CN111041082A

CN111041082A - Method for screening active substance for improving skin photoaging by using skin photoaging target and active substance for improving skin photoaging

Info

Publication number: CN111041082A
Application number: CN201811184736.3A
Authority: CN
Inventors: 蒋丹丹; 摩根·多斯桑托斯; 李慧
Original assignee: Jala Group Co
Current assignee: Shanghai Natural Hall Group Co ltd
Priority date: 2018-10-11
Filing date: 2018-10-11
Publication date: 2020-04-21
Anticipated expiration: 2038-10-11
Also published as: CN111041082B; WO2020073933A1

Abstract

The invention discloses a method for screening an active substance for improving skin photoaging by using a skin photoaging target and the active substance for improving skin photoaging, wherein microRNA in skin is used as a detection basis, and the microRNA is any one or combination of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5 p. The invention provides a new regulation target for developing cosmetic active ingredients for improving skin photoaging.

Description

Method for screening active substance for improving skin photoaging by using skin photoaging target and active substance for improving skin photoaging

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for screening a skin photoaging target, a method for screening an active substance by using the target and an active substance for improving skin photoaging.

Background

Today's society is constantly concerned about the skin condition of its own, and it is expected that the skin care products will maintain a healthy youthful state, and it is expected that products of a subdivided type will be produced to solve various skin problems. Over time, every consumer is faced with the problem of aging of the skin, and therefore anti-aging skin care products have always gained importance in the various major categories of cosmetics.

The aging of the skin is classified into endogenous aging, which is aging caused by programmed changes of genes, and exogenous aging, which is aging caused by external factors, such as ultraviolet irradiation, smoking, environmental pollution, and the like. The human skin is inevitably exposed to sunlight for a long period of time, and the ultraviolet radiation in the sunlight is the most important factor directly causing skin aging, which is also called photoaging.

With the continuous and deep epigenetic research in recent years, people have new knowledge about the expression mode of human genes. The various physiological and pathological conditions of the human body are not determined by genes, and epigenetic factors can change the instructions of whether the genes are expressed or not and make the instructions stably inherited. The main mechanisms of epigenetics include DNA methylation, histone modification, non-coding RNA, etc., wherein the non-coding RNA has very important and diverse regulatory functions, and thus has received high attention in the fields of molecular biology, cell biology and physiology, and has extremely high research value. The present invention concerns non-coding RNA called microRNA (microRNA) which has recently received considerable attention.

microRNA was discovered in 1993 to be an endogenous small fragment RNA involved in RNA interference: they are capable of targeting messenger rna (mrna) and causing it to degrade or terminate its translation. microRNAs such as these thus play a very important regulatory role in cells. Moreover, they form a group of the largest class of regulatory molecules. They are endogenous, derived from primary micrornas (pri-mirnas) encoded by the genome. To date, approximately 700 human micrornas have been identified. Their function and target have not been fully explained or proven.

microRNA is a small molecule which is ubiquitous in organisms, is 17-27 nucleotides in length, and can specifically inhibit the expression of a target gene by binding with a complementary mRNA target. Research shows that thousands of human protein-encoding genes are regulated by microRNA, indicating that microRNA is a "master regulator" of many important biological processes.

The naming of the microRNA is based on the discovered time sequence, and hsa-miR-29b-1-5p is taken as an example: hsa indicates that the species to which the molecule belongs is human, miR is the identifier of the mature microRNA, 29 is a serial number given to family members to which the microRNA belongs or the family members are found or submitted to a public database in sequence, and "b", "1", "5 p" respectively indicate the precursor sequence, the genome position and the number of the precursor 5' end arm for generating the mature microRNA.

Current research on skin miRNAs is limited, especially in human skin.

On animal skin, initially in mice, expressed miRNAs have been cloned. They play an important role in the morphogenesis of the epidermis and the coat. In recent years miRNAs have been found to be associated with the growth of goat and sheep coat. Recently, in the skin of mice, miR203 in miRNA has been identified, which plays an important role in epidermal differentiation induction by reducing cell proliferation potential. In humans, there are studies comparing the expression of miRNAs in normal skin with psoriatic and eczematous skin. miR203 in mirnas is highly expressed in skin (relative to other organs) and is only expressed by keratinocytes. It has been shown to be a miRNA that is overexpressed in psoriatic skin.

