CN111118043A

CN111118043A - Sophora alopecuroides SaMET6 gene clone and application thereof

Info

Publication number: CN111118043A
Application number: CN202010030181.8A
Authority: CN
Inventors: 王庆钰; 朱有成; 王英; 闫帆; 刘雅婧; 郭文云; 李景文; 王豆豆; 杨旭光; 张鑫生; 赵磊; 蒙佳慧; 高子为; 刘宇淇
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2020-01-13
Filing date: 2020-01-13
Publication date: 2020-05-08
Anticipated expiration: 2040-01-13
Also published as: CN111118043B

Abstract

The invention relates to cloning and application of Sophora alopecuroides SaMET6 gene, belonging to the technical field of genetic engineering, screening the salt-resistant related Sophora alopecuroides gene from the expression library of the yeast of Sophora alopecuroides by simulating adversity stress, determining the salt-resistant related Sophora alopecuroides gene as SaMET6 by bioinformatics analysis, and finding that the gene is expressed in roots, stems and leaves of Sophora alopecuroides by quantitative detection by using RT-PCR technology, wherein the expression level in the roots is the highest, and the expression level in the roots is obviously changed under the condition of salt treatment. The gene is subjected to functional verification BY constructing a yeast expression vector and a plant expression vector and successfully transforming yeast BY4743 and arabidopsis thaliana, and the result shows that the gene can obviously improve the salt tolerance and the drought tolerance after being over-expressed in the yeast and arabidopsis thaliana, so that a new gene resource is provided for improving the stress resistance of crops through a gene engineering technology.

Description

Sophora alopecuroides SaMET6 gene clone and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and relates to a method for expressing and screening a gene SaMET6 related to plant stress resistance (specifically salt and drought) by using Saccharomyces cerevisiae INVSC1, and researching the function of the gene on abiotic stress NaCl and PEG by using a Real-Time fluorescent quantitative PCR (Real-Time PCR) method.

Background

Soil salinization is a global problem which restricts agricultural production at present, about 20 percent of cultivated lands in the world are threatened by salt damage, and 43 percent of cultivated lands are arid and semi-arid regions. Stress is one of the most important factors and challenges affecting grain yield. During the growth and development of crops, crops are influenced by various adversity factors, including biotic stress and abiotic stress, wherein the abiotic stress includes salt, alkali, high temperature, low temperature, drought and the like, the stress limits the growth and development of the plants, and finally, the yield of the crops is reduced, the quality of the crops is reduced, and even the direct influence threatens food safety, among the adversity factors influencing the production of the crops, high salinity and drought, nutritional imbalance (including mineral deficiency and mineral poisoning), high temperature and low temperature are main factors influencing the yield of the crops, the yield reduction of the crops caused by the adversity such as salt, alkali, drought, high temperature and low temperature stress still exceeds 20 percent of the total yield every year, and the drought and salt stress are the most main limiting factors. Therefore, improving the salt and drought tolerance of crops has become one of the key problems to be solved urgently in crop breeding. At present, the clone of the stress-related gene and the analysis of the function thereof are carried out by a genetic engineering method, and valuable information and materials can be provided for the breeding of the plant with stress resistance. However, from the perspective of directly solving key problems in agricultural production, the varieties of transgenic crops which play a significant role in agricultural production are not many, the research on plant stress adaptability molecular mechanism by human is far insufficient, the demand of plant molecular breeding is far from being met, and compared with developed countries in the world, China has relatively few genes with independent intellectual property rights and important utilization values. Therefore, the method takes the drought-borne and saline-alkali tolerant plants as research materials, separates and clones the salt-tolerant and drought-tolerant genes, is an effective method for obtaining resistance gene resources, and can provide more candidate genes for a research method for improving the tolerance of crops to biotic and abiotic stresses through genetic engineering.

