CN116077517A - Application of miR-582-5p in preparation of medicines for preventing premature skin aging - Google Patents

Application of miR-582-5p in preparation of medicines for preventing premature skin aging Download PDF

Info

Publication number
CN116077517A
CN116077517A CN202310170461.2A CN202310170461A CN116077517A CN 116077517 A CN116077517 A CN 116077517A CN 202310170461 A CN202310170461 A CN 202310170461A CN 116077517 A CN116077517 A CN 116077517A
Authority
CN
China
Prior art keywords
mir
skin
collagen
preventing premature
medicament
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310170461.2A
Other languages
Chinese (zh)
Inventor
李嘉
张佳欣
吕卓敏
许可
周嘉恒
张星
高峰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Air Force Medical University of PLA
Original Assignee
Air Force Medical University of PLA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Air Force Medical University of PLA filed Critical Air Force Medical University of PLA
Priority to CN202310170461.2A priority Critical patent/CN116077517A/en
Publication of CN116077517A publication Critical patent/CN116077517A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/18—Antioxidants, e.g. antiradicals

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Dermatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention discloses a pharmaceutical application of miR-582-5p in preventing premature senility of skin, and experiments prove that the miR-582-5p has an obvious effect of preventing premature senility of skin, can inhibit aging of skin fibroblast and can strengthen secretion of skin collagen. miR-582-5p is an endogenous substance, exists in normal skin fibroblasts and smooth muscle cells, and has a safety advantage in preventing premature skin aging by regulating miR-582-5 p. miR-582-5p promotes the function of promoting collagen secretion by increasing the phosphorylation level of skin fibroblast Akt, and achieves the anti-aging purpose aiming at the skin fibroblast with targeting and specificity.