At present, most of the research on microRNA of the skin focuses on the diagnosis and treatment of major skin diseases, the research on the physiological aging of the skin is very limited, and the invention obtains the microRNA molecules with obvious differences after screening and induction by collecting a large number of normal human skin samples of different age groups, testing the microRNA expression profile of the skin by using a high-flux human microRNA chip.

In the analysis of the action mechanism of the microRNA molecules with obvious difference, a Target gene set of the microRNA molecules can be predicted by using a 'modified Target Module' Module of a mirwalk2.0 database, the Target gene set is subjected to function and metabolic pathway enrichment analysis by using a biological information database DAVID v6.8, and the microRNA molecules playing a key role, namely the microRNA markers of skin photoaging, can be obtained according to the weight of the Target genes in the skin aging function. Finally, the correlation effect of the microRNA marker and the predicted target gene can be verified through an RT-PCR experiment.

The discovery of the microRNA marker can be used for building a three-dimensional external biological model, testing the biological efficacy of chemical substances according to the expression quantity of the microRNA marker, and applying the microRNA marker to the development of active ingredients of cosmetics.

Disclosure of Invention

In one aspect, the invention provides a method for developing an active substance for improving skin photoaging, which takes a microRNA marker of skin photoaging as a detection basis, thereby developing a novel active efficacy component for a cosmetic for improving skin photoaging.

In order to achieve the purpose, the invention adopts the following technical scheme:

collecting normal human skin samples irradiated by solar ultraviolet rays and free from the irradiation of the solar ultraviolet rays, and testing a microRNA expression profile by using a high-flux human microRNA chip. And comparing the differences of the skin microRNA expression profiles under different irradiation conditions, and screening and inducing to obtain the microRNA marker of skin photoaging.

The microRNA marker for skin photoaging is characterized by being any one or combination of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5 p.

The sequence of the hsa-miR-3161 is shown in SEQ ID NO.1, the sequence of the hsa-miR-509-5p is shown in SEQ ID NO.2, the sequence of the hsa-miR-29b-1-5p is shown in SEQ ID NO.3, wherein,

SEQ ID NO.1 CUGAUAAGAACAGAGGCCCAGAU

SEQ ID NO.2 UACUGCAGACAGUGGCAAUCA

SEQ ID NO.3 GCUGGUUUCAUAUGGUGGUUUAGA

according to bioinformatics analysis results, the target genes of the marker hsa-miR-3161 comprise TYRP1, the target genes of hsa-miR-509-5p comprise HIF1A, and the target genes of hsa-miR-29b-1-5p comprise TXINIP.

According to the test of RT-PCR experiments, the marker hsa-miR-3161 has correlation with the expression of TYRP1 gene in the skin, hsa-miR-509-5p has correlation with the expression of HIF1A gene in the skin, and hsa-miR-29b-1-5p has correlation with the expression of TXINIP gene in the skin.

The coded product of the TYRP1 gene (Entrez ID: 7306) is tyrosinase-related protein 1, and has promoting effect on melanin generation. The HIF1A gene (Entrez ID: 3091) coding product is hypoxia inducible factor 1A, which plays an important role in the maintenance of the skin homeostasis under the oxidative stress. The encoding product of the TXNIP gene (Entrez ID: 10628) is thioredoxin interacting protein and can regulate the oxidative stress pressure on melanocytes.

The markers are used for developing cosmetic active ingredients for improving skin photoaging. Specifically, skin cells derived from normal humans are cultured in vitro, and the skin cells are treated with an active substance to be detected; after the culture is finished, skin cells are harvested, the marker is used as a target to carry out the semi-quantitative detection of microRNA RT-PCR, and the significant down-regulation effect is carried out on any one or more of the markers hsa-miR-509-5p and hsa-miR-29b-1-5p (the step (b))P<0.05) or has a significant up-regulation effect on the marker hsa-miR-3161 (P<0.05) can be used for developing cosmetics for improving skin photoaging.

