CN111118009A - Method for knocking out zebra fish p2rx2 gene - Google Patents

Abstract

The invention relates to the technical field of gene knockout, in particular to a method for knocking out zebra fish p2rx2 gene. According to the invention, through a CRISPR/Cas9 gene editing technology, a proper targeting site is designed on a zebra fish p2rx2 gene, and specific sgRNA and Cas9-mRNA are synthesized in vitro and used for gene editing of zebra fish. The invention can more efficiently and accurately silence specific genes, has simple manufacture and low cost, can simultaneously cut a plurality of sites on target genes and silence any number of single genes, and also provides a method for selectively breeding p2rx2 gene-deleted zebra fish by gene knockout.

Description

Method for knocking out zebra fish p2rx2 gene

Technical Field

The invention relates to the technical field of gene knockout, in particular to a method for knocking out zebra fish p2rx2 gene.

Background

The p2rx2 gene is located on the zebra fish chromosome 5 and comprises 12 exons and 11 introns, the cDNA total length is 1292bp, 400 amino acids are coded, the p2rx2 gene comprises 4 evolutionarily conserved functional domains, and meanwhile, through gene differential expression profiling analysis, genome correlation analysis and the like, the p2rx2 gene is found to be expressed in a plurality of tissues in the early stage of human embryo, particularly strongly expressed in the auricular vacuoles. The P2RX2 gene mutation can cause non-syndromic autosomal dominant hereditary deafness (DFNA41), the P2RX2 gene is a candidate gene of noise susceptibility genes, and patients are highly sensitive to noise.

The zebra fish has high homology with genes and signal paths in the human auditory canal development process, and p2rx2 genes are conserved in evolution, so that the research finds that the p2rx2 has particularly high expression level in early embryo of the zebra fish. Moreover, compared with other animal models, the zebra fish has the advantages of small size, easy feeding, fast development, strong reproductive capacity, in-vitro fertilization, embryo in-vitro development, transparency and the like. Therefore, the p2rx2 gene in zebra fish is interfered, and the functions of zebra fish are researched by means of genetics, so that the method is helpful for further disclosing the whole process of auditory canal morphogenesis and the molecular mechanism for regulating and controlling the processes, and has very important significance in understanding the pathology of auditory canal diseases and developing new treatment schemes in medicine. The p2rx2 gene is interfered, and the functions of the gene are researched by genetics, so that the gene is helpful for further disclosing the whole process of the morphogenesis of the auricular vesicles and hair cells and the molecular mechanism for regulating the processes, and the gene has very important significance in understanding the pathogenesis of the congenital deafness and developing a treatment scheme for gene correction in medicine.

Gene targeting technology originated in the end of the 20 th century 80 s, is an important means for studying gene function by site-directed modification of genome, and can also be used for treating various genetic diseases of human. The technology mainly utilizes modes such as deletion mutation, gene inactivation, chromosome large fragment deletion, exogenous gene introduction and the like to change the genetic information of organisms, and stably expresses mutation characters after inheritance in a germ line, so that the function of specific genes in the organisms in the growth and development process is researched, and the technical means become a research hotspot of modern molecular biology. The traditional gene targeting technology is based on the Embryonic Stem Cell (ESC) and homologous recombination technology, so the targeting technology has extremely low efficiency. In the beginning of 2013, a novel artificial endonuclease clustered regulated complementary amplified polymorphic polypeptides (CRISPR)/CRISPR-associated (Cas)9 can silence specific genes in organism genomes more efficiently and more accurately, is simple to manufacture and low in cost, and can simultaneously shear a plurality of sites on a target gene and silence any number of single genes.

However, the currently-used method for detecting CRISPR/Cas9 mutation applied to gene knockout of zebra fish has certain defects, such as: tail-snipping of zebrafish at F0 and TA cloning, Sanger sequencing, required significant time, reagents and sequencing costs, and sequencing from F0 did not necessarily lead to inheritance to the next generation. Moreover, the CRISPR/Cas9 technology requires more steps, is too high in cost and has relatively high off-target rate.

