specific primers to obtain double-stranded DNA;

step 2: and after the double-stranded DNA is transcribed, purifying to obtain gRNA.

Wherein the sequence of the synthesized DNA is shown as SEQ ID NO. 10.

Amplifying to obtain a specific primer of gRNA shown in SEQ ID NO. 5, wherein an upstream primer is shown in SEQ ID NO. 11; the downstream primer is shown as SEQ ID NO. 13;

amplifying to obtain a specific primer of gRNA shown in SEQ ID NO. 6, wherein an upstream primer is shown in SEQ ID NO. 12; the downstream primer is shown as SEQ ID NO. 13.

The system of transcription comprises:

the invention also provides a knockout reagent targeting the zebrafish myo7ab gene, which comprises the gRNA and the Cas9mRNA described in the invention.

In the invention, the Cas9mRNA is subjected to codon optimization for zebra fish, and has a sequence shown in SEQ ID NO: 9.

in the present invention, the knockout reagent comprises nucleic free H₂O and the following concentrations:

MgCl₂10mmol/L；

Cas9mRNA 150ng/μL；

gRNA 20 ng/. mu.L each.

The knockout reagent is applied to construction of a myo7ab gene deletion type zebra fish model.

The invention also provides a method for constructing the myo7ab gene-deleted zebra fish model, which comprises the steps of inoculating the knockout reagent into a zebra fish fertilized egg at a cell stage, and hatching to obtain the myo7ab gene-deleted zebra fish model.

In the present invention, 1.5 to 2.0nL of the knock-out reagent is administered to each fertilized egg. In some embodiments, 1.8nL of the knock-out agent is administered per fertilized egg

A screening step is further included after the incubation; the screening comprises the following steps: screening embryos fertilized for 36 hours or screening adult fishes;

the screening comprises the steps of amplifying the genome DNA, wherein the amplification product contains a 377bp band, so that the myo7ab gene is deleted, and the amplification product only contains a 465bp fragment, so that the myo7ab gene is not deleted; the sequence of the amplified primer is shown as SEQID NO. 7-8.

The hatched zebra fish with the myo7ab gene deleted is F0 generation; the method further comprises the step of passaging;

the F1 generation zebra fish is obtained by crossing F0 generation zebra fish with wild type zebra fish;

the F2 generation zebra fish is obtained by crossing the F1 generation mutant.

According to the invention, through a CRISPR/Cas9 gene editing technology, a proper targeting site is designed on a myo7ab gene of zebra fish, specific sgRNA (the final concentration is 20 ng/mu L) and Cas9-mRNA (the final concentration is 150 ng/mu L) synthesized in vitro are injected into a zebra fish cell in a micro-co-injection manner, and after 36h of embryo culture, Native-PAGE is utilized to perform genotype analysis on F0 generation embryos, so that the effectiveness of the targeted site is identified. The invention can silence specific genes in organism genomes more efficiently and more accurately, has simple manufacture and low cost, can simultaneously cut a plurality of sites on target genes and silence any number of single genes, overcomes the defects of the prior art, provides a method for breeding myo7ab gene-deleted zebra fish by gene knockout, finds out proper targeting sites, rapidly screens F0 zebra fish by CRISPR/Cas9 gene editing technology, and carries out Sanger sequencing after obtaining F1 generation of stable inheritance, thereby saving a great deal of time, energy and sequencing cost. The myo7ab gene-deleted zebra fish is bred quickly, efficiently and at low cost. The myo7ab gene is knocked out, and the functions of the myo7ab gene are researched by a genetic means, which is helpful for further disclosing the whole process of the morphogenesis of the auricular vesicles and hair cells and the molecular mechanism for regulating the processes, and has very important significance in understanding the pathogenesis of the congenital deafness and developing a treatment scheme for gene correction in medicine.