Compared with the prior art, the invention has the remarkable advantages that:

according to the invention, the microRNA chip technology and the expression of microRNA of photoaged skin are considered in a combined manner for the first time, the microRNA marker of skin photoaging is screened out, and the active substance efficacy detection method taking the marker as a target has the advantages of high efficiency, high specificity and high sensitivity, and is suitable for developing cosmetic active ingredients for improving skin photoaging.

In one aspect, the invention relates to a method for screening skin photoaging targets, comprising the following steps:

step 1: collecting a plurality of skin samples, and grouping according to whether the skin collecting parts are irradiated by ultraviolet rays in sunlight daily;

step 2: performing total RNA extraction on the plurality of skin samples;

and step 3: hybridizing the total RNA extraction sample with a human microRNA chip;

and 4, step 4: scanning the chip, and processing data to obtain a microRNA expression profile;

and 5: processing data to obtain differential microRNA;

step 6: and carrying out function and metabolic pathway enrichment analysis on the target gene set of the differential microRNA.

The method is preferably performed according to the sequence of steps 1-6. However, it is obvious to those skilled in the art that the sequence of several steps can be adjusted according to the actual situation, and the same functions and effects can be achieved by similar means of the present invention.

In one or more specific embodiments of the invention, the differential microRNA is selected from one or more of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p in skin cells.

In one or more embodiments of the invention, the skin cells are selected from dermal fibroblasts, or epidermal melanocytes, or epidermal keratinocytes.

In one aspect, the invention relates to a method for screening an active substance for improving skin photoaging by using a skin photoaging target, wherein one or more selected from differential microRNA(s) in skin cells are used as targets for screening detection, and the differential microRNA(s) is/are selected from one or more of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p in the skin cells.

In one or more embodiments of the present invention, the screening of the differential microRNA(s) comprises the following steps:

step 1: collecting a plurality of skin samples, and grouping according to whether the skin collecting parts are irradiated by ultraviolet rays in sunlight;

step 2: performing total RNA extraction on the plurality of skin samples;

and 5: processing data to obtain differential microRNA;

In one or more embodiments of the present invention, the skin cells are selected from one or more of dermal fibroblasts, epidermal keratinocytes and epidermal melanocytes.

In one or more embodiments of the invention, the modulation of said target by the active ingredient in the skin cells is determined by the RT-PCR method. Preferably, the RT-PCR method is performed by expressing the target in an amount of 2^-∆CtTo measure. More preferably, the determination criteria for the RT-PCR method are: whether the expression level of the skin cell target treated with the active ingredient is significantly reduced as compared with that of the control group or not (1)P<0.05）。

In one or more embodiments of the present invention, the type of application of the active substance for improving skin photoaging, which is obtained by screening, is a skin external preparation. Preferably, the skin external agent may be selected from a facial care product, a makeup product, a hair care product, a body care product, and the like.

In another aspect, the invention relates to an active capable of ameliorating skin photoaging, the active treated sample being compared to an untreated control sample to selectDetermining the expression level of one or more targets selected from hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p in skin cells by RT-PCR (reverse transcription-polymerase chain reaction) method to obtain expression level of 2^-∆CtIn terms of whether any one or more of the values of hsa-miR-509-5p, hsa-miR-29b-1-5p is significantly reduced in the active-treated sample compared to the control group(s) ((P<0.05), or whether hsa-miR-3161 is significantly upregulated: (0.05)', orP<0.05). Preferably, these actives are selected from one or a combination selected from rose honey, bamboo rice extract, flavanone derivatives, tsugeki extract, psammophyte mixture, coreopsis tinctoria extract, bamboo juice extract, peach gum aqueous solution, peony extract microemulsion, praecox extract, balsamiferous wood extract, phellinus polysaccharide extract, complex seed extract, complex flower extract, prinsepia utilis royle extract, saccharomyces cerevisiae extract, ginseng seed extract, scorpio leontopodium extract, peony seed extract, gentian extract, limonium extract, cow milk seed extract, young leaf of prinsepia utilis royle extract, pomegranate extract-containing composition, snow ginseng extract-containing composition, snow chrysanthemum extract-containing composition, rosa davurica extract, impatiens balsamina extract, green gloiopeltis extract, and albizia julibrissin extract.