Disclosure of Invention

In view of the above, the technical problem to be solved by the present invention is to provide a method for knocking out zebrafish p2rx2 gene, wherein the method adopts a cloning free strategy to knock out zebrafish p2rx2 gene, and the off-target rate is low.

The invention provides a gRNA of a targeted zebra fish p2rx2 gene, which comprises a promoter element, a target sequence and a framework sequence; wherein the target sequence is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

The sequence of the promoter element is shown as SEQ ID NO. 3; the framework sequence is shown in SEQ ID NO. 4.

In some embodiments, the gRNAs targeting the zebrafish p2rx2 gene include two gRNAs shown in SEQ ID NOS: 5-6.

The target sequence is designed aiming at the No. 3 exon of the zebra fish p2rx2 gene, and the invention designs two edited target sites which are respectively a target site a and a target site b. The selection of target site a (transcribed using the T7 promoter) followed the following criteria: 5 ' - (N)20-NGG-3 ', ensuring that the 3 ' end of the target site is NGG; target site b selection followed the following criteria: 5 '-GG- (N) 18-NGG-3' wherein the 5 'GG dinucleotide is part of the T7 promoter to ensure that the 3' end of the target site is NGG; the selected position of the target is within the stem-loop region of the p2rx2 gene. The gRNA of the targeted zebra fish p2rx2 gene designed by the invention has better specificity, and compared with other gRNAs, the gRNA designed by the invention has lower off-target rate, and a good zebra fish p2rx2 gene knockout effect is obtained by matching with cloning free CRISPR/Cas 9.

In the invention, the preparation method of the gRNA of the targeted zebra fish p2rx2 gene comprises the following steps:

step 1: using the synthesized DNA as a template, and respectively amplifying by using two pairs of specific primers to obtain double-stranded DNA;

step 2: and after the double-stranded DNA is transcribed, purifying to obtain gRNA.

Wherein the sequence of the synthesized DNA is shown as SEQ ID NO. 10.

Amplifying to obtain a specific primer of gRNA shown in SEQ ID NO. 5, wherein an upstream primer is shown in SEQ ID NO. 11; the downstream primer is shown as SEQ ID NO. 13;

amplifying to obtain a specific primer of gRNA shown in SEQ ID NO. 6, wherein an upstream primer is shown in SEQ ID NO. 12; the downstream primer is shown as SEQ ID NO. 13.

The system of transcription comprises:

the invention also provides a knockout reagent for targeting zebrafish p2rx2 gene, which comprises gRNA and Cas9 mRNA disclosed by the invention.

In the invention, the Cas9 mRNA is subjected to codon optimization aiming at zebra fish, and has a sequence shown in SEQ ID NO: 9.

in the present invention, the knockout reagent comprises nucleic free H₂O and the following concentrations:

MgCl₂10mmol/L；

Cas9 mRNA 150ng/μL；

gRNA 20 ng/. mu.L each.

The knockout reagent is applied to construction of a p2rx2 gene deletion type zebra fish model.

The invention also provides a method for constructing the p2rx2 gene-deleted zebra fish model, which comprises the steps of inoculating the knockout reagent into a zebra fish fertilized egg at a cell stage, and hatching to obtain the p2rx2 gene-deleted zebra fish model.

In the present invention, 1.5 to 2.0nL of the knock-out reagent is administered to each fertilized egg. In some embodiments, 1.8nL of the knock-out agent is administered per fertilized egg

A screening step is further included after the incubation; the screening comprises the following steps: screening embryos fertilized for 36 hours or screening adult fishes;

the screening comprises the steps of carrying out Sanger sequencing after the genomic DNA is amplified or carrying out screening according to an electrophoresis result; if the amplification product contains bands with sizes of 227bp and 322bp, the p2rx2 gene is deleted, and if the amplification product only has a fragment with the size of 322bp, the p2rx2 gene is not deleted; the sequence of the amplified primer is shown as SEQ ID NO. 7-8.

The p2rx2 gene-deleted zebra fish obtained by hatching is F0 generation; the method further comprises the step of passaging;

the F1 generation zebra fish is obtained by crossing F0 generation zebra fish with wild type zebra fish;

the F2 generation zebra fish is obtained by crossing the F1 generation mutant.

