CN111088256A

CN111088256A - Construction method of carrier for efficiently expressing small RNA and expressing multiple small RNAs by cynomolgus monkey U6 promoter

Info

Publication number: CN111088256A
Application number: CN201911395535.2A
Authority: CN
Inventors: 蓝田; 施金秀; 罗燕
Original assignee: Yunzhou Biosciences (guangzhou) Inc
Current assignee: Yunzhou Biotechnology (Guangzhou) Co.,Ltd.
Priority date: 2019-12-30
Filing date: 2019-12-30
Publication date: 2020-05-01
Anticipated expiration: 2039-12-30
Also published as: CN111088256B

Abstract

The invention provides a cynomolgus monkey U6 gene promoter macU6, which comprises a nucleotide sequence shown as SEQ ID NO: 1. The invention obtains a sequence homologous with the U6 promoter, namely the macU6 promoter, in the cynomolgus monkey genome for the first time, and has high-efficiency transcription capability. And introduced into a multiple gRNA expression vector. In the invention, a method combining a Golden Gate cloning technology and a Gateway recombinant cloning technology is adopted to construct a multi-gRNA expression vector with gRNAs expressed in series driven by different U6 promoters, and the method is simple, efficient, flexible and time-saving. Meanwhile, the problem of vector instability caused by too few U6 promoter types and repeated U6 is solved by introducing a new high-efficiency macU6 promoter.

Description

Construction method of carrier for efficiently expressing small RNA and expressing multiple small RNAs by cynomolgus monkey U6 promoter

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a cynomolgus monkey U6 gene promoter, and cloning and application thereof.

Background

In eukaryotes, three RNA polymerase (PolI, polii, and poliiii) promoters are responsible for the transcription of different types of genes, with the poliiii promoter being widely used for small RNA expression due to its ability to efficiently transcribe small RNAs, including small interfering RNAs in RNAi applications, short hairpin RNAs (shrna), and grnas in CRISPR-Cas systems. The Pol iii promoters which are currently most widely and efficiently used include the human U6 promoter (hU6), the mouse U6 promoter (mU6), and the human H1 promoter (hH 1). Studies have shown that transcription from the U6 promoter starts precisely from the first a or G in the range of transcription sites-1 to +2, and one modifies the U6 promoter based on this feature by adding a suitable cleavage site at its 3' end for cloning small RNAs and adding a G in front of the small RNA of interest during cloning, thereby enabling transcription of downstream small RNAs to start precisely from G. In contrast, the transcription initiation site of the H1 promoter is not fixed, and transcription can be initiated at multiple sites, so that the 5' end of a downstream RNA transcription product is subject to denaturation, and the method is not suitable for experiments with strict requirements on the transcription initiation site, and the application range of the method is greatly limited. Therefore, human and mouse U6 promoters are currently considered to be the Pol III promoter with the most efficient expression ability.

Compared with ZFN and TALEN technologies with high cost, tedious operation and long experimental period, the CRISPR/Cas9 system has become the most economically efficient and widely used gene editing tool at present. The CRISPR/Cas9 system is an acquired immune defense mechanism which is found in bacteria and archaea and can resist invasion of viruses and exogenous DNA, and comprises two parts of regularly Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and Cas (CRISPR-associated) protein. A number of Cas9 homologues have now been found, such as SpCas9, SaCas9, zCas9 etc., of which SpCas9 in the type 2 CRISPR/Cas9 system from streptococcus pyogenes is the most widely used one. SpCas9 is a universal DNA nuclease protein that mediates break-down of double-stranded DNA by complementarity of U6 transcribed small guide rna (grna) and the target genomic gene. In addition, the nicked SpCas9(dSpCas9) formed by mutating and inactivating the active center of the SpCas9 is combined with different functional proteins or effect structural domains, so that the method can be used for various precise gene regulation operations, and the application range of the CRISPR system is greatly expanded, such as the inhibition or activation of the expression of endogenous genes, epigenetic modification, gene visualization and the like. At present, the most widely applied is a single gRNA expression system, and a single target gene can be efficiently targeted. However, when multiple genes are targeted simultaneously, the traditional single gRNA expression vector cannot ensure that different grnas can enter the same cell in equal amounts, so that the expression levels of different grnas in the same cell are different, and the accuracy of an experimental result is affected. To solve this problem, multiple different gRNA expression cassettes were assembled on the same vector by Golden Gate to form a multi-gRNA expression vector, which was constructed by connecting multiple U6-gRNA-scanfold in tandem. When the vector is introduced into corresponding cells, different gRNAs can generate the same level of expression in the same cell, so that experimental errors are reduced. However, the use of the Pol III promoter for efficient expression of small RNAs in general is too few, and the repeated use of the U6 promoter in the same vector causes the existence of multiple repeated fragments (repeat), which is not favorable for the stable replication of the vector in Escherichia coli, and even causes the problem of large fragment loss. In order to solve the problem of vector instability caused by repeated times of the U6 promoter in multi-gRNA cloning, different high-efficiency U6 promoters are introduced. A sequence homologous with a U6 promoter, namely a macU6 promoter, is obtained in a cynomolgus monkey (Macaca fascicularis) genome for the first time by utilizing homology analysis, and a targeting efficiency comparison experiment with a mouse U6 promoter proves that the macU6 promoter has the same high-efficiency transcription capacity as the mouse U6 promoter at a cellular level. At the sequence level, the macU6 promoter has only 47% similarity to the mouse U6 promoter. Although 83% similar to the human U6 promoter, the different base distributions are more dispersed. The introduction of the macU6 promoter increases the selectivity of Pol III promoter, reduces the frequency of the same U6 promoter in a multi-gRNA expression vector, and greatly improves the stability of the vector.