Drawings

FIG. 1 is a high throughput chip screening of a clustering thermograph of differential microRNAs of normal human skin samples exposed to and protected from solar UV radiation.

FIG. 2 is an experimental result of verifying the correlation between hsa-miR-3161 and TYRP1 gene expression by RT-PCR experiment.

FIG. 3 is an experimental result of verifying the correlation between hsa-miR-509-5p and HIF1A gene expression using RT-PCR experiment.

FIG. 4 is an experimental result of verifying the association between hsa-miR-29b-1-5p and TXNIP gene expression using RT-PCR experiments.

FIG. 5 shows the results of experiments using RT-PCR and microRNA markers of skin photoaging as targets to detect the efficacy of cosmetic actives.

Detailed Description

For a better understanding of the present invention, the present invention will now be further described with reference to the following examples and drawings, but the practice of the present invention is not limited thereto. The experimental procedures, in which specific conditions are not indicated in the following examples, are conventional procedures and conditions well known to those skilled in the art, or are carried out according to commercial instructions.

Example 1: high-throughput microRNA chip expression profile for detecting normal human skin samples irradiated by and protected from solar ultraviolet radiation

First, obtaining skin sample

Fresh skin samples were purchased from Shanghai core Biotechnology Ltd, and skin sample donors were healthy women aged 30-40 years, born in Shanghai, and living in Shanghai, and excluded from amenorrhea, pregnancy, smoking, and drinking, for a total of 16 cases.

Wherein the skin irradiated with solar ultraviolet rays is obtained from eyelid skin obtained by eyelid cosmetic surgery, and the average age of the group is (33.5 + -2.8) years in 8 cases. Wherein the skin protected from the ultraviolet rays of sunlight is obtained from the chest or abdominal skin obtained by abdominal plasty, and the average age of the group is (34.8 + -3.5) years in 8 cases.

In particular, skin tissue is often collected after a stereotactic surgical procedure and is treated as soon as possible. Shearing skin tissue to a thickness of not more than 0.5cm, cutting into small tissue blocks of 0.5cm x 1cm x 1cm (thickness x length x width), placing the small tissue blocks into sterile freezing tubes, adding 2ml of RNAlater (Sigma company) into each tube, and immersing the tissue blocks in the frozen tubes for storage; 1 piece of cut skin tissue is put into each freezing tube and stored in a deep low temperature refrigerator at-80 ℃.

Second, total RNA extraction of skin sample

Total RNA of a sample is extracted by a mirVana ™ miRNA Isolation Kit with a reagent of outphenol (Ambion company) specially used for extracting common tissue and cell miRNA according to a standard operation flow provided by a manufacturer, and the extracted total RNA is qualified by Agilent Bioanalyzer 2100 (Agilent technologies company) electrophoresis quality for later use.

Three, high flux microRNA chip detection expression profile

An Agilent Human miRNA chip covering 2549 personal related microRNAs is adopted, and a database is derived from a microRNA database miRBase V21.0 version. The total RNA samples were dephosphorylated, denatured, ligated and then subjected to chip hybridization. And after the washing is finished, scanning the chip, reading data and normalizing to obtain the microRNA chip expression profiles of the skin irradiated by the solar ultraviolet rays and the skin not irradiated by the solar ultraviolet rays.

Example 2: screening differential microRNAs summarizing skin exposed to and protected from solar ultraviolet radiation

Differential expression of micrornas in solar uv-irradiated and non-solar uv-irradiated skin samples was studied using the agiicronra R analysis kit, which processes test data based on limma linear model. The analysis result is shown in the clustering heatmap of fig. 1, the expression of the microRNA in different samples is visually represented in a graph form by the color gradation distribution in the graph, the deeper the color is, the more significant the expression difference of the microRNA is, and the white area indicates that the expression of the microRNA has no significant difference. From fig. 1, it can be seen that there is a significant difference in microRNA expression levels between skin samples exposed to and protected from solar uv light. Several microRNA molecules with particularly significant differences are shown in table 1.