Drawings

Fig. 1 is a schematic diagram of a CRISPR/Cas9 targeting system;

FIG. 2 is a block diagram of a target site on the myo7ab gene;

FIG. 3 is a diagram showing the result of electrophoresis of zebra fish F1 generation;

FIG. 4 shows a forward alignment of deletion and WT gene sequences;

FIG. 5 shows a deletion contrast near the target site.

Detailed Description

The invention provides a method for knocking out the zebra fish myo7ab gene, and a person skilled in the art can realize the method by appropriately improving the process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The test materials adopted by the invention are all common commercial products and can be purchased in the market.

The invention is further illustrated by the following examples:

example 1:

1) design CRISPR/Cas9 gene knockout target site and detection primer

The genomic DNA sequence of The zebrafish myo7ab gene was queried on The National Center for Biotechnology Information (NCBI), its functional domain was analyzed on The website SMART (http:// smart.embl-heidelberg. de /), and The target site of The myo7ab gene was designed on The website The ZiFiT target (http:// ZiFiT. partners. org/ZiFiT /) according to The CRISPR/Cas knockout principle. The selection of the target must follow this criterion: 5 '-GG- (N) 18-NGG-3'. The GG dinucleotide at the 5 'end is part of the T7 promoter, and the target site can be designed without limitation, but the NGG at the 3' end of the target site must be ensured. The target site must be selected within the domain of the gene to ensure that the insertion or deletion of the base of the target site can affect the entire domain of the myo7ab gene to alter gene expression.

Two pairs of specific target site PCR primers were as follows:

f1 (target site a forward primer):

GCGTAATACGACTCACTATAGGagtctggagctggaaagaGTTTTAGAGCTAGAAATAG(SEQ IDNO:11)

f2 (target site b forward primer):

GCGTAATACGACTCACTATAGGttgagcagcaggttctggGTTTTAGAGCTAGAAATAG(SEQ IDNO:12)

r (common reverse primer): AAGCACCGACTCGGTGCCACT (SEQ ID NO:13)

PCR detection primer

PCR detection primers upstream and downstream primers were located on the myo7ab intron:

F(5’-GTGAATCCATACCAGCTTCTG-3’)(SEQ ID NO:7)

R(5’-CTGGGCTGTAAAAGATGTGAC-3(SEQ ID NO:8)

general template sequence (SEQ ID NO:10)

TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT

2) gRNA in vitro synthesis

and a, performing PCR by using the synthesized DNA as a template through the following specific primers to amplify the double-stranded DNA for synthesizing the specific gRNA.

Forward specific target site primer F1 or F2: the T7 promoter 20pb target sequence 20bp gRNA upstream backbone; reverse primer R: 20bp gRNA downstream scaffold

The PCR reaction (25. mu.L) was as follows:

after shaking and mixing, the mixture was centrifuged at 4 ℃ and subjected to amplification reaction on a PCR instrument. The reaction conditions are as follows: pre-denaturation at 95 ℃ for 3min, (denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 15s, and elongation at 72 ℃ for 15s) for 32 cycles, and then at 72 ℃ for 5 min. After the reaction is finished, centrifuging the PCR product, spotting 1 microliter of sample on 1.5% agarose gel for electrophoresis, and shooting the result by a gel imaging system.

And b, detecting to determine that the band is correct, then carrying out agarose gel DNA recovery, and purifying and recovering PCR products.

c, measuring the concentration of the purified DNA (as much as 1 mu g), and taking the DNA as a template to perform in vitro transcription by using a 20 mu L system to synthesize the specific gRNA. The Tip head and the EP tube used in the transcription experiment are both products of DEPC-treated RNase-Free, and the specific operation is as follows:

in vitro transcription reaction system (20 μ L):

adding the reactants into an EP tube with the concentration of 0.2mLRNase-Free, uniformly mixing, and carrying out water bath at 37 ℃ for 2 h;

after the water bath is finished, adding 1 mu LDNA enzyme into the transcription system, placing the transcription system in a water bath kettle at 37 ℃ for reaction for 30min to digest the DNA template, taking 1 mu L of sample, and carrying out electrophoresis by using prepared 1.5% agarose gel to detect the transcription result, wherein if the size of the transcription product is consistent with that expected, the successful transcription is indicated;

d, purification of specific gRNAs

Successfully transcribed gRNAs were purified using the RNeasy Minikit kit and stored at-20 ℃.1 μ L of the purified gRNA solution was aspirated for agarose gel electrophoresis to check the purified product, and the gRNA concentration after purification was determined.