In the traditional multi-fragment cloning, two cloning methods are generally adopted, the first method is to utilize the traditional enzyme digestion connection and connect each fragment to a skeleton carrier step by step one by one, for example, the construction method disclosed by the invention patent CN 103184235A, the method is not only complicated in operation and long in time consumption, but also is severely limited by enzyme digestion sites, and the success rate is low; the second method is to fuse each fragment into a single fragment by PCR and then connect the single fragment into a backbone vector, and the method is excessively dependent on extension PCR to fuse small fragments into large fragments, has multiple PCR steps and is not suitable for cloning of some repetitive sequences. All the above methods have respective defects, so in the invention, a method of combining a multi-fragment efficient seamless connection cloning technology, i.e. Golden Gate technology, and a multi-element freely-collocated and combined Gateway recombination cloning technology is introduced to solve the multi-fragment cloning problem. The Golden Gate technology is a simple, efficient, flexible and time-saving new cloning method, and mainly depends on type IIS restriction enzyme which is discovered in 1996 at first, compared with the traditional restriction enzyme, the recognition site of the type IIS restriction enzyme is positioned outside the cutting site, sticky ends of three or four bases can be generated after cutting, and because the protruding ends do not belong to one part of the recognition site, different sticky ends can be designed according to actual needs, and the recognition site can not appear in a vector, thereby achieving the aim of seamless cloning among multiple fragments. Because the enzyme digestion and the ligation reaction are carried out simultaneously in the same system, the problems of complex operation, long experimental period and the like in the conventional enzyme digestion ligation reaction can be avoided, and the working efficiency of researchers is greatly improved. By using the method, up to 9 fragments can be cloned into a target vector at the same time, wherein in 2-3 fragment cloning, the PCR identification positive rate reaches more than 70%, and the cloning efficiency is gradually reduced along with the increase of the number of the cloned fragments. Commonly used type IIS restriction enzymes are BsaI, AarI, BbsI, BsmBI and Esp 3I. The Gateway recombinant cloning technology is a universal cloning technology based on lambda phage site-specific recombination, and can quickly clone heterologous DNA fragments into different vectors according to a certain sequence. The recombination sites playing an important role in Gateway technology are respectively: attB, attP, attL and attR. First step BP reaction: attB sites are carried on both ends of a fragment to be cloned by utilizing a PCR method, and the target fragment is assembled into entry clone by carrying out recombination reaction with a DONOR vector with attP sites under the action of BP enzyme, wherein the sites on both ends of the target fragment are changed into attL sites. The second LR reaction: under the action of LR enzyme, the entry clone and Destination vector with attR site produce recombination reaction to obtain the desired expression vector. Due to the correspondence between att sites, different elements can be constructed into different entry clones in advance, and then the different elements can be assembled into different Destination vectors according to the actual requirements of customers in different orders. The method does not depend on restriction endonuclease, and various fragments can be freely assembled, and the method has the characteristics of rapidness, high efficiency and flexibility, so the method is widely applied to vector construction.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a cynomolgus monkey U6 gene promoter. Through homology analysis, a sequence homologous with the U6 promoter, namely a macU6 promoter, is obtained in the genome of a cynomolgus monkey (Macaca fascicularis), and the promoter has the same high-efficiency transcription capability as the mouse U6 promoter and the human h U6 promoter.