Description

Application of miR-582-5p in preparation of medicines for preventing premature skin aging
Technical Field
The invention belongs to the technical field of biological medicines, relates to a novel pharmaceutical application of RNA small molecules, and in particular relates to a pharmaceutical application of miR-582-5p in preventing premature skin aging.
Background
The skin is the organ with the largest and most extensive distribution of human body and bears the physiological functions of body temperature regulation, secretion, excretion, immune correlation and the like. With the age, the skin is degenerated in structure and function, and the skin structure is atrophic and the skin is degenerated, so that the skin aging is initiated, and the occurrence and development of a plurality of skin diseases are accelerated. Skin aging is the most intuitive manifestation of body aging, and its nature and basis are the aging of skin cells. By intervening in the skin aging process, improving the skin state and structure has become one of the research hotspots in the anti-aging field.
The most important cellular component of the dermis of the skin is fibroblasts, which are closely related to tissue wound repair. Skin aging is associated with reduced fibroblast count, altered morphology, reduced or reduced secretory synthesis, etc. Collagen is one of the important components of skin, wherein the type I collagen is the most important component and is distributed in tissues such as skin, tendons and the like, meanwhile, the content of the collagen in sea water product processing wastes (skin, bone and scale) is up to 80-90%, and the collagen is the protein with the most expression of organisms and is widely applied in the field of medicine and pharmacology. Among them, researchers at university of Beijing, university of Sichuan and university of China report that collagen products extracted from salmon, stichopus japonicus, jellyfish and other products can improve skin quality. In abroad, research teams such as Tanaka, matsuda, oesser respectively reveal the potential capability and molecular mechanism of collagen for delaying skin aging from the molecular biology level. In general, although collagen has been accepted by the public for its use in delaying skin aging, currently available factors for skin collagen regeneration are derived from marine organisms, which are not efficiently absorbed by human skin to function due to their poor thermal stability and their fish species specificity.
mirnas are endogenous single-stranded non-coding microrna molecules of a stretch of nucleotides consisting of between 20-25bp that bind to the 3' -non-coding region of mRNA in either a complete or incomplete pairing. miRNA has biological activity, and can mediate the degradation of mRNA and inhibit the translation of protein. In addition, miRNA has the capacity of regulating genes, and can play an important role in regulating various systems, tissues and organs of a human body. Studies have found that miRNA expression is abnormal in the skin aging process and that the premature aging process can be regulated by intervention of specific mirnas. Thus, mirnas are effective targets in the prevention and treatment of premature skin aging.
miR-582-5p has been reported to play an important role in various tumor progression. Studies by Takahiro et al indicate that miR-582-5p can inhibit bladder cancer cell proliferation invasion by targeting PGGT 1B. A recent study showed that miR-582-5p inhibits apoptosis in glioblastoma stem cells by acting on caspase-9, caspase-3, bim, etc. Liu et al showed that miR-582-5p could promote infiltration transfer of colon cancer cells by acting on PTEN. However, to date, no study has been reported to focus on the role of miR-582-5p in premature skin aging.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide the pharmaceutical application of miR-582-5p in preventing premature skin aging, and discloses the novel pharmaceutical application of miR-582-5p in preventing premature skin aging for the first time.
In order to achieve the above purpose, the invention is realized by adopting the following technical scheme:
the invention discloses application of miR-582-5p in preparation of a medicament for treating and/or preventing premature skin aging.
Preferably, the drug is a drug for increasing collagen content.
It is further preferred that the Collagen content is increased by modulating the levels of Collagen I and Collagen III proteins in skin fibroblasts.
Preferably, the medicament is a medicament for delaying the progression of cellular senescence.
It is further preferred that the progression of cellular senescence is delayed by up-regulating the proliferation of dermal fibroblasts and/or inhibiting expression of senescence markers.
Preferably, the medicament is a medicament for promoting skin fibroblasts to enhance collagen secretion.
It is further preferred that skin fibroblasts enhance collagen secretion by increasing the phosphorylation level of skin fibroblasts Akt.
The invention discloses a medicine for preventing premature skin aging, which consists of miR-582-5p and pharmaceutically-addable auxiliary materials;
the medicine takes miR-582-5p as a medicine target to regulate miR-582-5p expression at the gene level and/or protein level.
Preferably, the auxiliary materials comprise one or more of diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers and lubricants.
Preferably, the drug is capable of being introduced into body tissue by a physical or chemical mediated method; or mixed or wrapped with other substances and introduced into the body.
Compared with the prior art, the invention has the following beneficial effects:
the invention discloses a novel pharmaceutical application of miR-582-5p in preventing premature skin aging for the first time, and experiments prove that the miR-582-5p has a remarkable effect of preventing premature skin aging, can inhibit skin fibroblast aging and can strengthen skin collagen secretion. miR-582-5p is an endogenous substance, exists in normal skin fibroblasts and smooth muscle cells, and has a safety advantage in preventing premature skin aging by regulating miR-582-5 p. miR-582-5p promotes the function of promoting collagen secretion by increasing the phosphorylation level of skin fibroblast Akt, and achieves the anti-aging purpose aiming at the skin fibroblast with targeting and specificity.
Drawings
FIG. 1 is the effect of miR-582-5p on skin fibroblast collagen content; wherein A is miR-582-5p for detecting the protein level of skin fibroblast collagen; b is a statistical graph of the content relative value of miR-582-5p to skin fibroblast type I collagen; c is a statistical graph of the relative value of miR-582-5p to the level of the skin fibroblast type III collagen; d is miR-582-5p collagen of skin fibroblastmRNA level detection; wherein, n=4, * P＜0.05vs.NC；
FIG. 2 is the effect of miR-582-5p on the skin fibroblast senescence phenotype; wherein; a is the influence of miR-582-5p on the SA-beta-gal staining result of the skin fibroblast; b is the influence of miR-582-5p on the proliferation capacity of skin fibroblasts; c is the effect of miR-582-5p on the mRNA levels of p16 and p21 markers of skin fibroblast aging; wherein, n=4, * P＜0.05vs.NC。
FIG. 3 is a graph showing the effect of miR-582-5p on a pathway associated with regulation of skin fibroblast collagen synthesis; wherein A is miR-582-5p for detecting the protein level of an isolated skin fibroblast collagen synthesis related regulation pathway; b is a protein level relative value statistical graph of miR-582-5p on an isolated skin fibroblast collagen synthesis related regulation pathway; n=4 and, * P＜0.05vs.NC， # P＜0.05vs.inhibitor-NC。
Detailed Description
In order that those skilled in the art will better understand the present invention, a technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in which it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, shall fall within the scope of the present invention.