TABLE 1 skin screened by experiments in the chip for exposure to and protection from solar UV radiation

MicroRNA molecules with significant differences

Example 3: bioinformatics analysis is carried out to obtain microRNA markers and target genes of skin photoaging

A set of prediction gene sets is generated by predicting Target genes of differential microRNAs of skin samples irradiated by solar ultraviolet rays and not irradiated by the solar ultraviolet rays by using a 'modified Target Module' Module of a mirWalk2.0 database.

The predictive gene set was subjected to functional and metabolic pathway enrichment analysis using the bioinformatic database DAVID v 6.8. The enrichment analysis is based on 5 annotation category modules, including gene ontology (GO _ TERM), KEGG pathway, BIOCARTA pathway, InterPRO database, and UP _ keyword database. Some of the analysis results are shown in table 2, listing the more highly enriched 3 functional or metabolic pathway annotations.

Table 2. function and metabolic pathway enrichment analysis results of differential microRNA target genes

In the functions and metabolic pathways listed in table 2, the encoded product of TYRP1 gene is tyrosinase-related protein 1, which has a promoting effect on the generation of melanin; the coded product of the HIF1A gene is hypoxia inducible factor 1A, which plays an important role in the maintenance of the skin homeostasis under the pressure of oxidative stress; the product encoded by the TXNIP gene is thioredoxin interacting protein, and can regulate the oxidative stress on melanocytes. The functions are related to stress reaction caused by ultraviolet irradiation on skin cells, so that the microRNA molecules hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p for regulating and controlling the genes are considered to have potential application as markers of skin photoaging.

Example 4: RT-PCR experiment verifies relevance between microRNA marker and predicted target gene

First, monolayer culture of skin cells in vitro

Primary isolation of epidermal keratinocytes and epidermal melanocytes was performed in a sterile environment using fresh skin samples of the faces of commercially available female donors aged 47 years. Disinfecting the skin with iodophor and 75% alcohol each 1 time, washing with PBS, cutting subcutaneous adipose tissue and blood vessel with scissors, cutting the skin into 0.5cm x 0.5cm pieces, sterilizing with Dispase II (Roche corporation) at 4 deg.C for 15 hr, and removing dermis and epidermisAnd separating the skin layer. The epidermal layer was digested with 0.05% pancreatic enzyme (Invitrogen) for 13 minutes, divided into two portions, centrifuged at 1000rpm for 10 minutes, and the supernatant was discarded. One portion was resuspended in K-FSM medium (Invitrogen) and inoculated to 162cm²Placing the square bottle in a cell culture box at 37 ℃ and 5% CO₂And culturing under saturated humidity. And harvesting cells for freezing when the cell layer grows to 70% -80% confluence, and establishing an epidermal keratinocyte cell bank. Another portion of the cells were re-suspended in Melanocyte medium M2 (Promocell) culture medium and inoculated to 162cm²Placing the square bottle in a cell culture box at 37 ℃ and 5% CO₂And culturing under saturated humidity. And harvesting the cells for freezing when the cell layer grows to 70% -80% confluence, and establishing an epidermal melanocyte bank.

Secondly, increasing or reducing the content of specific microRNA molecules in skin cells through cell transfection

Preparing epidermal keratinocytes or epidermal melanocytes cultured in vitro in a monolayer at 300,000 cells/cm²The density of the microRNA markers is inoculated into a culture dish with the diameter of 100mm, corresponding culture medium is added for culture, and when the cells grow to 80% confluence, the microRNA markers and the predicted target genes can be tested for relevance.