In order to achieve the purpose, the invention adopts the technical scheme that: a cynomolgus monkey U6 gene promoter, the nucleotide sequence of the promoter is shown as SEQ ID NO: 1 is shown.

The invention discovers that a sequence homologous with a U6 promoter is obtained from the genome of a cynomolgus monkey organism and is named as macU6 promoter through the homology analysis and comparison with mouse mU6 and human h U6 promoters. At the sequence level, the macU6 promoter has only 47% similarity to the mouse U6 promoter; has 83 percent of similarity with the human U6 promoter, but has more dispersed different base distribution, and the nucleotide sequence of the promoter is shown as SEQ ID NO: 1 is shown. On a cellular level, a targeting efficiency comparison experiment proves that the macU6 promoter has the same high-efficiency transcription capacity as the mouse U6 promoter. Meanwhile, the macU6 promoter is applied to shRNA interference experiments, so that the efficient transcription capability of the promoter for regulating and controlling various small RNAs is further verified.

The invention also provides a gene editing vector, which contains nucleotide sequences shown as SEQ ID NO: 1, and a cynomolgus monkey U6 gene promoter macU 6.

Preferably, the gene editing vector is a recombinant plasmid promoter > marker-macU 6.

In the examples of the present invention, pLV [ gRNA ] -hPGK > EGFP: T2A: Puro-macU6> ROSA26[ gRNA #1] expression vectors were constructed using ROSA26 as a target gene. Meanwhile, a pLV [ gRNA ] -hPGK > EGFP, T2A, Puro-hU6, ROSA26[ gRNA #1] and a pLV [ gRNA ] -hPGK > EGFP, T2A, Puro-mU6 and ROSA26[ gRNA #1] expression vector are constructed by taking mouse mU6 and human h U6 promoters as a control, and the three expression vectors are packaged into a lentiviral vector to be transferred into a mouse SIA cell, so that the results show that three experimental groups have obvious double peaks in a ROSA26 region, and the macU6 promoter has the same high-efficiency transcription capability as hU6 and mU6 promoters.

The invention also provides a construction method of a vector for expressing a plurality of small RNAs, which comprises the following steps:

(1) respectively constructing editing vectors containing a human U6 gene promoter hU6, a murine U6 gene promoter mU6 and a cynomolgus monkey U6 promoter macU 6;

(2) carrying out enzyme digestion on the vector in the step (1), and connecting a vector skeleton segment with different target gene segments to obtain an editing vector for cutting the target gene;

(3) and (3) carrying out a GoldenGate reaction on the plasmid prepared in the step (2) to obtain an entry cloning vector, and carrying out an LR reaction to obtain a vector containing a plurality of small RNA expressions.

Preferably, the constructed editing vectors containing the human U6 gene promoter hU6, the murine U6 gene promoter mU6 and the cynomolgus monkey U6 promoter macU6 are respectively: pUC19m-hU6-gRNA (BbsI) -1, pUC19m-macU6-gRNA (BbsI) -2 and pUC19m-mU6-gRNA (BbsI) -3.

Preferably, the different target genes in the step (2) are respectively gene 1, gene 2 and gene 3, the editing vectors for cutting the target genes are respectively pUC19m-hU 6-gene 1_ gRNA, pUC19m-macU 6-gene 2_ gRNA and pUC19m-mU 6-gene 3_ gRNA, and the editing vectors each comprise two Golen Gate sites Esp 3I.

Preferably, the Golden Gate reaction in the step (3) is specifically realized by the following method: and (3) carrying out Golden Gate reaction on the vector obtained in the step (2) and pUp-Esp3I-ccdB-cmR-Esp3I (no Esp3I) skeleton vector to obtain an entry clone vector pUp-hU6> gene 1_ gRNA-macU6> gene 2_ gRNA-hU6> gene 3_ gRNA.

Preferably, the LR reaction is achieved in particular by: and (3) carrying out LR reaction on an entry cloning vector pUp-hU6, gene 1_ gRNA-macU6, gene 2_ gRNA-hU6, gene 3_ gRNA, pDOwn-promoter and pTail-marker with a Destination vector to obtain a final vector pLV [ gRNA ] -promoter > marker-hU6, gene 1_ gRNA-macU6, gene 2[ gRNA #1] -mU6 and gene 3_ gRNA expressed by a plurality of small RNAs.