3) Microinjection of zebrafish embryos

Within 30min after fertilization, embryos were pipetted into a microinjection petri dish made of agarose.

Before microinjection, Cas9mRNA and gRNA are prepared into a mixed solution and are fully and uniformly mixed, so that the final concentration of the Cas9mRNA is 150 ng/mu L, and the final concentration of the gRNA is 20 ng/mu L. About 1.8nL of Cas9mRNA and gRNA cocktail were injected into fertilized eggs at one cell stage. The injected fertilized eggs are placed in E3 water (5mmol/L NaCl, 0.33mmol/L CaCl)₂0.33mmol/L MgSO4, 0.17mmol/L KCl,) at 28 ℃. Embryo phenotype is observed under a body type microscope, and the embryo which normally develops is screened for target site mutation analysis.

Microinjection systems were as follows:

4) Native-PAGE (Native-PAGE) screening of F0-generation zebrafish (fountain)

After microinjection is carried out on zebra fish embryos, 5-10 early embryos are randomly selected, whether mutation exists in the myo7ab gene is detected, and compared with a wild type, the DNA after mutation can be separated from the normal DNA by utilizing non-denatured polyacrylamide gel.

a, extracting zebra fish genome

After the zebra fish embryo is fertilized for 36 hours (36hpf), respectively collecting the wild type and the injected embryo in a 1.5mLEp tube, wherein 2 embryos in each tube are extracted by the following method to obtain genome DNA, and the specific steps are as follows:

adding 200 μ L cell lysate and 2 μ L proteinase K into Ep tube filled with embryo, and placing in 55 deg.C water bath for lysis overnight;

after the cracking is finished, placing the mixture on an oscillator for full oscillation, adding isopropanol which is cooled in advance and has the same volume in an Ep tube, fully and evenly mixing the mixture in a reversed way, centrifuging the mixture for 10min at 12000 Xg at the temperature of 4 ℃, and pouring out supernate;

adding 500 μ L of 75% ethanol, centrifuging at 12000 × g at 4 deg.C for 5min, removing supernatant, and air drying at room temperature for 20 min;

adding 60 mu L of deionized water, fully and uniformly blowing, and detecting the extraction efficiency by agarose gel electrophoresis;

b, PCR amplification of the target sequence

After extracting genome DNA, designing a Primer sequence by using Primer Premier 5.0 software according to a genome region of about 150-200bp upstream and downstream of a CRISPR target site to amplify a target DNA fragment;

the PCR reaction system is as follows:

after shaking and mixing evenly, centrifuging at 4 ℃, and carrying out amplification reaction on a PCR instrument;

the reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, and repeat the following steps for 30 cycles: denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, elongation at 72 ℃ for 30s, and then elongation at 72 ℃ for 8 min.

c, separating the PCR product by 10% Native-PAGE electrophoresis,

the preparation system of the non-denatured polyacrylamide gel is as follows:

the preparation process of the non-denatured polyacrylamide gel is as follows:

a, selecting a proper vertical electrophoresis tank, two glass plates with the sizes matched with each other, and a spacer and a sample application comb between the two glass plates.

And b, cleaning the two glass plates by using a detergent, airing, and scrubbing with absolute alcohol once.

c, assembling a glue pouring plate: the two glass plates are aligned, clamps are clamped at the two sides of the glass plates, glue solution is added, and a sample application comb is inserted.

And d, allowing the gel to polymerize at room temperature for about 1-2 hours.

e, preparing 800mL of 0.5xTBE electrophoresis buffer solution, mixing uniformly, and adding into an upper electrophoresis tank and a lower electrophoresis tank.

And f, carefully pulling down the comb, washing the rubber hole with TBE in the electrophoresis tank, removing the clamps on the two sides of the glass plate, fixing the rubber plate on the electrophoresis tank with fixing clamps, switching on the power supply, and performing 300V electrophoresis for 40 minutes.

And g, taking down the rubber plate after electrophoresis is finished, carefully opening the glass plate, and soaking and dyeing the glass plate by using GelRed solution. The electrophoresis results were photographed with a gel imaging system.

Since the Native-PAGE gel can distinguish the difference of single base, it can be observed that after CRISPR/Cas9 is injected, the type of the gene mutation is N-1(N is the number of the bands of the PCR product after the mutation of the Native-PAGE gel). the fish obtained by Native-PAGE screening is F0 (founder), and F0 zebra fish is hybridized with wild zebra fish to obtain F1. The detection result shows that 31 zebra fish of the F0 generation have mutation, and the mutation rate reaches about 80%.

(5) Generation F1 to obtain heritable zebrafish mutants

The zebra fish mutant F0 generation is determined through a series of previous screens, then the mutant F0 generation is respectively hybridized with wild zebra fish to obtain F1 generation embryo, the embryo is cultured at 28.5 ℃, and the survival rate of F1 generation is observed at the initial stage; after fertilization for two days, 10 embryos are respectively taken from each mutant F1 generation for mutation inheritance identification; extracting a genome of each embryo independently, carrying out PCR amplification to obtain a region near a target site of 465bp, observing whether a miniband appears in the PCR amplification, wherein the miniband appears in the PCR amplification, and if the mutation can be inherited to F1 generations, the miniband appears in the PCR amplification;

(6) identification of mutant zebra fish genotypes:

if a small band appears in the F1 generation embryo amplified by PCR, the PCR product is purified and recovered, and Sanger sequencing is carried out, and the sequencing result shows that the size of the PCR band after gene knockout is 377 bp. Culturing zebra fish F1 embryo for 2-3 months; and then respectively carrying out tail shearing on each F1-generation adult zebra fish, extracting a genome for PCR amplification, continuously retaining if a PCR product has a 377bp band, and abandoning the fish for corresponding treatment if the PCR product has only 465 bp. The F1 generation zebra fish was identified as 3 with genetic effect.

7) Obtaining F2 generation homozygote of zebra fish mutant

Selecting female fish and male fish with the same mutation from the F1 generation mutants, hybridizing to obtain F2 generation, culturing at 28 ℃, fertilizing for two days, and taking part of embryo for identification. And (3) independently extracting a genome of each embryo, amplifying a region near a 465bp target site by PCR, analyzing and sequencing by PCR amplification, and preliminarily checking whether a myo7ab mutant homozygote can be obtained. And if the test result proves that homozygotes exist, carrying out single tail shearing identification after cultivation. The effect of the F2 generation zebra fish is identified to be 13.

8) The new zebra fish strain can be obtained by the inheritance of the F3 generation pure line of the gene deletion type zebra fish.

Stable inbred zebrafish lines have been obtained by passage to F3. FIG. 3 is the electrophoresis result of zebra fish F1, the genotype analysis is performed on adult fish of F1 generation, the PCR amplification result shows that compared with wild type, lane 3 has a band of about 377bp in addition to 465bp, and the band is recovered by cutting gel, TA cloned and sequenced. As shown in FIGS. 4 and 5, when the sequencing results were compared with the wild-type sequence (465bp), it was found that both target sites (bold and underlined) of myo7ab had a base deletion, that at target site a, 58 bases were deleted (19 amino acids were deleted), and that at target site b, 30 bases were deleted (10 amino acids were deleted and base-shifting was caused). The partial base deletion of the myo7ab gene of F1 generation of the screened mutant No. 5 causes the frame shift mutation of the whole gene, and the expression of the myo7ab gene of the zebra fish is changed. Thereby affecting the development of the heart of the zebra fish.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Sequence listing