Sophora alopecuroides L is a plant of the genus Sophora of the family Leguminosae, namely Sophora alopecuroides L, and is a perennial herb, namely a drought-tolerant plant with rhizomes and underground buds. It mostly occurs in arid desert and grassland border zones. Mainly distributed in arid areas such as western inner Mongolia, Xinjiang, Gansu and the like in China, and has strong drought and salt tolerance. The sophora alopecuroide is mainly grown on sandy soil, is resistant to sand burying and wind erosion, has good sand growth characteristics, and has the advantages that the plant root system is deep and wide in extension due to frequent water movement, and is shallow due to unsmooth up-and-down movement of water in the soil with a compact structure. In the semi-fixed sand dune, sophora alopecuroides is mostly pioneer species, and sophora alopecuroides grows first after the movable sand dune is fixed. The sophora alopecuroide is not only an excellent sand-fixing plant and available pasture, but also an important medicinal plant resource, has wide application, rich resource and extremely high development and utilization value.

Saccharomyces cerevisiae (Saccharomyces cerevisiae) has a typical eukaryotic system, is diploid, can form disulfide bonds in the protein post-translational processing process, has the characteristics of glycosylation, protein folding and the like, enables the gene expression mode to be closer to the expression mode in eukaryotic plants, and also has the advantages of rapid growth, simple and convenient genetic operation, easy culture and the like, so that the yeast expression system is used for screening in the related research of plant functional genes, and has the irreplaceable advantage of a prokaryotic expression system. The saccharomyces cerevisiae strain INVSC1 (with the genotype of MATa his3D1 leu2 trp1-289 ura3-52) is an artificially modified uracil auxotrophic strain, and when a yeast transformant of the strain is screened by using an SC-U deficient culture medium, false positive is low, and the transformation efficiency is high, so that the strain is an ideal yeast expression strain. The study and mining of plant cDNA libraries using yeast auxotrophic strains has received increasing attention in plants. Frommer et al and Hsu et al (1993) clone the amino acid-permeable enzyme NAT2/AAP1 gene in the screening Arabidopsis cDNA library, which can complement the amino acid transport-deficient mutant of yeast; the function research of the yeast system research plant salt tolerance expression gene is also widely applied, Yamada et al (2002) verify that the allene cyclase (AOC) gene can greatly improve the salt tolerance by using a yeast transformant, and further speculate that the AOC gene can also have the salt tolerance function in the plant. Tangyulin et al (2007) researches that soybean SAL I3-2 protein can enable salt tolerance of yeast transformants to be remarkably improved by using yeast, and therefore stress resistance of SALI3-2 gene is presumed. Thus, it can be seen that the expression of foreign proteins and the study of their functions by yeast have been widely used.

Methionine (DL-Methionine), a sulfur-containing essential amino acid, must be converted in vivo to the L-form by the organism to be utilized. Is closely related to the metabolism of various sulfur-containing compounds in organisms. In organisms, the adenosine group is first changed from ATP to S-adenosylmethionine (active methionine) and then the methyl group is transferred. Homocysteine, which has lost its methyl group, is converted to cysteine via cystathionine. 5-Methyltetrahydropterin-based triglyceride homocysteine methyltransferase (5-methylcysteine methyltransferase-like MET6) is an enzyme involved in a novel pathway for L-methionine biosynthesis and is itself part of amino acid biosynthesis. Under abiotic stress (drought, high salt, low temperature and the like) and biotic stress (pathogen infection), the mRNA level of the plant 5-methyltetrahydropterin-based triglyceride homocysteine methyltransferase is remarkably increased, and the plant 5-methyltetrahydropterin-based triglyceride homocysteine methyltransferase is considered to be involved in nucleotide and amino acid metabolism and mainly involved in cysteine and methionine metabolic pathways.

The invention provides a sophora alopecuroides 5-methyltetrahydropterin-based triglyceride homocysteine methyltransferase gene, which is called sophora alopecuroides cysteine methyltransferase gene for short and named as SaMET6, however, no research report about the physiological functions of sophora alopecuroides SaMET6 gene in stress resistance and the like exists in the current research.