In one embodiment of the invention, AAVS1, ROSA26 and EMX13 are selected as examples to demonstrate that the macU6 promoter of the invention regulates small RNA transcription and its stability in multiple small gRNA expression vectors.

In the examples, gRNA sequences designed for the target genes AAVS1, ROSA26, and EMX1 were as follows:

AAVS1_gRNA：GGGGCCACTAGGGACAGGAT；

ROSA26_gRNA：GTCTTTCTAGAAGATGGGCG；

EMX1_gRNA：GGCCAGGCTTTGGGGAGGCC。

the vector is constructed aiming at the genes, and the editing vectors for cutting the target genes are respectively pUC19m-hU6-AAVS1_ gRNA, pUC19m-macU6-ROSA26_ gRNA and pUC19m-mU6-EMX1_ gRNA, and each editing vector comprises two Golen Gate sites Esp 3I.

Carrying out Golden Gate reaction on the obtained vector and pUp-Esp3I-ccdB-cmR-Esp3I (no Esp3I) skeleton vector to obtain an entry clone vector pUp-hU6> AAVS1_ gRNA-macU6> ROSA26_ gRNA-mU6> EMX1_ gRNA vector.

The LR reaction is specifically achieved by the following method: an entry clone pUp-hU6> AAVS1_ gRNA-macU6> ROSA26_ gRNA-mU6> EMX1_ gRNA, pDOwn-CMV, pTail-EGFP: T2A: Puro and a Destination vector pLV.Des2d.C/EGFP: T2A: Puro (the commodity ID is VB160822-1027xug, please register https:// www.vectorbuilder.cn/query for details) are subjected to LR reaction to obtain a final vector pLV [ gRNA ] -CMV > EGFP: T2A: Puro-hU6> AAVS1_ gRNA-macU6> ROSA26[ gRNA #1] -mU6> EMX1_ gRNA expressed by a plurality of small RNAs.

The invention has the beneficial effects that: the invention obtains a sequence homologous with the U6 promoter, namely the macU6 promoter, in the cynomolgus monkey genome for the first time, and has high-efficiency transcription capability. And introduced into a multiple gRNA expression vector. In the invention, a method combining a Golden Gate cloning technology and a Gateway recombinant cloning technology is adopted to construct a multi-gRNA expression vector with gRNAs expressed in series driven by different U6 promoters, and the method is simple, efficient, flexible and time-saving. Meanwhile, the problem of vector instability caused by too few U6 promoter types and repeated U6 is solved by introducing a new high-efficiency macU6 promoter.

Drawings

FIG. 1 is a schematic representation of the alignment of the nucleotide sequence of the macU6 promoter with the human and mouse U6 promoter (in which the boxes indicate the TATA box of the U6 promoter).

FIG. 2 shows the electrophoresis of amplification PCR amplification macU6-ROSA26[ gRNA #1 ].

FIG. 3 is a diagram showing the sequencing results of the genomic amplification products after hU6-Rosa26_ gRNA drug screening.

FIG. 4 is a schematic representation of the results of sequencing of genomic amplification products after drug screening with macU6-Rosa26_ gRNA.

FIG. 5 is a schematic diagram showing the sequencing results of the genomic amplification products after mU6-Rosa26_ gRNA drug screening.

FIG. 6 is a schematic diagram showing the sequencing results of the genomic amplification products after AAVS1_ gRNA drug screening.

FIG. 7 is a schematic diagram showing the sequencing results of the genomic amplification products after Rosa26_ gRNA drug screening.

FIG. 8 is a diagram showing the sequencing results of the genomic amplification products after EMX1_ gRNA drug screening.

FIG. 9 is a graph showing the fluorescence intensity of pLV [ Exp ] -mCherry: T2A: Hygro-mPGK > EGFP control stable transformants (the left image is white light channel imaging with an exposure time of 10 ms; the middle image is GFP channel imaging with an exposure time of 30 ms; the right image is RFP channel imaging with an exposure time of 80ms, and the amplification times are all 200X.)

FIG. 10 is a graph showing the fluorescence intensity of the stably transfected strains transduced by pLV [ shRNA ] -hPGK > Puro-macU6> EGFP [ shRNA ] (the left image is white light channel imaging with an exposure time of 10 ms; the middle image is GFP channel imaging with an exposure time of 30 ms; the right image is RFP channel imaging with an exposure time of 80ms, and the amplification times are all 200X.)