It should be noted that the terms "first," "second," and the like in the description and the claims of the present invention and the above figures are used for distinguishing between similar objects and not necessarily for describing a particular sequential or chronological order. It is to be understood that the data so used may be interchanged where appropriate such that the embodiments of the invention described herein may be implemented in sequences other than those illustrated or otherwise described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.
The invention is described in further detail below with reference to the attached drawing figures:
miR-582-5p is a miRNA, and the sequence is as follows:
UCAUUGACCAACUUGUUGACAUU。
the research shows that miR-582-5p has the functions of regeneration and preventing skin premature senility, so that the miR-582-5p has a new application in developing medicines. The relevant effect of miR-582-5p on premature skin aging is demonstrated by a specific experiment.
1. Collagen secretion promotion effect of miR-582-5p on isolated skin fibroblast
Human skin fibroblasts were cultured in DMEM medium containing 10% fetal bovine serum (Gibco, usa) and placed in a 37 ℃ incubator (95% air/5% carbon dioxide). Cell transfection was performed when the cells grew to 50-60% in six well plates. miR-582-5p mimic (50. Mu.M) or inhibitors (100. Mu.M) and negative controls thereof were diluted with Opti-MEM medium (Invitrogen, USA). While Lipofectamine RNAiMAX co-transfection reagent was mixed with Opti-MEM medium. After the two mixtures are mixed uniformly and incubated for 15min, the two mixtures are added into a cell culture medium to be mixed uniformly, a six-hole plate is placed into a incubator to be incubated for 8h, and the supernatant is discarded and then fresh complete culture medium is added to replace the supernatant. Observing cell morphology under a light microscope, collecting cells after photographing and recording, respectively extracting protein and RNA, and then carrying out Western blotting experiments and real-time q-RT PCR experiments to detect the protein level and mRNA level of the Collagen I and the Collagen III.
As shown in FIG. 1, it can be seen that the expression level of type I and type III Collagen in human skin fibroblasts is significantly increased after miR-582-5p stimulation, and the mRNA levels of Collagen I and Collagen III are also significantly increased, (wherein n=4, * p < 0.05vs. miR-NC) suggests that miR-582-5P has collagen secretion promoting effect on isolated skin fibroblasts.
2. Influence of miR-582-5p on human skin fibroblast aging phenotype
Cell culture and transfection methods As described in section 1 above, 20J/cm was used after transfection 2 After 20min of UVA irradiation, observing the cell morphology under a light microscope and recording; cell senescence status was determined using the SA β -galactosidase (SA β -gal) staining kit. After removal of the cell growth medium, the six well plates were washed once with PBS, and after fixation of each well of cells with 1mL of 1 Xthe fixative solution at room temperature for 10-15min, washed twice with PBS. To each well, 1mL of beta-galactosidase staining solution was added and the plate was sealed with a plastic sealing film to prevent evaporation. Plates were incubated in a dry incubator (without CO at 37 DEG C 2 ) More than 12h of incubation. Observing the number of blue-stained cells under a microscope, the blue-stained cells being identified as senescent cells; human skin fibroblasts were isolated from 10 3 -10 4 The density of individual cells/well was seeded in 96-well plates and 100 μl of medium was added. Culturing cells in a constant temperature incubator overnight, adding miR-582-5p mic or NC into the plate according to the method shown in section 1 after the cells are adhered, removing the transfection medium after 6h of transfection in the incubator, changing to normal complete medium, and adopting 20J/cm 2 After 20min of UVA irradiation, the cell proliferation status was examined after 1, 2, 3 and 4 days, respectively. CCK8 reagent was carefully added to each well of the plate using a repeat pipette as standard. After the addition of the reagents, the plates were incubated in an incubator for 2h and then read. Finally, measuring the absorbance (450 nm) of the sample by an enzyme-labeled instrument to obtain a measurement result; after RNA extraction from the irradiated cells, p16 and p21 mRNA levels were detected using q-RT PCR experiments.
As shown in fig. 2 a, the human skin fibroblast morphology of the control group is deformed and distorted after UVA irradiation, the refractive index is obviously reduced, part of cells die, and most of cells treated by miR-582-5p in advance still keep long fusiform, have clear outline and have good refractive index; as shown in fig. 2B, the percentage of β -galactosidase-expressing positive cells in the control and miR-582-5 p-treated groups after UVA irradiation was 70.60% ± 3.04%, 10.58% ± 3.69%, respectively, with significant statistical significance between the two groups (where n=4, * p < 0.05vs. miR-NC); as shown in FIG. 2C, the human skin of the control group became visible after UVA irradiationThe proliferation rate of the fibroblasts was significantly reduced, while the miR-582-5p pretreatment group grew at a higher proliferation rate (where n=4, * p < 0.05vs. miR-NC); as shown in fig. 2D, after UVA irradiation, senescence markers p16 and p21 in human skin fibroblasts in the control group were significantly upregulated in mRNA levels, while p16 and p21 in the miR-582-5 p-pretreated group were at lower levels (where n=4, * p < 0.05vs. miR-NC); the result shows that miR-582-5p can obviously delay the photoaging process of human skin fibroblasts caused by UVA irradiation and inhibit cell aging.
3. Protein influence of miR-582-5p on human skin fibroblast collagen synthesis-related regulation pathway
After 48h transfection into human skin fibroblasts using lipomax and miR-582-5p mic (50 μm) and control NC, miR-342-5pin inhibitor (100 μm) and control NC, relevant protein levels (including Akt, p-Akt, collagen I and Collagen III) were detected by western immunoblotting experiments.
As shown in FIG. 3, the results show that miR-582-5p significantly increases the phosphorylation level of Akt Ser473, while miR-582-5p inhibitor inhibits the increase of the phosphorylation level of Akt Ser473, thereby reducing the expression levels of Collagen I and Collagen III. (n=4, * P＜0.05vs.mimic-NC， # P＜0.05vs.inhibitor-NC)
in conclusion, experiments show that miR-582-5p can promote collagen regeneration of skin fibroblasts, and simultaneously repress cell aging caused by UVA and prevent premature skin aging: miR-582-5p can promote the increase of the phosphorylation level of Akt Ser473, so that the expression of Collagen I and Collagen III in skin fibroblasts is enhanced, and skin premature senility is prevented.
Therefore, miR-582-5p can be applied to medicines for promoting skin collagen regeneration, suppressing skin fibroblast aging and preventing skin premature senility. The application of the collagen protein in the preparation of the medicines for increasing the phosphorylation level of the skin fibroblast Akt and promoting the up-regulation of the collagen protein expression of the skin fibroblast is provided.
Correspondingly, miR-582-5p can be used as a target point for preparing a medicine for preventing premature skin aging. In particular to the preparation of a medicine for regulating the expression of miR-582-5p serving as a medicine target point at the gene level and/or protein level; drugs that synergistically and/or assist miR-582-5p in the inhibition of cellular senescence processes, such as promotion of skin fibroblast proliferation and inhibition of upregulation of senescence marker expression, etc.
Preparation of a medicament for increasing the phosphorylation level of skin fibroblast Akt in synergy and/or assistance of miR-582-5 p; and the preparation of a drug that synergistically and/or assists miR-582-5p in increasing expression of Collagen I and Collagen III in skin fibroblasts.
The above is only for illustrating the technical idea of the present invention, and the protection scope of the present invention is not limited by this, and any modification made on the basis of the technical scheme according to the technical idea of the present invention falls within the protection scope of the claims of the present invention.