In this embodiment, a cell transfection technology is adopted to introduce a specific microRNA mimic (pre-miR) into skin cells, so as to artificially increase the content of the microRNA in the skin cells, and then the predicted corresponding content change of a target gene is examined through an RT-PCR experiment. Or transferring a specific microRNA inhibitor (anti-miR) into skin cells by adopting a cell transfection technology, artificially reducing the content of the microRNA in the skin cells, and then detecting the predicted change of the expression quantity of the target gene.

In the case of hsa-miR-3161, the content of hsa-miR-3161 in the skin is reduced after irradiation with ultraviolet rays from sunlight, so in this example, a transfection reagent Lipofectamine RNAimax (Invitrogen) was specifically used, and 50nM of a specific Inhibitor of hsa-miR-3161, anti-miR-3161 (Thermo), was introduced into melanocytes, and 50nM of anti-miR substantial miRNA Inhibitor Negative Control (Thermo) was introduced as a Negative Control.

For hsa-miR-509-5p, the hsa-miR-509-5p content in the skin is increased after solar ultraviolet irradiation, so in this example, 5pM of hsa-miR-509-5p mimic Pre-miR-509-5p (Thermo) is introduced into keratinocytes using a transfection reagent, and 5pM of Pre-miR polypeptide miRNA Precursor Negativecontrol #1 (Thermo) is introduced as a negative control.

For hsa-miR-29b-1-5p, the content of hsa-miR-29b-1-5p in the skin is increased after the skin is irradiated by solar ultraviolet rays, so in this example, 5pM of hsa-miR-29b-1-5p mimic Pre-miR-29b-1-5p (Thermo) is introduced into melanocytes by using a transfection reagent, and 5pM of Pre-miR hybrid miRNA Precursor Negativecontrol #1 (Thermo) is introduced as a negative control.

Cells were harvested 48h after transfection, total cellular RNA was extracted using mirVana miRNA isolation kit (Ambion), frozen at-80 ℃ and used for RT-PCR.

Third, primer design of RT-PCR reaction

The relevance of the change of the skin photoaging microRNA marker and the expression quantity of a target gene is verified through an RT-PCR experiment, U6 is used as an internal reference gene in the RT-PCR of the microRNA experiment, and 18S is used as the internal reference gene in the RT-PCR of the gene to be detected. The primers for each gene to be detected and the reference gene are as follows:

TYRP1 sense strand: 5 'TCTCAATGGCGAGTGGTCTGTG 3' (SEQ ID NO. 4)

TYRP1 antisense strand: 5 'CCTGTGGTTCAGGAAGACGTTG 3' (SEQ ID NO. 5)

HIF1A sense strand: 5 'TATGAGCCAGAAGAACTTTTAGGC 3' (SEQ ID NO. 6)

HIF1A antisense strand: 5 'CACCTCTTTTGGCAAGCATCCTG 3' (SEQ ID NO. 7)

TXNIP sense strand: 5 'CAGCAGTGCAAACAGACTTCGG 3' (SEQ ID NO. 8)

TXNIP antisense strand: 5 'CTGAGGAAGCTCAAAGCCGAAC 3' (SEQ ID NO. 9)

U6：5’ CAAGGATGACACGCAAATTGG 3’（SEQ ID NO.10）

18S sense strand: 5 'TCTGTGATGCCCTTAGATGTCC 3' (SEQ ID NO. 11)

18S antisense strand: 5 'AATGGGGTTCAACGGGTTAC 3' (SEQ ID NO. 12)

After the primer design is completed, the amplified target fragment sequence is prevented from being non-specific by BLAST analysis (https:// blast.ncbi.nlm.nih.gov/blast.cgi). The primers were synthesized by Shanghai Bioengineering Co., Ltd.

Fourth, reverse transcription

The RNA was removed from a-80 ℃ freezer, thawed at 4 ℃ and then the reaction solution High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) was prepared in a 0.2 ml PCR tube, which was then incubated at 37 ℃ for 15min, denatured at 98 ℃ for 5min and incubated at 4 ℃.

Five, SYBR Green qPCR

The PCR tube was placed in a PCR instrument for reaction, incubated at 50 ℃ for 2min, then at 95 ℃ for 10min, followed by 40 cycles: at 95 ℃ for 15 seconds; 60 ℃,1min, and finally the dissolution profile was added.