FIG. 11 is a graph showing the fluorescence intensity of the stably transfected strains transduced by pLV [ shRNA ] -hPGK > Puro-macU6> Scamble _ shRNA virus (the left image shows white light channel imaging with an exposure time of 10 ms; the middle image shows GFP channel imaging with an exposure time of 30 ms; the right image shows RFP channel imaging with an exposure time of 80ms, both amplification times are 200X.)

FIG. 12 is a graph showing fluorescence intensity of blank control stably transfected plants after drug screening (the left image is white light channel imaging with exposure time of 10 ms; the middle image is GFP channel imaging with exposure time of 30 ms; the right image is RFP channel imaging with exposure time of 80ms, and the magnification is 200X.)

Detailed Description

In order to more concisely and clearly demonstrate technical solutions, objects and advantages of the present invention, the following detailed description of the present invention is provided with reference to specific embodiments and accompanying drawings.

Example 1 obtaining macU6 promoter information:

using known human and mouse U6 promoters as templates, crab eating monkey (Macacafascicularis) genomes were screened at NCBI for Blast homology alignment (as shown in fig. 1, where TTATATA is TATA box of macU6 promoter) to obtain a macU6 promoter reference sequence, whose DNA sequence is as shown in SEQ ID NO: 1 is shown.

Example 2a vector was constructed in which the macU6 promoter mediated the expression of a single gRNA and its targeting efficiency was verified at the cellular level:

1, vector construction:

1.1 construction of pLV [ gRNA ] -hPGK > EGFP: T2A: Puro-macU6> ROSA26[ gRNA #1]

SpeI is used for digesting pLV [ gRNA ] -EGFP, T2A, Puro-U6> AAVS1-gRNA3 (the commercial ID is VB191223-3660qkw, and https:// www.vectorbuilder.cn/query is shown for details), and a 7.7kb large fragment of the vector framework is recovered; PCR-amplification was performed using the cynomolgus monkey genome as a template and the primers SpeI-macU6-F and SpeI-macU6-ROSA26[ gRNA #1] -R, and an about 300bp SpeI-macU6 target fragment (shown in FIG. 2) was recovered; using pLV [ gRNA ] -EGFP, T2A, Puro-U6 and AAVS1-gRNA3 as a template, utilizing primers ROSA26[ gRNA #1] -Scaffold-hPGK-F and SpeI-hPGK-R to carry out PCR amplification, and recovering a ROSA26[ gRNA #1] -Scaffold-hPGK target fragment of about 430 bp; in the primer sequences, the homologous arm sequences for the subsequent gibson reaction are in italics, the gRNA sequence is in bold, and the sequence complementary to the template is underlined.

SpeI-macU6-F:

CAAATTACAAAAATTCAAAATTTTACTAGTGAGGGCCTATTTCCCATGAGTC

SpeI-macU6-ROSA26[gRNA#1]-R:

TCTAGAAGATGGGCGCGGTGTTGGTAACTTGCCAGAAG

ROSA26[gRNA#1]-Scaffold-hPGK-F:

CAAGTTACCAACACCGCGCCCATCTTCTAGAAAGACG

SpeI-hPGK-R:

GTCCGTCTGCGAGGGTACTAG

And recovering a PCR product, and carrying out gibson reaction on the primer and the framework according to a certain proportion.

The Gibson reaction temperature is 50 ℃, and comprises the following steps:

DNA preparation: linearizing a vector framework, wherein the tail end of a cloned fragment is provided with a 20-40 bp homologous sequence homologous with the framework;

b.5' exonuclease generates growing sticky ends;

pfu polymerase fills the single strands near the annealing region into double strands;

dna ligase complements the nick (nick) after polymerase filling.

The Gibson reaction system and procedure are as follows:

1.2 AarI cleaves pLV-hU6-gRNA (AarI) -PGK-EGFP-T2A-Puro (new) (commercial ID: VB160712-1045wfj, please see https:// www.vectorbuilder.cn/query for details) and pLV-mU6> gRNA (AarI) -PGK-EGFP-T2A-Puro (commercial ID: VB191224-1639jwq, see https:// www.vectorbuilder.cn/query for details) backbone vector, respectively, and recovering backbone large fragments.

1.3 the following primers were annealed according to the following procedure:

ROSA26[gRNA#1]-F:CACCGCGCCCATCTTCTAGAAAGAC

ROSA26[gRNA#1]-R:AAACGTCTTTCTAGAAGATGGGCGC

the annealing system and procedure were as follows:

1.4, respectively carrying out ligation reaction on the primer of 1.3 and the large fragment of the framework of 1.2 according to a certain proportion.

1.5 the cloning reaction products of the above three vectors are transformed into VB UltraStable^TMChemically competent cells (cat # UC 001-010).

1.6 PCR positive and enzyme digestion and sequencing verification to obtain the following three vectors:

carrier 1: pLV [ gRNA ] -hPGK > EGFP, T2A, Puro-hU6> ROSA26[ gRNA #1]

Carrier 2: pLV [ gRNA ] -hPGK > EGFP: T2A: Puro-macU6> ROSA26[ gRNA #1]

Carrier 3: pLV [ gRNA ] -hPGK > EGFP, T2A, Puro-mU6> ROSA26[ gRNA #1]

2, cell verification:

2.1 resuscitating mouse SIA cells;

2.2 preparing SIA stable transformant for expressing Cas9 by using Cas9 lentivirus expression vector pLV [ Exp ] -CBh > hCas9/Hygro (commercial ID: VB160923-1033trt, please register https:// www.vectorbuilder.cn/query for details);

2.3 packaging the vectors 1-3 into lentiviruses;

2.4 each virus is transduced with SIA stable transfer strain according to 50 ul/hole and divided into a drug sieve (Puro + Hygro) group and a non-drug sieve group, and the stable transfer strain is set as a blank control;

2.5 extracting genome DNA from cells before and after the drug screening and the blank group after the transduction for 96 hours, using the extracted genome DNA as a template for PCR amplification cutting area and sequencing to identify the cutting conditions of target sites before and after the drug screening, wherein the primer information is as follows:

ROSA26-F:CTCCCAAAGTCGCTCTGAGTTGTT

ROSA26-R:ACCGAAAATCTGTGGGAAGTCTTG

2.6 sequencing results show that compared with a blank group, three experimental groups have obvious double peaks in a ROSA26 region and good cutting effects, and as shown in FIG. 3, FIG. 4 and FIG. 5, the macU6 promoter has the same high-efficiency transcription capacity as the hU6 and mU6 promoters.

3. Construction of vectors for mediating multiple gRNA expression by different U6 promoters and verification of targeting efficiency at cellular level

3.1. The invention designs gRNA aiming at targeting genes AAVS1, ROSA26 and EMX1 respectively. The following vectors were constructed:

pLV[gRNA]-CMV>EGFP:T2A:Puro-hU6>AAVS1_gRNA-macU6>ROSA26[g RNA#1]-mU6>EMX1_gRNA

3.1.1 enzyme ligation: firstly, pUC19m-hU6-gRNA (BbsI) -1, pUC19m-macU6-gRNA (BbsI) -2 and pUC19m-mU6-gRNA (BbsI) -3 are respectively cut by BbsI, a vector framework fragment is recovered, and then the vector framework fragment is respectively connected with AAVS1_ gRNA, ROSA26_ gRNA and EMX1_ gRNA annealing products to obtain pUC19m-hU6-AAVS1_ gRNA, pUC19m-macU 24-ROSA 26_ gRNA and pUC19m-mU6-EMX1_ gRNA vectors, wherein the three vectors comprise two Golen Gate sites Esp gRNA I, the structures of which are Esp I-U6-gRNA-Esp-I are respectively used for the subsequent Golen gRNA construction reaction, and the sequences of the vectors are respectively as follows:

AAVS1_gRNA：GGGGCCACTAGGGACAGGAT

ROSA26_gRNA：GTCTTTCTAGAAGATGGGCG

EMX1_gRNA：GGCCAGGCTTTGGGGAGGCC。

3.1.2 Golden Gate reaction: carrying out Golden Gate reaction on pUC19m-hU6-AAVS1_ gRNA, pUC19m-macU6-ROSA26_ gRNA and pUC19m-mU6-EMX1_ gRNA vectors obtained in the first step and pUp-Esp3I-ccdB-cmR-Esp3I (noEsp3I) framework vectors to obtain Mengkong pUp-hU6> AAVS1_ gRNA-macU6> ROSA26_ gRNA-hU6> EMX1_ gRNA.

3.1.3 LR reaction: performing LR reaction on entry clone pUp-hU6> AAVS1_ gRNA-macU6> ROSA26_ gRNA-hU6> EMX1_ gRNA, pDOwn-CMVpromoter, pTail-EGFP, T2A: Puromarker and a Destination vector pLV, Des2d, C/EGFP, T2A: Puro to obtain a final vector pLV [ gRNA ] -CMV > EGFP, T2A: Puro-hU6> AAVS1_ gRNA-macU6> ROSA26[ gRNA #1] -mU6> EMX1_ gRNA.

3.2 cell level assay targeting efficiency:

3.2.1 packaging the final vector obtained above into lentiviruses.

3.2.2 transfer 50uL of the two viruses into pLV [ Exp ] -CBh > hCas9/Hygro stable transfer strain, and set up stable transfer strain cells without virus transduction as blank control. Puro + Hygro is added into each experimental group for double drug screening until all blank cells die, and the surviving cells are collected to extract genome DNA.

3.2.3 PCR amplifying cutting area and sequencing to identify the cutting condition of the front and back target sites of the drug screen by using the extracted genome as a template, wherein the primer information is as follows:

AAVS1-F：CCCTATGTCCACTTCAGGACAGCA

AAVS1-R：CTCTGGCTCCATCGTAAGCAAACC

the amplified fragment has a size of 330bp

ROSA26-F:CTCCCAAAGTCGCTCTGAGTTGTT

ROSA26-R:ACCGAAAATCTGTGGGAAGTCTTG

The amplified fragment has a size of 328bp

EMX1-F(58)：CCAGAACCGGAGGACAAAGTACAA

EMX1-R(58)：CTCAGCCAGCCCATTGCTTGT

The amplified fragment size was: 336bp

3.2.4 PCR-amplified drug-screened genomes were sequenced, and the results showed that PCR sequencing of drug-screened cell genomes showed distinct double peaks in the AAVS1, ROSA26 and EMX1 regions, respectively, compared with the control group, as shown in FIGS. 6, 7 and 8, indicating that all three gRNAs produced effective cleavage.

Example 4 a vector for macU6 promoter-mediated shRNA interference was constructed and its interference efficiency was verified at the cellular level:

1. the invention adopts macU6 promoter to express shRNA, and the interference gene is EGFP. The following two interference vectors were constructed:

carrier 1: pLV [ shRNA ] -hPGK > Puro-macU6> EGFP [ shRNA ]

Carrier 2: pLV [ shRNA ] -hPGK > Puro-macU6> Scamble _ shRNA

1.1 enzyme-cleaved connection: firstly, digesting vector framework pLV.shRNA (macU6). P/Puro (commercial ID is VB191226-1031aup, please register https:// www.vectorbuilder.cn/query in detail) by using AgeI and EcoRI, recovering a large fragment of the vector framework, and then respectively connecting with annealing products of EGFP [ shRNA ] and Scramble _ shRNA to obtain the vector 1 and the vector 2, wherein the vector 1 is an interference vector aiming at the EGFP, the vector 2 is a negative control vector without interference effect, corresponding annealing primer sequences are respectively as follows, and a scribed region is a target sequence and a reverse complementary sequence:

EGFP[shRNA]-F：

CCGGACGTCTATATCATGGCCGACACTCGAGTGTCGGCCATGATATAGACGTTTTTTG

EGFP[shRNA]-R：

AATTCAAAAAACGTCTATATCATGGCCGACACTCGAGTGTCGGCCATGATATAGACGT

Scramble_shRNA-F：

CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG

Scramble_shRNA-R：

AATTCAAAAACCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG

and (3) respectively carrying out ligation reaction on the primers of 4.1.1 and the recovered framework large fragments according to a certain proportion.

1.2 transforming the cloning reaction product of the two vectors into VB UltraStable^TMChemically competent cells (cat # UC 001-010).

1.3 PCR positive and enzyme digestion and sequencing verification to obtain the following two vectors:

carrier 1: pLV [ shRNA ] -hPGK > Puro-macU6> EGFP [ shRNA ]

Carrier 2: pLV [ shRNA ] -hPGK > Puro-macU6> Scamble _ shRNA (control vector)

2, cell verification:

2.1 resuscitating HEK293T cells;

2.2 preparation of HEK293T cell stable transformant expressing EGFP using pLV [ Exp ] -mChery: T2A: Hygro-mPGK > EGFP (commercial ID VB160425-1035nhz, for more details, https:// www.vectorbuilder.cn/query);

2.3 packaging vectors 1 and 2 into lentiviruses respectively;

2.4 each virus transduces EGFP stable transformant according to 20 ul/hole, respectively sieving (Puro) for 5 days, setting stable transformant as blank control, exposing EGFP for 30ms, exposing mCherry for 80ms, magnifying power of 200x, and observing fluorescence expression;

2.5 fluorescence intensity shows that compared with negative control, green fluorescence of EGFP in the experimental group corresponding to the vector 1 is obviously weakened, which indicates that the vector 1 has obvious interference effect and obviously down-regulates the expression level of EGFP on the mRNA level. Whereas the blank control showed massive cell death due to lack of resistance against Puro. As shown in fig. 9, fig. 10, fig. 11, and fig. 12, these all demonstrate that the macU6 promoter is able to efficiently drive expression of downstream shRNA and interfere with the expression level of the target gene.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

SEQUENCE LISTING

<110> Yun boat Biotechnology (Guangzhou) Ltd

<120> cynomolgus monkey U6 gene promoter, and clone and application thereof

<130>12.23

<160>1

<170>PatentIn version 3.3

<210>1

<211>248

<212>DNA

<213> Synthesis

<400>1

gagggcctat ttcccatgag tccttcatat ttgcatatac gatgcaagaa tgttagagag 60

ataattagaa ttaatttggc tataaacata aagatattag tacaaaatat tgatgcagaa 120

agtaataatt tcttgggtag tttgtaattt taaaattatg ttttaaaatg gaccatgaca 180

tacttgccgt aagtgtaaag tatttctatt tcttgccttt atatatcttc tggcaagtta 240

ccaacacc 248

Claims

1. A cynomolgus monkey U6 gene promoter macU6, characterized by comprising the amino acid sequence shown as SEQ ID NO: 1.

2. The cynomolgus monkey U6 gene promoter macU6 of claim 1, wherein the nucleotide sequence of the promoter is set forth in SEQ ID NO: 1 is shown.

3. The use of the cynomolgus monkey U6 gene promoter macU6 of claim 1 or 2 for regulating small RNA expression.

4. A gene editing vector comprising the cynomolgus monkey U6 gene promoter macU6 according to claim 1 or 2.

5. The gene editing vector of claim 4, wherein the gene editing vector is recombinant plasmid promoter > marker-macU 6.

6. A method for constructing a vector for expressing a plurality of small RNAs is characterized by comprising the following steps:

(3) and (3) carrying out Golden Gate reaction on the plasmid prepared in the step (2) to obtain an entry cloning vector, and carrying out LR reaction to obtain a vector containing a plurality of small RNA expressions.

7. The method for constructing a vector expressing a plurality of small RNAs as claimed in claim 6, wherein the editing vectors constructed to contain the human U6 gene promoter hU6, the murine U6 gene promoter mU6 and the cynomolgus U6 promoter macU6 are: pUC19m-hU6-gRNA (BbsI) -1, pUC19m-macU6-gRNA (BbsI) -2 and pUC19m-mU6-gRNA (BbsI) -3.

8. The method for constructing a vector for expressing a plurality of small RNAs as claimed in claim 6, wherein the different target gene fragments in step (2) are Gene 1, Gene 2 and Gene 3 respectively, and the constructed editing vectors for cutting the target genes are pUC19m-hU 6-Gene 1_ gRNA, pUC19m-macU 6-Gene 2_ gRNA and pUC19m-mU 6-Gene 3_ gRNA respectively, and each editing vector comprises two Golen Gate sites Esp 3I.

9. The method for constructing a vector expressing a plurality of small RNAs as claimed in claim 6, wherein said step (3) Golden Gate reaction is specifically realized by the following steps: and (3) carrying out Golden Gate reaction on the vector obtained in the step (2) and pUp-Esp3I-ccdB-cmR-Esp3I (no Esp3I) skeleton vector to obtain an entry clone vector pUp-hU6> gene 1_ gRNA-macU6> gene 2_ gRNA-hU6> gene 3_ gRNA.

10. The method of claim 9, wherein the LR reaction is achieved by: and (3) carrying out LR reaction on an entry cloning vector pUp-hU6> gene 1_ gRNA-macU6> gene 2_ gRNA-hU6> gene 3_ gRNA, pDOwn-promoter and pTail-marker with a Destination vector to obtain a vector promoter > marker-hU6> gene 1_ gRNA-macU6> gene 2[ gRNA #1] -mU6> gene 3_ gRNA expressed by a plurality of small RNAs.