Disclosure of Invention

The invention constructs a salt stress (200Mm NaCl) and drought stress (8 percent PEG) full-length cDAN library of Sophora alopecuroides L, successfully recombines the library into a yeast expression vector (pYES-DEST52), a mixed plasmid vector is transformed into a yeast strain INVSC1, selects the Sophora alopecuroides gene related to the stress by simulating the stress (NaCl, PEG), obtains a gene nucleic acid sequence by sequencing, carries out bioinformatics analysis on the gene, finds that the gene possibly belongs to a 5-methyltetrahydropterin-triglyceride homocysteine methyltransferase family gene, is called as Sophora alopecuroides cysteine methyltransferase gene for short, and is named as SaMET6, designs a clone primer and a quantitative primer according to the sequence obtained by sequencing, and simultaneously detects the expression quantity change of the gene in different tissues of the Sophora alopecuroides under the stress (NaCl, PEG6000) by using an RT-PCR technology, the corresponding effect of the gene in the stress of the sophora alopecuroides is preliminarily researched, and the SaMET6 gene is found to show obvious response to salt stress and drought stress, the expression level in roots is high, and the expression level is obviously up-regulated after the stress treatment. At the same time, the gene is constructed into a yeast expression vector and a plant overexpression vector and is successfully transferred into yeast BY4743 and wild type arabidopsis thaliana for function preliminary verification, and the result shows that a recombinant yeast transformant of the transgenic yeast BY-SaMET 6 shows obvious salt stress resistance, and transgenic pCHF3300-SaMET6 arabidopsis thaliana shows obvious salt tolerance and drought tolerance.

The invention provides a sophora alopecuroides 5-methyltetrahydropterin triglyceride homocysteine methyltransferase gene, called sophora alopecuroides cysteine methyltransferase gene for short, named SaMET6, and is shown as SEQ ID NO: 1. The gene consists of 1041 basic groups in total, a complete open reading frame contains 507bp and also contains a 5' untranslated region sequence, the initiation codon of the open reading frame is ATG, and the termination codon is TAA. The protein provided by the invention is drought-resistant and salt stress-resistant, is named SaMET6, is 5-methyltetrahydropterin-based triglyceride homocysteine methyltransferase, is derived from sophora alopecuroides, and plant stress-resistance related protein SaMET6 is protein consisting of an amino acid sequence shown in SEQ ID NO.2 in a sequence table.

Drawings

FIG. 1 is a colony diagram of SD/-Ura (containing NaCl 0.68mol/l) screening medium

FIG. 2 shows PCR detection of yeast positive clones

Wherein: the 5 th is SaMET6 gene; m:2000bp marker,1-6: Yeast amplification results

FIG. 3 shows the electrophoresis chart of SaMET6 gene clone recovery

FIG. 4 shows the restriction enzyme-digestion-verified electrophoresis of pCHF3300-SaMET6 vector

FIG. 5 shows the results of non-stress recombinant yeasts pYES-SaMET6 and pYES-DEST52

FIG. 6 is a graph showing the results of the recombinant yeasts pYES-SaMET6 and pYES-DEST52 under 1.0M NaCl stress

FIG. 7 shows the relative expression levels of SaMET6 gene in different tissues under control and NaCl treatment conditions

FIG. 8 shows the relative expression levels of SaMET6 gene in the leaves of Sophora alopecuroides at different treatment times under the condition of 1.2% NaCl treatment

FIG. 9 shows the relative expression levels of SaMET6 gene in the stem of Sophora alopecuroides at different treatment times under the condition of 1.2% NaCl treatment

FIG. 10 shows the relative expression levels of the Sophora alopecuroides SaMET6 gene in roots treated with 1.2% NaCl under different treatment times

FIG. 11 shows the relative expression levels of the Sophora alopecuroides SaMET6 gene in roots treated with 8% PEG for different treatment times

FIG. 12 shows the detection of pCHF3300-SaMET6 vector transformation Agrobacterium EHA105 bacterial liquid pcr

FIG. 13 shows the results of T1 generation detection of SaMET6 transgenic Arabidopsis thaliana

FIG. 14 shows the results of T2 generation detection of SaMET6 transgenic Arabidopsis thaliana

FIG. 15 shows the relative expression levels of different strains of SaMET6 transgenic Arabidopsis

FIG. 16 shows the 5-day phenotypic differences between wild type Arabidopsis thaliana and SaMET6 transgenic Arabidopsis thaliana under 300mM NaCl treatment

FIG. 17 shows the phenotypic differences between wild type Arabidopsis thaliana and SaMET6 transgenic Arabidopsis thaliana after one week of drought treatment

Detailed Description

Example 1: obtaining and sequence analysis of full-length cDNA of SaMET6 gene

1. Stress-treating the sophora alopecuroides:

selecting 10g of the seeds of the full sophora alopecuroides, and adding 5ml of 98% concentrated sulfuric acid for soaking for 20 min. After being washed clean, the seeds are sowed in soil (peat: vermiculite: 1), and the culture conditions are as follows: 16h illumination, 26 ℃ temperature, 65% humidity and 30000 lux light intensity. After 4 weeks of germination, seedlings were transferred to a hoagland nutrient solution containing 200mM NaCl for 0h, 1h, 2h, 4h, 8h, 12h, 24h, and 48h, respectively. Taking the roots of the sophora alopecuroides under each treatment, and freezing and storing at minus 80 ℃ for preparing a warehouse.

2. Constructing a cDNA library:

total RNA was extracted from the Sophora alopecuroides samples (radicles) after NaCl treatment for each period, and then single-stranded cDNA containing an intact cap structure was enriched using a 'cap antibody module' of Invitrogen corporation and used as follows

Constructing a Full-Length cDNA Library by a Full-Length cDNA Library restriction Kit, recombining the cDNA Library LR into a yeast expression vector pYES-DEST52 by a Gateway technology, randomly carrying out PCR detection on the cDNA Library, sequencing fragments with the Length of more than 500bp, and carrying out functional domain comparison and related bioinformatics analysis by using BlastX of NCBI.

2.1 method for extracting total RNA of sophora alopecuroide:

2.1.1 taking 100mg of plant sample, quickly grinding into powder in a precooled mortar by using liquid nitrogen, and quickly transferring to 2mL of cold

Centrifuging the tube. (ensure the whole process in a ventilated kitchen, prevent RNA degradation.)

2.1.2 adding 1ml Trizol reagent, shaking vigorously and mixing for 15s, standing for 10min to fully lyse the cells.

2.1.3 adding 0.2mL chloroform (chloroform), shaking rapidly and mixing for 15s, standing for 5 min.

2.1.4 high speed Low temperature (12,000rpm, 4 ℃) centrifugation for 15 min.

2.1.5 the supernatant was carefully transferred to a new 1.5mL centrifuge tube, 0.5mL isopropanol was added, mixed by inversion and allowed to stand for 10 min.

2.1.6 high speed low temperature (12,000rpm, 4 ℃) centrifugation for 10min again.

2.1.7 remove the supernatant, add 0.5mL 75% ethanol, 7,500rpm low temperature centrifugation for 5min to wash the precipitate.

2.1.8 repeat step 2.1.7 once and wash the precipitate further to remove ions.

2.1.9 the supernatant was carefully aspirated and the RNA pellet was dried in a fume hood and the RNA was dissolved in 50. mu.L of DEPC water.

3. Screening_{SaMET6 gene}Cloning of the fragments:

according to sequencing analysis, sophora alopecuroides ESTs are obtained, a cDNA complete sequence SaMET6 for coding 5-methyltetrahydropterin-based triglyceride homocysteine methyltransferase is obtained, a yeast expression vector pYES-SaMET6 obtained by LR recombination is transformed into an escherichia coli competent cell (DH5 α), after overnight culture, a single colony is picked up and cultured in an LB (Amp containing 100 mg/L) liquid culture medium overnight, plasmids are extracted through a plasmid extraction kit (Dingguo company), and plasmid PCR amplification verification is carried out according to a universal sequence PCR primer on the vector, so as to identify the obtained cDNA sequence.