According to the invention, through a CRISPR/Cas9 gene editing technology, a proper targeting site is designed on a p2rx2 gene of zebra fish, specific sgRNA (with a final concentration of 20 ng/mu L) and Cas9-mRNA (with a final concentration of 150 ng/mu L) synthesized in vitro are subjected to microinjection into a zebra fish cell, and after 36h of embryo culture, an embryo is selected for genotype analysis, so that the effectiveness of the targeted site is identified. The invention can silence specific gene in organism genome more efficiently and accurately, has simple manufacture and low cost, can cut a plurality of sites on the target gene simultaneously, silence any number of single genes, interfere p2rx2 gene, and is helpful to further disclose the whole process of the ear morphogenesis and the molecular mechanism for regulating and controlling the processes by researching the functions of the gene by means of genetics, thereby having very important significance in understanding the pathology of deafness disease and developing new treatment schemes in medicine.

Drawings

Fig. 1 is a schematic diagram of a CRISPR/Cas9 targeting system;

FIG. 2 is a diagram of the structure of the target site on the p2rx2 gene;

FIG. 3 is a diagram showing the results of enzyme digestion electrophoresis of zebrafish F0 generation T7E 1;

FIG. 4 is a graph showing the results of electrophoresis of zebra fish F1;

FIG. 5 shows a forward alignment of deletion and WT gene sequences;

FIG. 6 shows a deletion contrast near the target site.

Detailed Description

The invention provides a method for knocking out zebra fish p2rx2 gene, and the technical parameters can be properly improved by the technical personnel in the field by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The test materials adopted by the invention are all common commercial products and can be purchased in the market.

The invention is further illustrated by the following examples:

example 1:

1) design CRISPR/Cas9 gene knockout target site and detection primer

The genomic DNA sequence of zebrafish p2rx2 gene was queried on The National Center for Biotechnology Information (NCBI), its functional domain was analyzed on The website SMART (http:// smart.embl-heidelberg. de /), and The target site of p2rx2 gene was designed on The website The ZiFiT target (http:// ZiFiT. partners. org/ZiFiT /) according to The CRISPR/Cas knockout principle. The selection of the target must follow this criterion: 5 '-GG- (N) 18-NGG-3'. The GG dinucleotide at the 5 'end is part of the T7 promoter, and the target site can be designed without limitation, but the NGG at the 3' end of the target site must be ensured. The target site must be selected within the domain of the gene to ensure that the insertion or deletion of the target site base can affect the entire domain of the p2rx2 gene to alter gene expression.

Two pairs of specific target site PCR primers were as follows:

f1 (target site a forward primer):

GCGTAATACGACTCACTATAGGTGGGGTTTTGCTGTGTGCGTTTTAGAGCTAGAAATAG(SEQ IDNO:11)

f2 (target site b forward primer):

GCGTAATACGACTCACTATAGGAATACGTCAGACCATCTGGTTTTAGAGCTAGAAATAG(SEQ IDNO:12)

r (common reverse primer): AAGCACCGACTCGGTGCCACT (SEQ ID NO:13)

PCR detection primer

The PCR detection primer upstream and downstream primers are respectively positioned on the first intron and the second intron of p2rx 2:

F(5’-TTGTTTGGCATGTATCTGGG-3’)(SEQ ID NO:7)

R(5’-CCACTGTCACCCCATATAGTA-3(SEQ ID NO:8)

universal template sequence

TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT(SEQ ID NO:10)

2) gRNA in vitro synthesis

and a, performing PCR by using the synthesized DNA as a template through the following specific primers to amplify the double-stranded DNA for synthesizing the specific gRNA.

Forward specific target site primer F1 or F2: the T7 promoter 20pb target sequence 20bp gRNA upstream backbone; reverse primer R: 20bp gRNA downstream scaffold

The PCR reaction (25. mu.L) was as follows:

after shaking and mixing, the mixture was centrifuged at 4 ℃ and subjected to amplification reaction on a PCR instrument. The reaction conditions are as follows: pre-denaturation at 95 ℃ for 3min, (denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 15s, and elongation at 72 ℃ for 15s) for 32 cycles, and then at 72 ℃ for 5 min. After the reaction is finished, centrifuging the PCR product, spotting 1 microliter of sample on 1.5% agarose gel for electrophoresis, and shooting the result by a gel imaging system.