Sixthly, data processing

After transfection of microRNA inhibitor, simulant or negative control, the content change of skin photoaging microRNA marker and the expression change of target gene are compared by percentage value with the level of untransfected group, and the data results are shown in Table 3. As shown in FIG. 2, when the content of hsa-miR-3161 in melanocytes is reduced, the expression of TYRP1 gene is increased; as shown in FIG. 3, when hsa-miR-509-5p content in keratinocytes is increased, HIF1A gene expression is decreased; as shown in FIG. 4, when the content of hsa-miR-29b-1-5p in melanocytes is reduced, the expression of TXNIP gene is reduced. The verification experiment result of the MicroRNA markers proves that the MicroRNA markers can be used as the regulatory factors of the skin photoaging related genes.

TABLE 3 microRNA marker for skin photoaging on target gene expression level

Example 5: efficacy of cosmetic active substance detection by taking microRNA marker of skin photoaging as target

First, in vitro culture of epidermal melanocytes

Isolation and in vitro culture of epidermal melanocytes As described in example 4, at 10,000 cells/cm²Seeded into 6-well cell culture plates.

Secondly, detecting the influence of the cosmetic active substances on the skin photoaging microRNA marker

After 3 days of Melanocyte growth, the cells were cultured with Melanocyte medium M2 medium containing cosmetic active, nicotinamide in the concentration of 50. mu.M in the medium, instead of the cell change solution, and the control group was cultured with the conventional Melanocyte medium M2 medium.

After 48h of treatment of the cells with the active substance, the cells were subjected to a cumulative dose of 2J/cm using a UV irradiator (VILBER LOURMAT/BioSun)²While retaining cells that were not treated with actives and not subjected to UV irradiation as controls. The cells were cultured for 24 h.

Thirdly, detecting the expression of the microRNA marker of skin photoaging by RT-PCR

Harvesting cells to extract total RNA, detecting the change of hsa-miR-3161 and hsa-miR-29b-1-5p in the cells and the change conditions of TYRP1 and TXNIP gene expression, wherein the specific method and the data analysis method of the RT-PCR experiment are the same as those in example 4. The detection result is shown in FIG. 5, after UV irradiation, the content of hsa-miR-3161 in the melanocyte which is not treated by nicotinamide is reduced to 23.9%, the content of hsa-miR-29b-1-5p is increased to 159.5%, the expression level of corresponding TYRP1 is increased to 124.4%, and the TXINIP is reduced to 36.2%. And after UV irradiation, the content of hsa-miR-3161 is reduced to 78.4%, the content of hsa-miR-29b-1-5p is increased to 116.5%, the corresponding expression level of TYRP1 is 104.2%, and the content of TXINIP is 89.5%. Therefore, the nicotinamide can relieve the regulation level of ultraviolet irradiation on hsa-miR-3161 and hsa-miR-29b-1-5p, reduce the change of TYRP1 and TXNIP expression levels, and is favorable for improving the application potential of skin photoaging phenomenon.

The above examples are only illustrative of the present invention and are not intended to limit the present invention, and those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, which falls within the scope of the present invention, and the appended claims shall control the scope of the present invention.

Sequence listing

<110> Kalan (group) corporation

<120> a method for screening skin photoaging-improving active substance by using skin photoaging target and skin photoaging-improving active substance

<130>TJW-NP-18-100058

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>RNA

<213> Intelligent (Homo sapiens)

<400>1

cugauaagaa cagaggccca gau 23

<210>2

<211>21

<212>RNA

<213> Intelligent (Homo sapiens)

<400>2

uacugcagac aguggcaauc a 21

<210>3

<211>24

<212>RNA

<213> Intelligent (Homo sapiens)

<400>3

gcugguuuca uauggugguu uaga 24

<210>4

<211>22

<212>DNA

<213> Intelligent (Homo sapiens)

<400>4

tctcaatggc gagtggtctg tg 22

<210>5

<211>22

<212>DNA

<213> Intelligent (Homo sapiens)