Upstream (T7): 5'-TAATACGACTCACTATAGGG-3'

Downstream (R): 5'-AGGGTTAGGGATAGGCTTACCTTC-3'

PCR reaction (25. mu.L): buffer 2.5. mu.L, upstream and downstream primers (T7, R) 0.5. mu. L, Tag each, dNTP 0.5. mu.L, template 0.2. mu. L, ddH₂O20.8. mu.L. Conditions of the PCR reaction: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds; rapidly cooling to 58 ℃ and annealing for 30 seconds; extension at 72 ℃ for 2 min for 30 cycles; extension at 72 ℃ for 10 min; and cooling and storing at 4 ℃. The amplified product was detected by 1% agarose gel electrophoresis, and had a specific band of interest at a position of approximately 1041 bp.

Example 2: sequence analysis of SaMET6 Gene

After sequencing analysis, the full-length cDNA sequence of the SaMET6 gene has the full length of 1041bp and comprises 507bp open reading frames, the protein consists of 169 amino acids according to DNAMAN analysis, and the possible surface region of the globulin is analyzed to be at the N end according to Hphob./Kyte & Doolittle of Expasy protscale. The PSORT Prediction predicts that proteins are most likely localized to the cytosol and mitochondrial matrix, which are major features of the cysteine protease family. Analysis shows that the full-length cDNA sequence of SaMET6 gene is obtained.

The conserved region analysis of the encoding gene was performed using NCBI (http:// www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb. cgi), and the protein encoded by the gene belongs to the family of 5-methyltetrahydropterin-based triglyceride homocysteine methyltransferase proteins. BLASTX of the amino acid sequence encoded by the SaMET6 gene by NCBI, phylogenetic analysis by homology analysis and phylogenetic analysis with amino acid sequences of other species whose functions have been determined, and phylogenetic tree analysis using MEGA4 software revealed that: SaMET6 has been shown to be relatively closely related to the evolution of the amino acids encoded by the 5-methyltetrahydropterin-based triglyceride homocysteine methyltransferase gene in other known species.

Example 3: transformation and detection of recombinant yeast

Saccharomyces cerevisiae strain INVSC1 is auxotrophic for urinary ammonia acid (Ura)^-) The model strain of (1), in a yeast minimal medium lacking urinary alanine (SC-Ura)^-) As above, the yeast strain hardly grows and propagates. The yeast expression vector (pYES2-DEST52) contains URA3 gene, and the expression of the gene can make yeast transformant in SC-Ura^-Normal growth on medium. Thus, SC-Ura^-Selection medium allows for the screening of positive and non-positive yeast transformants. Respectively transforming vector plasmids pYES-SaMET6 and pYES-DEST52 into yeast sensitive strain INVSC1 by lithium acetate method, and coating the transformed yeast liquid on SC-Ura^-And (3) culturing on a solid selective culture medium by taking untransformed yeast as a control, wherein after 2d, the yeast for transforming the two plasmids can grow and have bacterial colonies growing except the empty yeast which is not grown completely, which indicates that the yeast transformation is successful, picking a single bacterial colony of the yeast, removing cell walls after overnight culture, and further identifying the positive transformant by a bacterial liquid PCR method.

1. A lithium acetate chemical conversion method is used for converting saccharomyces cerevisiae INVsc1, and the specific conversion steps are as follows:

1.1A single clone of yeast strain (INVSC1) was added to 10mL YPD liquid medium and shaken overnight at 30 ℃.

1.2 detecting OD of Yeast liquid₆₀₀Value, the overnight cultured yeast liquid was diluted to OD with 50mL YPD liquid medium₆₀₀At 0.4 deg.C, continuing to shake for 2-4h at 30 deg.C.

1.3 Low temperature centrifugation (4 ℃, 2500rpm) for 5min, then remove the supernatant and collect the bacteria, using 40mL1xTE buffer solution heavy suspension of bacteria.

1.4 centrifugation at low temperature (4 ℃ C., 2500rpm) was performed again for 5min, and then the cells were collected and resuspended in 2mL of 1xLiAc/0.5xTE buffer.

1.5 the obtained resuspended cells were dispensed into 1.5mL centrifuge tubes in a system of 100. mu.L/tube.

1.6 the dispensed yeast cells were incubated at room temperature for 10 min.

1.7 to each transformation system (100. mu.L), 1. mu.g of plasmid DNA and 100. mu.g of denatured salmon sperm DNA were added and mixed well.

1.8 Add 600. mu.L of 1 × LiAc/40% PEG-3350/1 × TE to each system and mix well.

Incubate the mixture from step 1.8 in a shaker at 200rpm for 30min at 1.930 ℃.

1.10 adding 70 μ L DMSO into each system, mixing, and heating in water bath at 42 deg.C for 15 min.

1.115000 rpm for 1min, and removing the supernatant.

1.12 the cells were resuspended in 1mL of 1XTE buffer, centrifuged at 5000rpm for 1min, and the supernatant was further removed.

1.13 the cells were resuspended in 100. mu.L of 1XTE buffer, plated on yeast selection medium and incubated for 24h at 30 ℃.

2. Identification of Positive transformants

Randomly picking a single colony of 5 yeast transformants (pYES2-SaMET6) from a yeast selection medium, carrying out shaking culture at 30 ℃ overnight (200rpm), collecting overnight cultured thalli, boiling for 5min in boiling water, quickly placing on ice for 5min to break cells, repeating for several times, carrying out bacteria liquid PCR by using a centrifugally concentrated sample of a cell breaking liquid as a template, carrying out PCR amplification by using primers T7 and R, wherein the PCR reaction system is (25 mu L): buffer 2.5. mu.L, upstream and downstream primers (T7, R) 0.5. mu. L, Tag each, enzyme 0.5. mu. L, dNTP 0.5.5. mu.L, template 5. mu. L, ddH₂O 15.5μL。

And (3) carrying out electrophoresis detection on the PCR product on 1% agarose gel, wherein the size of the amplified fragment is matched with the target length. It was demonstrated that the recombinant plasmid pYES2-SaMET6 had been transformed into a yeast strain.

Example 4: positive transformed yeast stress

1. Preparation before stress treatment

Taking appropriate amount of positive yeast for transformationInoculating the strain solution of seed (pYES-DEST52, pYES2-SaMET6) into SC-U liquid culture medium containing 2% glucose, shake culturing at 30 deg.C and 200rpm for 24 hr, and measuring OD₆₀₀The OD of the strain was adjusted to the OD of the strain using SC-U liquid medium (2% glucose)₆₀₀Uniformly adjusting to 0.4, total volume of 5mL, centrifuging at 8000 rpm for 1min, sucking supernatant, adding 2mL of 2% galactose-containing yeast induction culture medium, suspending thallus, inoculating into 5mL of induction culture medium at a ratio of 1:50, performing amplification culture, performing shake culture at 30 deg.C for 24h, and detecting OD of yeast INVSC1(pYES-DEST52) and INVSC1(pYES2-SaMET6)₆₀₀Value and uniformly adjusted to OD₆₀₀The value is 2, ready for use. The two yeast transformants are subjected to different abiotic stress treatments, the salt stress resistance and the drought stress resistance of the two yeast transformants are compared, and the experiment is repeated for 3 times.

2. Simulated adversity stress treatment

Plants existing in nature are faced with various biotic and abiotic stresses, the most prominent of which are salt stress (NaCl, KCl, etc.) and drought stress.

Salt and drought simulations were performed under laboratory conditions, simulating salt stress with 2M NaCl. The yeast transformants are treated by the two simulated conditions, and the growth conditions of the yeast are compared, so that the influence of the gene on the stress resistance of the yeast after the gene is induced and expressed in the yeast is evaluated, and the stress resistance function of the gene in the yeast is initially detected.

NaCl treatment: the above-mentioned spare bacteria are respectively inoculated on SC-U solid culture medium containing 2% galactose by using undiluted and diluted 10, 100, 1000 and 10000 times bacteria, 2 microliter of bacterial liquid is absorbed, after two days of culture at 30 deg.C, the colony growth state of two kinds of yeast conversion bacteria is compared.

Example 5: response of SaMET6 gene under PEG and NaCl stress of sophora alopecuroides

1. Stress treatment of sophora alopecuroides:

the method comprises the steps of planting sophora alopecuroides seeds in soil, selecting the sophora alopecuroides with good growth after the sophora alopecuroides grows for four weeks under normal conditions, transferring the sophora alopecuroides to 1/8hoagland nutrient solution for water culture, replacing the nutrient solution every day, performing water culture for 3 days until the sophora alopecuroides grows to be strong, treating the sophora alopecuroides with 200mM NaCl and 8% PEG6000 respectively, taking roots, stems and leaves after 0, 4, 12, 24, 36, 48 and 72 hours, quickly freezing the roots, the stems and the leaves by using liquid nitrogen, and storing the roots, the stems.

RNA extraction and reverse transcription:

total RNA was extracted by Trizol (as in example one, 2.1) using Takara

The RTreagent Kit With gDNA Eraser (Perfect Real Time) Kit was reverse transcribed to prepare cDNA for quality Real-Time PCR analysis.

3. Fluorescent quantitative PCR analysis:

by using

Green Reagent kit, using 7500 fluorescence quantitative system to detect the expression quantity difference of SaMET6 gene (F: GCAACAGTTGGTGGACTGTG; R: ACGTTCAATACCACCGGCTT) along with the change of time under different treatments, using the eukaryotic elongation growth factor (EF1- α) as the internal reference gene (F: 5'-CCCCAGTTCTCGACTGTCAC-3'; R5 '-TGGTGGGAACCATCTTCACG-3'). the reaction conditions are pre-denaturation at 95 ℃ for 30 seconds, denaturation at 95 ℃ for 5 seconds, annealing and elongation at 60 ℃ for 34 seconds, 40 cycles, denaturation at 95 ℃ for 15 seconds, annealing and elongation at 60 ℃ for 1 minute, denaturation at 95 ℃ for 15 seconds, and elongation at 60 ℃ for 15 seconds, and 2 is adopted^-△△CtThe method analyzes the difference of expression amount.

Example 6: expression of SaMET6 in Arabidopsis thaliana and analysis of salt tolerance

The plant expression vector pCHF3300-SaMET6 was constructed. Transforming a plant expression vector pCHF3300-SaMET6 into wild arabidopsis by adopting agrobacterium-mediated transformation, carrying out basta screening on the transgenic arabidopsis, detecting the expression quantity of a target gene in a positive plant, and analyzing the salt tolerance of the transgenic arabidopsis. The specific method comprises the following steps:

the transgenic arabidopsis seeds of T3 generation and wild WT (Columbia wild type) seeds are disinfected by 10% sodium hypochlorite for 3min, washed by sterilizing water for 5 times, sown in a 1/2MS culture medium containing 0.8%, moved to pot soil (the pot specification is consistent and the soil is weighed to be equal in weight) after 4 true leaves grow out, and respectively subjected to salt treatment and drought treatment after 3 days, wherein the salt treatment is irrigated by using a hoagland nutrient solution containing 300mM NaCl, and the drought treatment is not watered for one week. And taking pictures after the phenotype difference occurs.

A sequence table:

sequence of SEQ ID NO.1

(i) Sequence characteristics: (A) length: 1041 bp; (B) type (2): a nucleotide; (C) chain property: single-stranded; (D) 1-533: 5' -UTR

(ii) Molecular type: nucleotide, its preparation and use

(iii) Description of the sequence: SEQ ID NO.1

Sequence of SEQ ID NO.2

(i) Sequence characteristics: (A) length: 168 amino acids; (B) type (2): an amino acid; (C) chain property: single-stranded.

(ii) Molecular type: polypeptides

(iii) Description of the sequence: SEQ ID NO.2

Sequence listing

The invention name is as follows: sophora alopecuroides SaMET6 gene clone and application thereof

Sequence of SEQ ID NO.1

(ii) Molecular type: nucleotide, its preparation and use

(iii) Description of the sequence: SEQ ID NO.1

1 AAACCATCAC AGTTTGTACA AAAGTTGGAA GGGGACAACT TTGTAAAAAG TTGGAAGGGG

61 ACAACTTTGT ACAAAAAAGT TGGGAGATCA AGTCATGGCT AGCTTTTGCT GCCCAAAAAG

121 TTGTTGAAGT AAATGCATTG GCTAATGCAT TGTCTGGTAA AAAGGATGAG GTCTTCTTCT

181 CTGCTAATGC TGCGGCCCAG GCTTCAAGAA AGTCCTCTCC AAGAGTGACA AATGAGGCTG

241 TTCAGAAGGC TGCTGCTGCA TTGAAGGGTT CTGACCATCG CCGTGCTACT AATGTCAGTG

301 CCAGACTGGA TGCTCAACAA AAGAAGCTTA ACCTTCCAAT CCTCCCAACC ACTACTATTG

361 GATCCTTCCC TCAGACTGTA GAACTGAGGA GGGTACGCCG TGAATACAAG GCTAACAAGA

421 TCTCCGAGGA AGAGTATGTT AAGGCAATTA AGGAGGAAAT CCGCAAAGTT GTTGAACTCC

481 AAGAAGAGCT TGATATTGAT GTCCTGGTGC ATGGGGAGCC TGAGAGGAAT GATATGGTTG

541 AGTACTTTGG CGAGCAATTG TCAGGCTTTG CTTTCACTGT TAATGGGTGG GTGCAATCCT

601 ATGGATCTCG TTGCGTGAAG CCACCAATCA TCTATGGTGA TGTGAGCCGC CCAAAGCCAA

661 TGACCGTCTT CTGGTCATCT ACTGCTCAGA GCATGACCAA ACGCCCAATG AAGGGAATGC

721 TTACTGGACC TGTCACCATT CTCAACTGGT CCTTTGTCAG AAACGATCAG CCTAGATCTG

781 AGACCTGCTA CCAGATTGCT TTGGCTATCA AGGACGAAGT AGAAGACCTT GAAAAGGGTG

841 GTATTGGTGT CATCCAAATT GATGAAGCTG CTTTGAGAGA GGGGCTACCA TTGAGGAAGT

901 CAGAGCAATC TCACTACTTG GACTGGGCTG TCCATTCCTT CCGGATCACC AACGTTGGTG

961 TTCAGACACC ACTCAGATCC ACACTCACAT GTGCTACTCT AACTTCAACG ACATCATCCA

1021 CTCAATCATT GATATGGATG C

Sequence of SEQ ID NO.2

(ii) Molecular type: polypeptides

(iii) Description of the sequence: SEQ ID NO.2

1 MVEYFGEQLS GFAFTVNGWV QSYGSRCVKP PIIYGDVSRP KPMTVFWSST AQSMTKRPMK

61 GMLTGPVTIL NWSFVRNDQP RSETCYQIAL AIKDEVEDLE KGGIGVIQID EAALREGLPL

121 RKSEQSHYLD WAVHSFRITN VGVQTPLRST LTCATLTSTT SSTQSLIWMQ*

Claims

1. A sophora alopecuroides cysteine methyltransferase gene SaMET6 is characterized in that the nucleotide sequence is shown in SEQ ID NO: 1.

2. A fenugreek cysteine methyltransferase SaMET6 is characterized in that the amino acid sequence is shown in SEQ ID NO. 2.

3. The application of the sophora alopecuroide cysteine methyltransferase gene SaMET6 and the sophora alopecuroide cysteine methyltransferase gene SaMET6 in the aspect of plant salt tolerance.