<110> Xiangya II Hospital of Zhongnan university

<120> method for knocking out zebrafish myo7ab gene

<130>MP1937329

<160>13

<170>SIPOSequenceListing 1.0

<210>1

<211>18

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

agucuggagc uggaaaga 18

<210>2

<211>18

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

uugagcagca gguucugg 18

<210>3

<211>22

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gcguaauacg acucacuaua gg 22

<210>4

<211>79

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60

ggcaccgagu cggugcuuu 79

<210>5

<211>119

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gcguaauacg acucacuaua ggagucugga gcuggaaaga guuuuagagc uagaaauagc 60

aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuuu 119

<210>6

<211>119

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gcguaauacg acucacuaua gguugagcag cagguucugg guuuuagagc uagaaauagc 60

aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuuu 119

<210>7

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gtgaatccat accagcttct g 21

<210>8

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ctgggctgta aaagatgtga c 21

<210>9

<211>4047

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

augaaaagcg aaaaaaaaua uuauaucgga uuggauguag guacuaauag uguaggaugg 60

gcugugacug acgaauucua uaauauucuu agagccaaag gaaaagauuu guggggagua 120

agauuauuug aaaaagcaga cacugcagca aacacaagaa uauuuagaag ugguagaaga 180

agaaacgaca gaaaagguau gcgucuucaa auuuugagag aaauuuuuga agaugaaauc 240

aaaaagguug acaaagacuu cuaugacaga cuugaugaaa gcaaauucug ggcugaagac 300

aagaaaguau cugggaaaua uucguuauuu aaugauaaaa auuucagcga caagcaauau 360

uuugaaaagu uuccuacuau uuuucaucuu agaaaauauu uaauggaaga acauggaaaa 420

guagacauua gauacuauuu ucuagcuauc aaucaaauga ugaaaagaag gggacauuuu 480

cuaauagaug gucagauuuc ucacguuaca gaugauaaac cauuaaaaga acaacuuauu 540

cuauuaauaa augauuuauu aaaaaucgaa uuagaagaag agcuuaugga uucgauauuu 600

gaaauuuugg cggaugugaa cgagaaaaga acagacaaga aaaacaaucu aaaagagcuu 660

auaaaaggac aagauuuuaa uaaacaagaa gguaacaucc uaaacucgau uuuugaauca 720

auaguuacug guaaagcaaa aauaaaaaau auaauuucag augaagacau ucuugaaaaa 780

auaaaggaag auaacaagga agauuucguu cuuacaggag auagcuacga ggaaaaucuc 840

caauauuuug aggaaguuuu acaagaaaac auaacauugu uuaacacacu uaaaucaaca 900

uaugauuuuu uaauccuuca aucuauuuua aaagguaaga gcacacuuuc ugaugcacaa 960

gucgaacgau acgaugaaca uaaaaaagac cucgaaauac uuaaaaaagu aauaaaaaaa 1020

uacgaugaag auggaaaauu guucaagcaa guauucaagg aagauaaugg aaauggauau 1080

guuucauaua uuggauauua uuugaacaaa aacaaaaaga uuaccgcaaa gaagaaaaua 1140

ucaaauauug aauuuacaaa auacguuaaa ggaauucuug aaaaacaaug cgacugugaa 1200

gaugaagaug uuaaguauuu auuggggaaa auagaacaag aaaacuuucu auuaaaacaa 1260

auaucaucca uaaauucggu uauuccacau caaauucacc uuuuugaauu agauaaaaua 1320

uuggaaaacu uagccaaaaa cuacccuagc uuuaauaaua agaaggaaga auuuacaaaa 1380

auagaaaaga ucagaaaaac auuuacauuu aggauuccau auuauguugg accauuaaau 1440