Claims (10)

  1. Application of miR-582-5p in preparation of medicine for treating and/or preventing premature skin aging.
  2. 2. The use according to claim 1, wherein the medicament is a medicament for increasing collagen content.
  3. 3. The use according to claim 2, wherein the Collagen content is increased by modulating the levels of CollagenI and Collagen III proteins in skin fibroblasts.
  4. 4. The use according to claim 1, wherein the medicament is a medicament for delaying the progression of cellular senescence.
  5. 5. The use according to claim 4, wherein the progression of cellular senescence is delayed by promoting proliferation of dermal fibroblasts and/or inhibiting expression of senescence markers.
  6. 6. The use of claim 1, wherein the medicament is a medicament for promoting collagen secretion by skin fibroblasts.
  7. 7. The use of claim 6, wherein skin fibroblasts enhance collagen secretion by increasing the phosphorylation level of skin fibroblasts Akt.
  8. 8. The medicine for preventing premature skin aging is characterized by comprising miR-582-5p and pharmaceutically-addable auxiliary materials;
    the medicine takes miR-582-5p as a medicine target to regulate miR-582-5p expression at the gene level and/or protein level.
  9. 9. The agent for preventing premature skin aging according to claim 8, wherein the auxiliary materials include one or more of a diluent, an excipient, a filler, an adhesive, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, an adsorption carrier, and a lubricant.
  10. 10. The agent for preventing premature skin aging according to claim 8, wherein the agent is capable of being introduced into body tissue by a physical or chemical-mediated method; or mixed or wrapped with other substances and introduced into the body.
CN202310170461.2A 2023-02-27 2023-02-27 Application of miR-582-5p in preparation of medicines for preventing premature skin aging Pending CN116077517A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310170461.2A CN116077517A (en) 2023-02-27 2023-02-27 Application of miR-582-5p in preparation of medicines for preventing premature skin aging