And b, detecting to determine that the band is correct, then carrying out agarose gel DNA recovery, and purifying and recovering PCR products.

c, measuring the concentration of the purified DNA (as much as 1 mu g), and taking the DNA as a template to perform in vitro transcription by using a 20 mu L system to synthesize the specific gRNA. The Tip head and the EP tube used in the transcription experiment are both products of DEPC-treated RNase-Free, and the specific operation is as follows:

in vitro transcription reaction system (20 μ L):

adding the reactants into an EP tube with 0.2mL of RNase-Free, uniformly mixing, and carrying out water bath at 37 ℃ for 2 h;

after the water bath is finished, adding 1 mu LDNA enzyme into the transcription system, placing the transcription system in a water bath kettle at 37 ℃ for reaction for 30min to digest the DNA template, taking 1 mu L of sample, and carrying out electrophoresis by using prepared 1.5% agarose gel to detect the transcription result, wherein if the size of the transcription product is consistent with that expected, the successful transcription is indicated;

d, purification of specific gRNAs

Successfully transcribed gRNAs were purified using the RNeasy Mini kit and stored at-20 ℃.1 μ L of the purified gRNA solution was aspirated for agarose gel electrophoresis to check the purified product, and the gRNA concentration after purification was determined.

3) Microinjection of zebrafish embryos

Within 30min after fertilization, embryos were pipetted into a microinjection petri dish made of agarose.

Before microinjection, Cas9 mRNA and gRNA are mixed into a mixed solution and are fully mixed, so that the final concentration of Cas9 mRNA is 150 ng/mu L, and the final concentration of gRNA is 20 ng/mu L. About 1.0nL of Cas9 mRNA and gRNA cocktail was injected into fertilized eggs at one cell stage. The injected fertilized eggs were incubated in E3 water (5mmol/L NaCl, 0.33mmol/L CaCl2, 0.33mmol/L MgSO4, 0.17mmol/L KCl) at 28 ℃. Embryo phenotype is observed under a body type microscope, and the embryo which normally develops is screened for target site mutation analysis.

Microinjection systems were as follows:

4) sanger sequencing to test the effectiveness of target sites

After microinjection is carried out on zebra fish embryos, 5-10 early embryos are randomly selected, whether p2rx2 genes are mutated or not is detected, whether the selected target site has an effect or not can be confirmed in advance, and whether microinjection operation is standard or not can be determined.

a. Extraction of zebra fish genome

After the zebra fish embryo is fertilized for 36 hours (36hpf), a wild type (used as a control) and an injected embryo are respectively collected in a 1.5mLEp tube (2 embryos per tube), and the genome DNA is extracted according to the following method, which comprises the following steps:

to Ep tube containing embryo, 200. mu.L of cell lysate and 2. mu.L of proteinase K were added and placed in a 55 ℃ water bath for lysis overnight.

After the cracking is finished, placing the mixture on an oscillator for full oscillation, adding isopropanol (cooled in advance) with the same volume (200 mu L) into an Ep tube, fully reversing and uniformly mixing the mixture, centrifuging the mixture at 12000 Xg for 10min at the temperature of 4 ℃, and pouring out supernatant;

adding 500 μ L of 75% ethanol, centrifuging at 12000 × g at 4 deg.C for 5min, removing supernatant, and air drying at room temperature for 20 min;

adding 60 μ L deionized water, fully beating, mixing, and detecting extraction efficiency by agarose gel electrophoresis

b. PCR amplification of target sequences

After extracting the genomic DNA, designing a Primer sequence by using Primer Premier 5.0 software according to a genomic region of about 150-200bp upstream and downstream of the CRISPR target site to amplify the target DNA fragment.

The PCR reaction (30. mu.L) was as follows:

after shaking and mixing, the mixture was centrifuged at 4 ℃ and subjected to amplification reaction on a PCR instrument. The reaction conditions are as follows: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s, annealing at 60 deg.C for 30s, and extension at 72 deg.C for 30s for 30 cycles, and further denaturation at 72 deg.C for 8 min. After the reaction is finished, centrifuging the PCR product, taking 5 mu L of sample to sample on 1.5% agarose gel for electrophoresis, and detecting whether large fragment deletion exists.

c. If no large fragment is deleted, the T7E1 enzyme digestion is carried out, and the 1.5% agarose gel electrophoresis is used for identifying whether small fragments are deleted.

d. PCR amplification of large amounts of target sequences

The PCR reaction system is as follows:

after shaking and mixing, centrifuging at 4 ℃, and carrying out amplification reaction on a PCR instrument under the following reaction conditions: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30s, annealing at 60 deg.C for 30s, and extension at 72 deg.C for 30s for 30 cycles, and further denaturation at 72 deg.C for 8 min. After the reaction is finished, centrifuging the PCR product, taking 5 microliter of sample to sample on 1.5% agarose gel for electrophoresis, and detecting whether the size of the PCR product is correct or not.

e. If the PCR product is correct in size, the PCR product is separated by 1.5% agarose gel electrophoresis, and the desired band is excised for DNA purification.

f. Sending the target DNA fragment after partial purification to Sanger sequencing, and obtaining the information of insertion or deletion primarily from the sequencing peak diagram.

4) Two months after injection, the tail-cutting identification was performed as in the identification procedure above.

5) TA cloning of sequences of interest

The target sequences with possible mutations were preliminarily identified by PCR and then subjected to Sanger sequencing. If the sequencing peak map has double peaks and the sequencing result shows that the target sequence has the insertion or deletion phenomenon, then the TA cloning is carried out, and then the monoclonal is picked for further detection.

6) Sanger sequencing of plasmids

And (3) sending the plasmid with the band size meeting the expected result shown by the double-enzyme digestion detection result to sequencing, comparing the plasmid with a standard target sequence on NCBI according to a peak diagram and a sequence given after sequencing, and analyzing the mutation type of each monoclonal according to the comparison result.

The detection result shows that 7 mutant zebra fish of the 36F 0 generations are available.

7) Generation F1 to obtain heritable zebrafish mutants

The zebra fish mutant F0 generation was confirmed by the previous series of screens, and then the F0 generation mutant was respectively crossed with wild zebra fish to obtain F1 generation embryos, which were cultured at 28 ℃ and the survival rate of F1 generation was observed at the early stage. Two days after fertilization, 10 embryos were taken for each mutant F1 generation for the identification of the inheritance of the mutation. Extracting genome of each embryo independently, carrying out PCR amplification to obtain a region near a 322bp target site, observing whether a small band appears in PCR amplification or not, wherein the PCR amplification has a small band of about 227bp, and if the mutation can be inherited to F1 generation, whether the PCR amplification has a small band of less than 227bp or not.

The zebrafish mutant was bred for up to 2-3 months for F1 generations if the presence of a mutation was detected from F1 generation embryos. And then, respectively carrying out tail shearing on each F1 generation adult zebra fish, and screening F1 generation mutants (the specific method is as described above). 3 of the 26F 1 generations of zebra fish were identified to have a genetic effect.

8) Obtaining F2 generation homozygote of zebra fish mutant

Selecting female fish and male fish with the same mutation from the F1 generation mutants, hybridizing to obtain F2 generation, culturing at 28 deg.C, fertilizing for four days, and taking part of embryo for identification. Extracting genome of each embryo separately, amplifying a region near a 227bp target site by PCR, analyzing and sequencing by PCR amplification, and primarily checking whether a p2rx2 mutant homozygote can be obtained. And if the test result proves that homozygotes exist, carrying out single tail shearing identification after cultivation. The homozygote was identified to be 8 out of 34F 2 generations of zebra fish.

9) The new zebra fish strain can be obtained by the inheritance of the F3 generation pure line of the gene deletion type zebra fish.

Stable inbred zebrafish lines have been obtained by passage to F3. FIG. 3 is a photograph showing the results of cleavage electrophoresis of zebrafish F0 at T7E1, and genotype analysis was performed on adult zebrafish F0 at T7E1, which shows that E1 has a cleavage band in addition to the 322bp band, and similarly E2 and E4 have cleavage bands in comparison with C1, and therefore, fish Nos. 1, 2 and 4 have small-fragment gene deletion.

FIG. 4 is the electrophoresis result chart of zebra fish F1, the genotype analysis is performed on adult fish of F1 generation, the PCR amplification result shows that the 2 lane has a band of about 227bp besides the 322bp band compared with the wild type, and the band is cut and recovered, TA cloned and sequenced. As shown in FIGS. 4 and 5, when the sequencing results were compared with the wild-type sequence (322bp), it was found that p2rx2 had a base deletion at the target site b (underlined) and a 91 base deletion at the target site b (297 amino acids were deleted and base-shifted). The partial base deletion of p2rx2 gene of F1 generation of the screened No. 2 mutant causes frame shift mutation of the whole gene, and the expression of zebra fish p2rx2 gene is changed. Thereby affecting the development of the zebra fish ear vacuoles.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Sequence listing

<110> Xiangya II Hospital of Zhongnan university

<120> method for knocking out zebrafish p2rx2 gene

<130>MP1937330

<160>13

<170>SIPOSequenceListing 1.0

<210>1

<211>18

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ugggguuuug cugugugc 18

<210>2

<211>18

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

aauacgucag accaucug 18

<210>3

<211>22

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gcguaauacg acucacuaua gg 22

<210>4

<211>79

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60

ggcaccgagu cggugcuuu 79

<210>5

<211>119

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gcguaauacg acucacuaua ggugggguuu ugcugugugc guuuuagagc uagaaauagc 60

aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuuu 119

<210>6

<211>119

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gcguaauacg acucacuaua ggaauacguc agaccaucug guuuuagagc uagaaauagc 60

aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu ggcaccgagu cggugcuuu 119

<210>7

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ttgtttggca tgtatctggg 20

<210>8

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ccactgtcac cccatatagt a 21

<210>9

<211>4047

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

augaaaagcg aaaaaaaaua uuauaucgga uuggauguag guacuaauag uguaggaugg 60

gcugugacug acgaauucua uaauauucuu agagccaaag gaaaagauuu guggggagua 120

agauuauuug aaaaagcaga cacugcagca aacacaagaa uauuuagaag ugguagaaga 180

agaaacgaca gaaaagguau gcgucuucaa auuuugagag aaauuuuuga agaugaaauc 240

aaaaagguug acaaagacuu cuaugacaga cuugaugaaa gcaaauucug ggcugaagac 300

aagaaaguau cugggaaaua uucguuauuu aaugauaaaa auuucagcga caagcaauau 360

uuugaaaagu uuccuacuau uuuucaucuu agaaaauauu uaauggaaga acauggaaaa 420

guagacauua gauacuauuu ucuagcuauc aaucaaauga ugaaaagaag gggacauuuu 480

cuaauagaug gucagauuuc ucacguuaca gaugauaaac cauuaaaaga acaacuuauu 540

cuauuaauaa augauuuauu aaaaaucgaa uuagaagaag agcuuaugga uucgauauuu 600

gaaauuuugg cggaugugaa cgagaaaaga acagacaaga aaaacaaucu aaaagagcuu 660

auaaaaggac aagauuuuaa uaaacaagaa gguaacaucc uaaacucgau uuuugaauca 720

auaguuacug guaaagcaaa aauaaaaaau auaauuucag augaagacau ucuugaaaaa 780

auaaaggaag auaacaagga agauuucguu cuuacaggag auagcuacga ggaaaaucuc 840

caauauuuug aggaaguuuu acaagaaaac auaacauugu uuaacacacu uaaaucaaca 900

uaugauuuuu uaauccuuca aucuauuuua aaagguaaga gcacacuuuc ugaugcacaa 960

gucgaacgau acgaugaaca uaaaaaagac cucgaaauac uuaaaaaagu aauaaaaaaa 1020

uacgaugaag auggaaaauu guucaagcaa guauucaagg aagauaaugg aaauggauau 1080

guuucauaua uuggauauua uuugaacaaa aacaaaaaga uuaccgcaaa gaagaaaaua 1140

ucaaauauug aauuuacaaa auacguuaaa ggaauucuug aaaaacaaug cgacugugaa 1200

gaugaagaug uuaaguauuu auuggggaaa auagaacaag aaaacuuucu auuaaaacaa 1260

auaucaucca uaaauucggu uauuccacau caaauucacc uuuuugaauu agauaaaaua 1320

uuggaaaacu uagccaaaaa cuacccuagc uuuaauaaua agaaggaaga auuuacaaaa 1380

auagaaaaga ucagaaaaac auuuacauuu aggauuccau auuauguugg accauuaaau 1440

gauuaucaca aaaacaaugg cggaaaugcu uggauauuca gaaauaaagg cgaaaaaaua 1500

agaccaugga auuuugaaaa aauaguugau cuucauaaaa gugaagaaga auuuaucaaa 1560

agaaugcuaa aucaaugcac uuaucuucca gaagagacag uucuuccuaa aucuucuauu 1620

cuuuauucag aauauauggu gcuaaaugaa uugaauaauu ugaggauuaa uggaaagcca 1680

cuagauaccg auguuaaguu gaaauuaauu gaagaauuau ucaagaaaaa gacaaaaguc 1740

acucucaaau cgaucagaga uuauauggua aggaauaacu uugcagauaa agaagacuuu 1800

gauaauucag agaaaaacuu ggaaauagca uccaauauga aaucauauau ugauuuuaac 1860

aauauauuag aagacaaguu ugacguagaa augguggaag aucucauuga gaaaauuaca 1920

auucauacgg gaaauaagaa acuuuugaaa aaauacaucg aggaaacuua ucccgauuua 1980

ucaaguucuc aaauucaaaa aauuaucaac cuuaaauaca aagauugggg aagauuauca 2040

agaaaauuau uagacggaau aaaaggaaca aaaaaagaaa cagaaaagac ugauacugua 2100

auuaauuucu ugagaaauuc aagugacaau uugaugcaaa uaauuggaag ccaaaauuac 2160

agcuuuaaug aauauauuga uaaguuaagg aaaaaauaua uuccucaaga aauaaguuau 2220

gaagugguug aaaaucuuua cguaucucca ucuguaaaaa agaugauaug gcaaguuaua 2280

agaguuacag aagaaaucac aaagguuaug ggauaugacc cggauaaaau cuucauagaa 2340

auggcaaaau cugaagagga aaaaaagacg acaauuucua gaaaaaauaa auuacuagac 2400

cuauauaagg cgauaaaaaa agaugaaaga gauagucaau augaaaagcu auuaacaggg 2460

uugaauaaau uagacgauag cgaucuuaga agcagaaaac uuuaucuuua cuacacucaa 2520

auggguagag auauguacac uggcgaaaag auugaccugg auaaauuauu cgauucuaca 2580

cacuacgaua aagaccacau aauaccucaa aguaugaaaa aagaugauuc gauaauaaac 2640

aacuugguau uaguaaauaa aaaugcaaac caaaccacaa aaggcaacau auacccugua 2700

ccauccagua uaagaaacaa uccaaagauu uacaauuacu ggaaguauuu gauggaaaaa 2760

gaguucauca gcaaagaaaa auacaauaga uuaauaagaa auacaccacu aacaaaugaa 2820

gaacuuggcg gauucaucaa cagacaacuu guagaaacaa gacaaucaac aaaagcaauc 2880

aaagaauuau uugaaaaguu cuaccaaaaa ucaaaaauaa uaccuguaaa agcaagucuu 2940

gcaagugauu ugagaaaaga caugaauacc cuuaaaucca gagaaguaaa ugaccuucac 3000

caugcucacg augcguuuuu gaauauugua gcaggagaug uguggaaucg agaguucaca 3060

ucaaauccaa uaaauuaugu caaagaaaac agagaaggug acaagguaaa auauucguua 3120

agcaaagauu uuacaagacc ucguaaaucc aaaggaaaag uuaucuggac accugaaaaa 3180

gguagaaaau ugauuguaga uacauugaau aaaccaucag uucuaaucag caaugaaagu 3240

cauguaaaaa aaggagaguu auucaacgcu accauugcag ggaaaaagga uuacaagaaa 3300

gguaaaauau aucuuccacu aaaaaaagac gauagauuac aagauguauc gaaauaugga 3360

ggauauaagg cuauaaaugg agcguucuuu uucuugguag agcauacuaa aagcaagaaa 3420

agaauaagaa gcauagaauu auuuccguua cauuugcuua guaaauuuua ugaagauaaa 3480

aauacaguau uagauuaugc gauaaaugua uugcaauuac aagauccaaa gauaauaaua 3540

gacaaaauua auuaucguac agaaauaauu auagauaauu uuaguuauuu aauauccacu 3600

aaaucgaaug augguaguau aacuguuaaa ccaaaugagc aaauguauug gagaguugau 3660

gaaauuucga auuugaaaaa aauagaaaau aaauacaaaa aagaugccau auuaacagaa 3720

gaggauagaa aaauuaugga gaguuauauu gauaaaaucu aucaacaauu caaggcagga 3780

aaauacaaga auagacgcac uacugauaca auaauagaaa aauaugaaau aaucgaucua 3840

gacacucuag auaauaaaca auuauaccaa uuacugguag cuuuuauuuc acuuucauau 3900

aaaacaucaa auaaugcagu ggacuuuacu guaauuggac uagguacuga auguggaaag 3960

ccaagaauua cgaauuuacc ugacaacaca uaucuaguau auaaaucaau aacaggaaua 4020

uaugaaaaga ggauaagaau aaaauaa 4047

<210>10

<211>78

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact tgaaaaagtg 60

gcaccgagtc ggtgcttt 78

<210>11

<211>59

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gcgtaatacg actcactata ggtggggttt tgctgtgtgc gttttagagc tagaaatag 59

<210>12

<211>59

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gcgtaatacg actcactata ggaatacgtc agaccatctg gttttagagc tagaaatag 59

<210>13

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

aagcaccgac tcggtgccac t 21

Claims (10)

1. A gRNA targeting zebrafish p2rx2 gene, comprising a promoter element, a target sequence, and a backbone sequence; wherein the target sequence is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

2. A gRNA according to claim 1, wherein the sequence of the promoter element is set forth in SEQ ID No. 3; the framework sequence is shown in SEQ ID NO. 4.

3. The gRNA according to claim 1, including two gRNAs represented by SEQ ID NOS 5-6.

4. A knockout agent targeting zebrafish p2rx2 gene, comprising the gRNA of any one of claims 1 to 3 and Cas9 mRNA.

5. The knock-out agent according to claim 4, which comprises nucleic free H₂O and the following concentrations:

MgCl₂10mmol/L；

Cas9 mRNA 150ng/μL；

gRNA 20 ng/. mu.L each.

6. Use of the knock-out reagent of claim 4 or 5 in the construction of a p2rx2 gene-deleted zebra fish model.

7. A method for constructing a p2rx2 gene-deleted zebra fish model, which is characterized in that the knock-out reagent of claim 4 or 5 is inoculated into a fertilized egg of zebra fish in a cell stage, and the zebra fish model with the p2rx2 gene-deleted is obtained by incubation.

8. The method of claim 7, wherein 1.5-2.0 nL of the knock-out agent of claim 4 or 5 is administered per fertilized egg.

9. The method according to claim 7 or 8, further comprising a step of screening after said incubation; the screening comprises the following steps: screening embryos fertilized for 36 hours or screening adult fishes;

the screening comprises the steps of carrying out Sanger sequencing after the genomic DNA is amplified or carrying out screening according to an electrophoresis result; if the amplification product contains bands with sizes of 227bp and 322bp, the p2rx2 gene is deleted, and if the amplification product only has a fragment with the size of 322bp, the p2rx2 gene is not deleted; the sequence of the amplified primer is shown as SEQ ID NO. 7-8.

10. The method according to any one of claims 7 to 9, wherein the p2rx2 gene-deleted zebrafish obtained by hatching is F0 generation; the method further comprises the step of passaging;

the F1 generation zebra fish is obtained by crossing F0 generation zebra fish with wild type zebra fish;

the F2 generation zebra fish is obtained by crossing the F1 generation mutant.

Images