gauuaucaca aaaacaaugg cggaaaugcu uggauauuca gaaauaaagg cgaaaaaaua 1500

agaccaugga auuuugaaaa aauaguugau cuucauaaaa gugaagaaga auuuaucaaa 1560

agaaugcuaa aucaaugcac uuaucuucca gaagagacag uucuuccuaa aucuucuauu 1620

cuuuauucag aauauauggu gcuaaaugaa uugaauaauu ugaggauuaa uggaaagcca 1680

cuagauaccg auguuaaguu gaaauuaauu gaagaauuau ucaagaaaaa gacaaaaguc 1740

acucucaaau cgaucagaga uuauauggua aggaauaacu uugcagauaa agaagacuuu 1800

gauaauucag agaaaaacuu ggaaauagca uccaauauga aaucauauau ugauuuuaac 1860

aauauauuag aagacaaguu ugacguagaa augguggaag aucucauuga gaaaauuaca 1920

auucauacgg gaaauaagaa acuuuugaaa aaauacaucg aggaaacuua ucccgauuua 1980

ucaaguucuc aaauucaaaa aauuaucaac cuuaaauaca aagauugggg aagauuauca 2040

agaaaauuau uagacggaau aaaaggaaca aaaaaagaaa cagaaaagac ugauacugua 2100

auuaauuucu ugagaaauuc aagugacaau uugaugcaaa uaauuggaag ccaaaauuac 2160

agcuuuaaug aauauauuga uaaguuaagg aaaaaauaua uuccucaaga aauaaguuau 2220

gaagugguug aaaaucuuua cguaucucca ucuguaaaaa agaugauaug gcaaguuaua 2280

agaguuacag aagaaaucac aaagguuaug ggauaugacc cggauaaaau cuucauagaa 2340

auggcaaaau cugaagagga aaaaaagacg acaauuucua gaaaaaauaa auuacuagac 2400

cuauauaagg cgauaaaaaa agaugaaaga gauagucaau augaaaagcu auuaacaggg 2460

uugaauaaau uagacgauag cgaucuuaga agcagaaaac uuuaucuuua cuacacucaa 2520

auggguagag auauguacac uggcgaaaag auugaccugg auaaauuauu cgauucuaca 2580

cacuacgaua aagaccacau aauaccucaa aguaugaaaa aagaugauuc gauaauaaac 2640

aacuugguau uaguaaauaa aaaugcaaac caaaccacaa aaggcaacau auacccugua 2700

ccauccagua uaagaaacaa uccaaagauu uacaauuacu ggaaguauuu gauggaaaaa 2760

gaguucauca gcaaagaaaa auacaauaga uuaauaagaa auacaccacu aacaaaugaa 2820

gaacuuggcg gauucaucaa cagacaacuu guagaaacaa gacaaucaac aaaagcaauc 2880

aaagaauuau uugaaaaguu cuaccaaaaa ucaaaaauaa uaccuguaaa agcaagucuu 2940

gcaagugauu ugagaaaaga caugaauacc cuuaaaucca gagaaguaaa ugaccuucac 3000

caugcucacg augcguuuuu gaauauugua gcaggagaug uguggaaucg agaguucaca 3060

ucaaauccaa uaaauuaugu caaagaaaac agagaaggug acaagguaaa auauucguua 3120

agcaaagauu uuacaagacc ucguaaaucc aaaggaaaag uuaucuggac accugaaaaa 3180

gguagaaaau ugauuguaga uacauugaau aaaccaucag uucuaaucag caaugaaagu 3240

cauguaaaaa aaggagaguu auucaacgcu accauugcag ggaaaaagga uuacaagaaa 3300

gguaaaauau aucuuccacu aaaaaaagac gauagauuac aagauguauc gaaauaugga 3360

ggauauaagg cuauaaaugg agcguucuuu uucuugguag agcauacuaa aagcaagaaa 3420

agaauaagaa gcauagaauu auuuccguua cauuugcuua guaaauuuua ugaagauaaa 3480

aauacaguau uagauuaugc gauaaaugua uugcaauuac aagauccaaa gauaauaaua 3540

gacaaaauua auuaucguac agaaauaauu auagauaauu uuaguuauuu aauauccacu 3600

aaaucgaaug augguaguau aacuguuaaa ccaaaugagc aaauguauug gagaguugau 3660

gaaauuucga auuugaaaaa aauagaaaau aaauacaaaa aagaugccau auuaacagaa 3720

gaggauagaa aaauuaugga gaguuauauu gauaaaaucu aucaacaauu caaggcagga 3780

aaauacaaga auagacgcac uacugauaca auaauagaaa aauaugaaau aaucgaucua 3840

gacacucuag auaauaaacaauuauaccaa uuacugguag cuuuuauuuc acuuucauau 3900

aaaacaucaa auaaugcagu ggacuuuacu guaauuggac uagguacuga auguggaaag 3960

ccaagaauua cgaauuuacc ugacaacaca uaucuaguau auaaaucaau aacaggaaua 4020

uaugaaaaga ggauaagaau aaaauaa 4047

<210>10

<211>78

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact tgaaaaagtg 60

gcaccgagtc ggtgcttt 78

<210>11

<211>59

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gcgtaatacg actcactata ggagtctgga gctggaaaga gttttagagc tagaaatag 59

<210>12

<211>59

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gcgtaatacg actcactata ggttgagcag caggttctgg gttttagagc tagaaatag 59

<210>13

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

aagcaccgac tcggtgccac t 21

Claims (10)

1. A gRNA targeting the zebrafish myo7ab gene, comprising a promoter element, a target sequence, and a backbone sequence; wherein the target sequence is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

2. A gRNA according to claim 1, wherein the sequence of the promoter element is set forth in SEQ ID No. 3; the framework sequence is shown in SEQ ID NO. 4.

3. The gRNA according to claim 1, including two gRNAs represented by SEQ ID NOS 5-6.

4. A knockout agent targeting zebrafish myo7ab gene, comprising the gRNA of any one of claims 1 to 3 and Cas9 mRNA.

5. The knock-out agent according to claim 4, which comprises nucleic free H₂O and the following concentrations:

MgCl₂10mmol/L；

Cas9 mRNA 150ng/μL；

gRNA 20 ng/. mu.L each.

6. Use of the knock-out agent of claim 4 or 5 in the construction of a model of myo7ab gene-deleted zebrafish.

7. A method for constructing a myo7ab gene-deleted zebra fish model, which is characterized in that the knockout reagent of claim 4 or 5 is inoculated into a fertilized egg of zebra fish at a cell stage, and the zebra fish model with the myo7ab gene-deleted is obtained by hatching.

8. The method of claim 7, wherein 1.5-2.0 nL of the knock-out agent of claim 4 or 5 is administered per fertilized egg.

9. The method according to claim 7 or 8, further comprising a step of screening after said incubation; the screening comprises the following steps: screening embryos fertilized for 36 hours or screening adult fishes;

the screening comprises the steps of amplifying the genome DNA, wherein the amplification product contains a 377bp band, so that the myo7ab gene is deleted, and the amplification product only contains a 465bp fragment, so that the myo7ab gene is not deleted; the sequence of the amplified primer is shown as SEQ ID NO. 7-8.

10. The method according to any one of claims 7 to 9, wherein the zebrafish with the myo7ab gene deletion obtained from hatching is F0 generation; the method further comprises the step of passaging;

the F1 generation zebra fish is obtained by crossing F0 generation zebra fish with wild type zebra fish;

the F2 generation zebra fish is obtained by crossing the F1 generation mutant.

Images