<400>5

cctgtggttc aggaagacgt tg 22

<210>6

<211>24

<212>DNA

<213> Intelligent (Homo sapiens)

<400>6

tatgagccag aagaactttt aggc 24

<210>7

<211>23

<212>DNA

<213> Intelligent (Homo sapiens)

<400>7

cacctctttt ggcaagcatc ctg 23

<210>8

<211>22

<212>DNA

<213> Intelligent (Homo sapiens)

<400>8

cagcagtgca aacagacttc gg 22

<210>9

<211>22

<212>DNA

<213> Intelligent (Homo sapiens)

<400>9

ctgaggaagc tcaaagccga ac 22

<210>10

<211>21

<212>DNA

<213> Intelligent (Homo sapiens)

<400>10

caaggatgac acgcaaattg g 21

<210>11

<211>22

<212>DNA

<213> Intelligent (Homo sapiens)

<400>11

tctgtgatgc ccttagatgt cc 22

<210>12

<211>20

<212>DNA

<213> Intelligent (Homo sapiens)

<400>12

aatggggttc aacgggttac 20

Claims

1. The method for screening the skin photoaging improvement active substances by using the skin photoaging targets is characterized in that one or more differential microRNAs selected from one or more of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p in skin cells are used as targets for screening detection.

2. The method according to claim 1, wherein the screening for differential microRNAs comprises the steps of:

(1) collecting a plurality of skin samples, and grouping according to whether the skin collecting parts are irradiated by ultraviolet rays in sunlight;

(2) performing total RNA extraction on the plurality of skin samples;

(3) hybridizing the total RNA extraction sample with a human microRNA chip;

(4) scanning the chip, and processing data to obtain a microRNA expression profile;

(5) processing data to obtain differential microRNA;

(6) and carrying out function and metabolic pathway enrichment analysis on the target gene set of the differential microRNA.

3. The method of claim 1 or 2, wherein the skin cells are selected from one or more of dermal fibroblasts, epidermal keratinocytes and epidermal melanocytes.

4. The method according to any one of claims 1 to 3, wherein the modulation of said target by the active ingredient in the skin cells is determined by RT-PCR.

5. The method of claim 4, wherein the RT-PCR method is performed by expressing the target in an amount of 2^-∆CtTo measure.

6. The method according to claim 5, wherein the determination criteria for the RT-PCR method are: whether the expression level of the skin cell target treated with the active ingredient is significantly reduced as compared with that of the control group or not (1)P<0.05）。

7. The method of claim 6, wherein the type of application of the active is a topical skin agent.

8. The method of claim 7, wherein the topical skin agent is selected from the group consisting of: one or more of a facial care product, a make-up product, a hair care product, a body care product.

9. An agent for improving skin photoaging, wherein the agent-treated sample is compared with an untreated control sample, and one or more selected from the group consisting of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p in skin cells are used as targets, and the expression level of the targets is determined by RT-PCR method to be 2^-∆CtIn terms of a significant decrease in the value of one or more markers of hsa-miR-509-5p and hsa-miR-29b-1-5p in the active-treated sample compared to the control group(s) ((P<0.05), or the value of hsa-miR-3161 in the active-treated sample is significantly increased compared to the control group (P<0.05）。

10. Active according to claim 9, characterized in that it is selected from: the composition comprises one or more of rose honey, bamboo rice extract, flavanone derivatives, tsugeki extract, psammophyte mixture, coreopsis extract, bamboo juice extract, peach gum aqueous solution, peony extract microemulsion, praecox extract, balsamifera extract, phellinus igniarius polysaccharide extract, composite seed extract, composite flower extract, prinsepia utilis royle extract, saccharomyces cerevisiae extract, ginseng seed extract, rue leontopodium extract, peony seed extract, gentian extract, limonium extract, cow milk seed extract, prinsepia utilis royle extract, pomegranate extract-containing composition, cedar ginseng extract-containing composition, coreopsis tinctoria extract-containing composition, rosa davurica pall extract, impatiens balsamina extract, scinaria lunata extract and acacia extract.