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310170461.2A CN116077517A (en) 2023-02-27 2023-02-27 Application of miR-582-5p in preparation of medicines for preventing premature skin aging

Publications (1)

Publication Number Publication Date
CN116077517A true CN116077517A (en) 2023-05-09

Family

ID=86206423

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310170461.2A Pending CN116077517A (en) 2023-02-27 2023-02-27 Application of miR-582-5p in preparation of medicines for preventing premature skin aging

Country Status (1)

Country Link
CN (1) CN116077517A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117257957A (en) * 2023-11-21 2023-12-22 呈诺再生医学科技(北京)有限公司 Application of miR-660-5p in preparation of medicament for treating photoaging

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117257957A (en) * 2023-11-21 2023-12-22 呈诺再生医学科技(北京)有限公司 Application of miR-660-5p in preparation of medicament for treating photoaging
CN117257957B (en) * 2023-11-21 2024-02-27 呈诺再生医学科技(北京)有限公司 Application of miR-660-5p in preparation of medicament for treating photoaging

Similar Documents

Publication Publication Date Title
Xin et al. Expansion of CD26 positive fibroblast population promotes keloid progression
Xiao et al. miR‑186 functions as a tumor suppressor in osteosarcoma cells by suppressing the malignant phenotype and aerobic glycolysis
Ni et al. miR-21 promotes the differentiation of hair follicle-derived neural crest stem cells into Schwann cells
Kuo et al. Flashlamp pulsed‐dye laser suppressed TGF‐β1 expression and proliferation in cultured keloid fibroblasts is mediated by MAPK pathway
CN116077517A (en) Application of miR-582-5p in preparation of medicines for preventing premature skin aging
CN111254146B (en) Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer
Lee et al. Ascorbic Acid 2-Glucoside Stably Promotes the Primitiveness of Embryonic and Mesenchymal Stem Cells Through Ten–Eleven Translocation-and cAMP-Responsive Element-Binding Protein-1-Dependent Mechanisms
CN113846064A (en) FGF18 gene modified mesenchymal stem cell and preparation method and application thereof
CN106244593B (en) It is a kind of adjust pilose antler young pilose antler skin fast-growth microRNA and its application
CN113151177A (en) Mammary gland or breast cancer tissue acellular matrix and preparation method and application thereof
Shi et al. MiR‐330‐5p negatively regulates ovine preadipocyte differentiation by targeting branched‐chain aminotransferase 2
CN106350519A (en) MicroRNA for adjusting rapid growth of cornua cervi pantotrichum cartilage and application thereof
CN105688227B (en) Application of miR-127 in preparation of medicine for treating muscle diseases
CN115607689A (en) Application of KLF7 gene in preparation of drug for reversing cell senescence
KR101949443B1 (en) COMPOSITION FOR INHIBITING SENESCENCE OF ADULT STEM CELLS COMPRISING MICRORNAs AND CULTURE METHODS USING THE SAME
CN113717926A (en) Method for culturing kidney cancer organoid
EP3763822A1 (en) Method for screening skin endogenous aging targets, active material for improving skin endogenous aging and screening method therefor
CN113025560A (en) Periplaneta americana small peptide repair acceptor H2O2Construction method of pig ovarian granular cell model with oxidative damage
Ye et al. The effect of MiR-497 on the expression of target genes BCL-2 and LC3B on cardiomyocytes injured by hypoxia/reoxygenation
Xu et al. Tert-butyl hydroperoxide induces ferroptosis of bone mesenchymal stem cells by repressing the prominin2/BACH1/ROS axis
Qin et al. Comparison of primary keloid fibroblast cultivation methods and the characteristics of fibroblasts cultured from keloids, keloid-surrounding tissues, and normal skin tissues
Sun et al. Effects of miR-32 targeting PTEN on proliferation and apoptosis of myeloma cells.
Liu et al. Long noncoding RNA TPTE2P1 promotes the migration and invasion of hepatocellular carcinoma.
CN113151279B (en) hsa_circ_0001236 and application thereof
CN111118154B (en) Application of LINC01272 in preparation of tumor detection reagent and/or treatment drug

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination