WO2020073933A1 - Method for screening, by skin photoaging target, active matter improving skin photoaging, and active matter improving skin photoaging - Google Patents

Abstract

Disclosed in the present invention are a method for screening, by skin photoaging target, active matter improving skin photoaging, and active matter improving skin photoaging. MicroRNA in the skin is used as a testing basis, the microRNA being any one of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p or any combination thereof. The present invention provides novel regulating targets for the development of cosmetic active ingredients improving skin photoaging.

Description

Method for screening active substances for improving skin photoaging by using skin photoaging target and active substances for improving photoaging of skin Technical field

The present invention belongs to the field of biotechnology. Specifically, the present invention relates to a screening method for skin photoaging targets, a method for screening active substances with targets, and active substances for improving skin photoaging.

Background technique

In today's society, people generally pay more and more attention to their own skin conditions, hoping to maintain a healthy and young state through skin care products. On top of this expectation, there are subdivided types of products that solve different skin problems. With the passage of time, every consumer will face the problem of skin aging, so anti-aging skin care products have always occupied an important position in various categories of cosmetics.

Skin aging is divided into endogenous aging and exogenous aging. Endogenous aging refers to aging caused by genetic changes. Exogenous aging refers to aging caused by external factors, such as ultraviolet radiation, smoking, environment Pollution, etc. Human skin is inevitably exposed to sunlight for many years, and ultraviolet radiation in sunlight is the most important factor that directly causes skin aging. This aging is also called photoaging.

With the deepening of epigenetics research in recent years, people have a new understanding of the way of human gene expression. The various physiological and pathological conditions of the human body are not determined solely by genes. Epigenetic factors can also change the instructions for gene expression or not and let this set of instructions be inherited steadily. The main mechanisms of epigenetics include DNA methylation, histone modification, and non-coding RNA. Among them, non-coding RNA has very important and diverse regulatory functions. A high degree of attention has extremely high research value. The present invention is concerned with a non-coding RNA called microRNA (microRNA) that has received significant attention in recent years.

Found in 1993, microRNA is an endogenous small piece of RNA that involves RNA interference: they can target messenger RNA (mRNA) and cause it to degrade or terminate its translation. Micro RNA like this plays a very important role in cell regulation. Moreover, they form a group of the largest class of regulatory molecules. They are endogenous and originate from the primary microRNA (pri-miRNA) encoded by the genome. To date, approximately 700 human microRNAs have been identified. Their functions and targets have not been fully explained or confirmed.

MicroRNAs are a class of small molecules that are ubiquitous in organisms and are 17-27 nucleotides in length. They can specifically inhibit the expression of target genes by binding to complementary mRNA targets. Studies have shown that thousands of human protein-coding genes are regulated by microRNA, indicating that microRNA is the "master regulator" of many important biological processes.

The naming of microRNA is based on the chronological order in which it was discovered, taking hsa-miR-29b-1-5p as an example: hsa indicates that the species to which the molecule belongs is human, and miR is the identity of the mature microRNA, 29 It is a serial number given to the family member to which the microRNA belongs when it is discovered or submitted to a public database. "B", "-1" and "-5p" refer to the precursor sequence and genome of the mature microRNA, respectively. Location, number of the 5 'end arm of the precursor.

At present, research on skin miRNAs is very limited, especially on human skin.

On animal skin, initially in mice, expressed miRNAs have been cloned. They play an important role in the morphogenesis of the epidermis and fur. In recent years, it has been found that miRNAs are related to the growth of goat and sheep fur. Recently, miR203 in miRNA has been identified in the skin of mice, and it plays an important role in reducing the cell proliferation potential in the induction of epidermal differentiation. In humans, studies have compared the expression of miRNAs in normal skin with psoriasis skin and eczema skin. miR203 in miRNA is highly expressed in skin (relative to other organs) and is expressed only by keratinocytes. It has been proved to be a miRNA that is overexpressed in psoriasis skin.

At present, most of the microRNA research on skin is focused on the diagnosis and treatment of major skin diseases. The research on skin aging is very limited. The present invention collects a large number of normal human skin samples of different ages and uses high-throughput human-derived microRNA chips to test Skin microRNA expression profile, after screening and induction, we obtained microRNA molecules with significant differences.

In the analysis of the mechanism of action of microRNA molecules with significant differences, the "Validated Target" Module of the miRWalk2.0 database can be used to predict the target gene set of microRNA molecules, and the biological information database DAVID v6.8 is used to carry out the target gene set. Enrichment analysis of functions and metabolic pathways, according to the weight of target genes in skin aging function, microRNA molecules that play a key role, that is, microRNA markers for skin photoaging, can be obtained. Finally, the correlation between microRNA markers and predicted target genes can be verified by RT-PCR experiments.

The discovery of microRNA markers can be used to establish in vitro biological models, test the biological efficacy of chemical substances based on the expression levels of microRNA markers, and apply to the development of cosmetic active ingredients.

Summary of the invention

On the one hand, the present invention provides a method for developing active substances for improving skin photoaging, which uses microRNA markers for detecting skin photoaging as a basis for developing novel active functional ingredients for cosmetics for improving photoaging of skin.

In order to achieve the above objectives, the present invention adopts the following technical solutions:

Collect normal human skin samples irradiated by sunlight and protected from sunlight, and use high-throughput human microRNA chips to test microRNA expression profiles. The difference in microRNA expression profiles of skin under different irradiation conditions was compared, and microRNA markers for skin photoaging were obtained after screening and induction.

The microRNA marker for skin photoaging, characterized in that the marker is any one or more of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p The combination.

The hsa-miR-3161 sequence is shown in SEQ ID NO.1, the hsa-miR-509-5p sequence is shown in SEQ ID NO.2, and the hsa-miR-29b-1-5p sequence is SEQ ID NO.3, where,

According to the results of bioinformatics analysis, the target genes of the marker hsa-miR-3161 include TYRP1, the target genes of hsa-miR-509-5p include HIF1A, and the target genes of hsa-miR-29b-1-5p include TXNIP.

Tested by RT-PCR experiment, the marker hsa-miR-3161 is related to the expression of TYRP1 gene in skin, hsa-miR-509-5p is related to the expression of HIF1A gene in skin, hsa-miR-29b -1-5p is related to the expression of TXNIP gene in the skin.

The encoded product of the TYRP1 gene (Entrez ID: 7306) is tyrosinase-related protein 1, which promotes the production of melanin. The encoded product of the HIF1A gene (Entrez ID: 3091) is hypoxia-inducible factor 1A, which plays an important role in maintaining the homeostasis of the epidermis under oxidative stress. The encoded product of the TXNIP gene (Entrez ID: 10628) is a thioredoxin interaction protein, which can regulate the oxidative stress of melanocytes.

The markers are used to develop cosmetic active ingredients that improve skin photoaging. Specifically, skin cells of normal human origin are cultured in vitro, and the skin cells are treated with the active substance to be detected; after the cultivation is completed, the skin cells are harvested, and the semi-quantitative detection of microRNA RT-PCR is performed using the marker as a target. Any one or more of the markers hsa-miR-509-5p, hsa-miR-29b-1-5p have a significant down-regulation effect (P <0.05), or have the marker hsa-miR-3161 Active substances with significant upregulation (P <0.05) can be used to develop cosmetics that improve skin photoaging.

Compared with the prior art, the significant advantages of the present invention are:

In the present invention, the microRNA chip technology and the expression of photo-aged skin microRNA are jointly investigated for the first time, and the microRNA markers for photo-aged skin are screened out. , Suitable for the development of cosmetic active ingredients to improve skin photoaging.

In one aspect, the present invention relates to a method for screening skin photoaging targets, including the following steps:

Step 1: Collect multiple skin samples and group them according to whether the skin collection site is exposed to ultraviolet rays in the sun daily;

Step 2: Extract total RNA from the skin samples;

Step 3: Hybridize the total RNA extraction sample with the human microRNA chip;

Step 4: Scan the chip, data processing to obtain microRNA expression profile;

Step 5: Data processing to obtain differentiated microRNA;

Step 6: Perform functional and metabolic pathway enrichment analysis on the target gene set of the differentiated microRNA.

The preferred solution of the present invention is performed in the order of steps 1 to 6. However, a person skilled in the art can obviously adjust the sequence of several steps according to the actual situation, so that similar means of the present invention can be used to achieve the same function while achieving the same effect.

In one or more specific embodiments of the present invention, the differential microRNA is selected from one of hsa-miR-3161, hsa-miR-509-5p, and hsa-miR-29b-1-5p in skin cells or Multiple.

In one or more specific embodiments of the invention, the skin cells are selected from dermal fibroblasts, or epidermal melanocytes, or epidermal keratinocytes.

In one aspect, the present invention relates to a method for screening active substances for improving skin photoaging with skin photoaging targets, using one or more differentiating microRNAs selected from skin cells as targets for screening detection, the (s) The differential microRNA is selected from one or more of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p in skin cells.

In one or more specific embodiments of the present invention, the screening of the differential microRNA (s) includes the following steps:

Step 1: Collect multiple skin samples and group them according to whether the skin collection site is exposed to ultraviolet rays in sunlight;

Step 2: Extract total RNA from the skin samples;

Step 3: Hybridize the total RNA extraction sample with the human microRNA chip;

Step 4: Scan the chip, data processing to obtain microRNA expression profile;

Step 5: Data processing to obtain differentiated microRNA;

Step 6: Perform functional and metabolic pathway enrichment analysis on the target gene set of the differentiated microRNA.

The preferred solution of the present invention is performed in the order of steps 1 to 6. However, a person skilled in the art can obviously adjust the sequence of several steps according to the actual situation, so that similar means of the present invention can be used to achieve the same function while achieving the same effect.

In one or more specific embodiments of the present invention, the skin cells are selected from one or more of dermal fibroblasts, epidermal keratinocytes, and epidermal melanocytes.

In one or more specific embodiments of the invention, the modulation of the target of the skin cell by the active ingredient is determined by the RT-PCR method. Preferably, the RT-PCR method measures the expression level of the target by 2- ^ΔCt . More preferably, the determination criterion of the measurement result of the RT-PCR method is whether the expression level of the skin cell target treated with the active ingredient is significantly reduced compared with the control group (P <0.05).

In one or more specific embodiments of the present invention, the application type of the active agent for improving skin photoaging obtained by screening is an external preparation for skin. Preferably, the skin external preparation may be selected from facial care products, make-up products, hair care products, body care products and the like.

On the other hand, the present invention also relates to an active substance capable of improving the photoaging of skin, and a sample treated with the active substance is compared with an untreated control sample to select from hsa-miR-3161, hsa- One or more of miR-509-5p and hsa-miR-29b-1-5p are used as targets, and the expression level of the target (s) is measured by RT-PCR method, which is measured by 2- ^ΔCt . Compared with the control group, whether one or more values of hsa-miR-509-5p and hsa-miR-29b-1-5p were significantly reduced (P <0.05), or hsa-miR -3161 was significantly increased (P <0.05). Preferably, these actives are selected from rose honey, bamboo rice extract, dihydroflavonoid derivatives, Cudrania extract, sand plant mixture, snow chrysanthemum extract, bamboo leaching extract, peach gum aqueous solution, peony extract micro Emulsion, Jinghuahua extract, Fragrant wood extract, Phellinus linteus polysaccharide extract, composite seed extract, composite flower extract, thorn fruit extract, Saccharomyces cerevisiae extract, ginseng seed extract, Fragrant velvet extract Extract, peony seed extract, gentian extract, limonium extract, milk seed extract, thorny young leaf extract, pomegranate extract-containing composition, snow ginseng extract-containing composition, snow chrysanthemum One or a combination of one or more selected from the group consisting of an extract composition, a rose extract, a balsamina extract, a green radix flower extract, and an acacia extract.

BRIEF DESCRIPTION

Figure 1 is a clustering heat map of differential microRNAs of normal human skin samples screened by high-throughput chips and exposed to sunlight and protected from sunlight.

Figure 2 shows the experimental results of RT-PCR experiments to verify the correlation between hsa-miR-3161 and TYRP1 gene expression.

Figure 3 shows the experimental results of RT-PCR experiments to verify the correlation between hsa-miR-509-5p and HIF1A gene expression.

Fig. 4 shows the experimental results of RT-PCR experiments to verify the correlation between hsa-miR-29b-1-5p and TXNIP gene expression.

Figure 5 shows the experimental results of using RT-PCR to detect the efficacy of cosmetic actives using microRNA markers of skin photoaging.

detailed description

In order to better understand the present invention, the present invention will now be further described in conjunction with the embodiments and drawings, but the implementation of the present invention is not limited to this. The experimental methods without specific conditions in the following examples are conventional methods and conditions well known to those skilled in the art, or implemented according to the product description.

Example 1: Detection of high-throughput microRNA microarray expression profiles of normal human skin samples exposed to and protected from sunlight

1. Obtaining skin samples

Fresh skin samples were purchased from Shanghai Xinchao Biological Technology Co., Ltd. The skin sample donors were all healthy women between 30-40 years old, born in Shanghai and living in Shanghai, excluding menopause, pregnancy, smoking and drinking donors , A total of 16 cases.

Among them, the skin irradiated with sunlight ultraviolet light was taken from the eyelid skin obtained by eyelid cosmetic surgery, a total of 8 cases, the average age of this group was (33.5 ± 2.8) years old. The skin protected from sunlight and ultraviolet radiation was taken from the chest or abdomen skin obtained by abdominal plastic surgery, a total of 8 cases, and the average age of the group was (34.8 ± 3.5) years old.

Specifically, skin tissue is collected after conventional plastic surgery, and the skin tissue is processed as soon as possible. Cut the skin tissue, the thickness of the skin does not exceed 0.5cm, cut into small pieces of 0.5cm x 1cm x 1cm (thickness x length x width), and then put these cut pieces into sterile Add 2ml RNAlater (Sigma) to each tube of the cryopreservation tube and immerse the tissue for preservation; put one piece of cut skin tissue into each cryotube and store in a deep-freezer at -80 ℃.

2. Extraction of total RNA from skin samples

The mirVana ^TM miRNA Isolation Kit without phenol reagent (Ambion), which is dedicated to the extraction of miRNA from ordinary tissues and cells, was used to extract the total RNA of the sample according to the standard operating procedures provided by the manufacturer. The total RNA extracted was extracted by Agilent Bioanalyzer 2100 ( (Agilent technologies company) After electrophoresis quality inspection is passed, it is ready for use.

3. High-throughput microRNA chip detection expression profile

It uses Agilent's Human miRNA chip covering 2549 human-related microRNA. The database is derived from the microRNA database miRBase V21.0 version. After dephosphorylation, denaturation, and ligation of total RNA samples, chip hybridization was performed. After washing, scan the chip, read the data, and normalize to obtain the microRNA chip expression profile of the skin irradiated by the ultraviolet rays of the sun and the skin protected from the ultraviolet rays of the sunlight.

Example 2: Screening of differential microRNA summarizing skin exposed to and protected from ultraviolet rays

The differential expression of microRNA in skin samples irradiated with and protected from sunlight ultraviolet rays was studied using the AgiMicroRna R analysis toolkit, which is based on the limma linear model to process test data. The analysis results are shown in the clustering heat map of Figure 1. The color scale distribution in the figure visually represents the expression of microRNA in different samples in a graphical form. The darker the color, the more significant the difference in microRNA expression, and the white area indicates the microRNA. There was no significant difference in the expression. It can be seen from Fig. 1 that there is a significant difference in microRNA expression levels between skin samples irradiated by sunlight and protected from sunlight. Several microRNA molecules with particularly significant differences are shown in Table 1.

Table 1. MicroRNA molecules with significant differences in skin that were screened by the chip experiment and exposed to sunlight and protected from sunlight

Example 3: Bioinformatics analysis to obtain microRNA markers and target genes for skin photoaging

Using the "Validated Target" Module of the miRWalk 2.0 database to predict the target genes of differentiated microRNAs in skin samples that are exposed to and protected from sunlight ultraviolet rays, a set of predicted gene sets is generated through this step.

The bioinformatics database DAVID v6.8 was used to analyze the enrichment of functions and metabolic pathways of the predicted gene set. The enrichment analysis is based on five annotation category modules, including gene ontology (GO_TERM), KEGG pathway, BIOCARTA pathway, InterPRO database and UP_KEYWORDS database. Part of the analysis results are shown in Table 2, which lists three functional or metabolic pathway annotations with high enrichment.

Table 2. Enrichment analysis results of functions and metabolic pathways of differential microRNA target genes

In the functions and metabolic pathways listed in Table 2, the TYRP1 gene encodes the product of tyrosinase-related protein 1, which promotes the production of melanin; the HIF1A gene encodes the product of hypoxia-inducible factor 1A, which stresses oxidative stress The lower epidermis has an important role in maintaining homeostasis; the encoded product of the TXNIP gene is the thioredoxin interaction protein, which can regulate the oxidative stress of melanocytes. These functions are all related to the stress response caused by ultraviolet radiation on skin cells, so it is believed that the microRNA molecules hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p that regulate these genes have Potential applications of aging markers.

Example 4: RT-PCR experiment to verify the association between microRNA markers and predicted target genes

1. In vitro monolayer culture of skin cells

The primary separation of epidermal keratinocytes and epidermal melanocytes was performed in a sterile environment using fresh facial skin samples purchased from a female donor aged 47 years old. Disinfect the skin once with iodophor and 75% alcohol, wash with PBS, cut the subcutaneous fat tissue and blood vessels with scissors, cut the skin into small pieces of 0.5cm x 0.5cm, and digest with Dispase II (Roche) at 4 ° C For 15 hours, separate the dermis and epidermis. The epidermal layer was digested with 0.05% pancreatin (Invitrogen) for 13 minutes and then divided into two parts, centrifuged at 1000 rpm for 10 minutes, and the supernatant was discarded. A part of the cells were resuspended with K-FSM culture solution (Invitrogen) and then inoculated into a 162 cm ² square flask, and placed in a cell culture incubator at 37 ° C., 5% CO 2, and saturated humidity for cultivation. When the cell layer grows to 70% -80% confluence, the harvested cells are frozen and stored to establish an epidermal keratinocyte bank. The other part of the cells was resuspended with Melanocyte medium M2 (Promocell) culture solution and then inoculated into a 162cm ² square flask, placed in a cell culture incubator at 37 ° C, 5% CO2, saturated humidity for cultivation. After the cell layer grows to 70% -80% confluence, the cells are harvested and stored frozen to establish an epidermal melanocyte bank.

2. Increase or decrease the content of specific microRNA molecules in skin cells through cell transfection

Prepare epidermal keratinocytes or epidermal melanocytes cultured in vitro in a monolayer, inoculate them in a 100 mm diameter petri dish at a density of 300,000 cells / cm ² , add the corresponding culture medium for culturing, and wait until the cells grow to 80% confluence. An experiment to test the association between microRNA markers and predicted target genes.

In this example, cell transfection technology was used to introduce a specific microRNA mimic (pre-miR) into skin cells to artificially increase the content of this microRNA in skin cells, and then the corresponding target genes predicted by RT-PCR experiments were investigated. Content changes. Or use cell transfection technology to transfer a specific microRNA inhibitor (anti-miR) into skin cells, artificially reduce the content of this microRNA in skin cells, and then detect the predicted changes in the expression of target genes.

For hsa-miR-3161, the content of hsa-miR-3161 in the skin is reduced after the ultraviolet rays of the sun, so in this example, the transfection reagent Lipofectamine RNAimax (Invitrogen) was used to convert 50nM hsa-miR-3161 The specific inhibitor anti-miR-3161 (Thermo) was introduced into melanocytes, and 50 nM of anti-miR ^™ miRNA Inhibitor Negative Control (Thermo) was introduced as a negative control.

For hsa-miR-509-5p, the content of hsa-miR-509-5p in the skin increases after the ultraviolet rays of sunlight, so in this example, a transfection reagent was used to transfer 5pM of hsa-miR-509-5p The mimic Pre-miR-509-5p (Thermo) was introduced into keratinocytes, and 5 pM of Pre-miR ^™ miRNA Precursor Negative Control # 1 (Thermo) was simultaneously introduced as a negative control.

For hsa-miR-29b-1-5p, the content of hsa-miR-29b-1-5p in the skin increases after exposure to ultraviolet rays from the sun, so in this example, a transfection reagent was used to transfer 5pM of hsa-miR-29b -1-5p mimetics Pre-miR-29b-1-5p (Thermo) was introduced into melanocytes and 5pM of Pre-miR ^™ miRNA Precursor Negative Control # 1 (Thermo) was introduced as a negative control.

The cells were harvested 48h after transfection, and the total RNA of the cells was extracted using mirVana miRNA isolation kit (Ambion), frozen and stored at -80 ° C for RT-PCR reaction.

3. Primer design for RT-PCR reaction

The correlation between the changes of microRNA markers of skin photoaging and the expression of target genes was verified by RT-PCR experiment. In this experiment, the RT-PCR of microRNA used U6 as the internal reference gene, and the RT-PCR of the tested gene used 18S as the internal reference gene. The primers for each gene to be tested and the internal reference gene are as follows:

TYRP1 justice chain: 5’TCTCAATGGCGAGTGGTCTGTG 3 ’(SEQ ID NO. 4)

TYRP1 antisense strand: 5’CCTGTGGTTCAGGAAGACGTTG 3 ’(SEQ ID NO.5)

HIF1A justice chain: 5’TATGAGCCAGAAGAACTTTTAGGC 3 ’(SEQ ID NO.6)

HIF1A antisense strand: 5 ’CACCTCTTTTGGCAAGCATCCTG 3’ (SEQ ID NO. 7)

TXNIP justice chain: 5’CAGCAGTGCAAACAGACTTCGG 3 ’(SEQ ID NO. 8)

TXNIP Antisense Chain: 5’CTGAGGAAGCTCAAAGCCGAAC 3 ’(SEQ ID NO.9)

U6: 5’CAAGGATGACACGCAAATTGG 3 ’(SEQ ID NO.10)

18S justice chain: 5’TCTGTGATGCCCTTAGATGTCC 3 ’(SEQ ID NO.11)

18S antisense strand: 5’AATGGGGTTCAACGGGTTAC 3 ’(SEQ ID NO.12)

After the primer design is completed, BLAST analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi) is used to avoid the non-specificity of the amplified target fragment sequence. The primers were synthesized by Shanghai Shenggong Biological Engineering Co., Ltd.

Fourth, reverse transcription

Remove the RNA from the refrigerator at -80 ℃, thaw at 4 ℃, then prepare the reaction solution High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) in a 0.2ml PCR tube, then place the PCR tube at 37 ℃ for 15min, 98 ℃ Denature for 5min and keep at 4 ℃.

5. SYBR Green qPCR

Place the PCR tube in the PCR instrument for reaction, incubate at 50 ° C for 2 min, then 95 ° C for 10 min; then perform 40 cycles: 95 ° C for 15 seconds; 60 ° C for 1 min, and finally add the dissolution curve.

Six, data processing

After transfection with microRNA inhibitors, mimics or negative controls, the changes in skin photoaging microRNA marker content and the expression of target genes were compared with the percentage of the level of the untransfected group. The data results are shown in Table 3. . As shown in Figure 2, when the content of hsa-miR-3161 in melanocytes is reduced, the expression of TYRP1 gene will increase; At this time, the expression of the HIF1A gene will decrease; as shown in Figure 4, when the content of hsa-miR-29b-1-5p in melanocytes is reduced, the expression of the TXNIP gene will decrease. The verification experiment results of MicroRNA markers confirmed that they can be used as regulators of skin photoaging related genes.

Table 3. The expression of target genes by skin photoaging microRNA markers

Example 5: Using microRNA markers of skin photoaging to detect the efficacy of cosmetic actives

1. In vitro culture of epidermal melanocytes

The method of separating and in vitro culturing epidermal melanocytes was as described in Example 4, and was seeded into a 6-well cell culture plate at a density of 10,000 cells / cm ² .

2. Detection of the effect of cosmetic actives on microRNA markers of skin photoaging

When the melanocytes grew for 3 days, the cells were changed and the cells were cultured with Melanocyte medium M2 medium containing cosmetic actives. The cosmetic active used in this example was nicotinamide, the concentration in the medium was 50 μM, control The group still used conventional Melanocyte medium M2 medium to cultivate cells.

After the cells were treated with the active substance for 48h, the cells were subjected to UVA irradiation with a cumulative dose of 2J / cm ² using a UV irradiator (VILBER LOURMAT / BioSun), while retaining the cells that were not treated with the active substance and were not irradiated with UV as a control. Continue culturing the cells for 24h.

3. Using RT-PCR to detect the expression of microRNA markers of skin photoaging

Harvest the cells to extract total RNA, detect the changes of hsa-miR-3161 and hsa-miR-29b-1-5p, and the changes of TYRP1 and TXNIP gene expression in the cells. The specific methods and data analysis methods of RT-PCR experiments are the same as the examples Shown in 4. The detection results are shown in Figure 5. After UV irradiation, the content of hsa-miR-3161 in melanocytes without nicotinamide treatment decreased to 23.9%, and the content of hsa-miR-29b-1-5p increased to 159.5%. The corresponding TYRP1 The expression level rose to 124.4% and TXNIP dropped to 36.2%. For melanocytes pretreated with nicotinamide, hsa-miR-3161 content decreased to 78.4% after UV irradiation, hsa-miR-29b-1-5p content increased to 116.5%, the corresponding TYRP1 expression level was 104.2%, TXNIP The content is 89.5%. Therefore, nicotinamide can slow down the regulation level of hsa-miR-3161 and hsa-miR-29b-1-5p by ultraviolet irradiation, reduce the change of TYRP1 and TXNIP expression levels, and help to improve the application potential of skin photoaging phenomenon.

The above examples only express several embodiments of the present invention and are not intended to limit the present invention. Those skilled in the art can make various equivalent modifications or replacements without departing from the inventive spirit of the present invention. The protection scope of the present invention shall be subject to the appended claims.

Claims (10)

1. A method for screening active substances for improving skin photoaging with a skin photoaging target, characterized in that one or more kinds of differential microRNAs selected from skin cells are used as targets for screening and detection, and the differential microRNAs are selected From one or more of hsa-miR-3161, hsa-miR-509-5p and hsa-miR-29b-1-5p in skin cells.
2. The method according to claim 1, wherein the screening of the differential microRNA comprises the following steps:

   (1) Collect multiple skin samples and group them according to whether the skin collection site is exposed to ultraviolet rays in sunlight;

   (2) Extracting total RNA from the skin samples;

   (3) Hybridize the extracted samples of total RNA with human microRNA chips;

   (4) Scan the chip and obtain microRNA expression profile by data processing;

   (5) Data processing to obtain differentiated microRNA;

   (6) Perform functional and metabolic pathway enrichment analysis on the target gene set of the differentiated microRNA.
3. The method according to claim 1 or 2, wherein the skin cells are selected from one or more of dermal fibroblasts, epidermal keratinocytes, and epidermal melanocytes.
4. The method according to any one of claims 1 to 3, wherein the modulation of the target of the skin cell by the active ingredient component is determined by the RT-PCR method.
5. The method according to claim 4, wherein the RT-PCR method measures the expression level of the target by 2- ^ΔCt .
6. The method according to claim 5, characterized in that the determination criterion of the measurement result of the RT-PCR method is: whether the expression level of the skin cell target treated with the active ingredient component is significantly lower than that of the control group (P < 0.05).
7. The method according to claim 6, wherein the type of application of the active substance is an external preparation for skin.
8. The method according to claim 7, wherein the external preparation for skin is selected from one or more of facial care products, make-up products, hair care products, and body care products.
9. Actives for improving skin photoaging, characterized in that the active-treated samples are compared with untreated control samples to select from hsa-miR-3161, hsa-miR-509-5p and One or more of hsa-miR-29b-1-5p is used as a target, and the expression level of the target is measured by RT-PCR method to measure by 2 ^{-ΔCt, hsa-} One or more markers in miR-509-5p and hsa-miR-29b-1-5p were significantly lower than those of the control group (P <0.05), or the samples treated with active substances Compared with the control group, the value of hsa-miR-3161 was significantly increased (P <0.05).
10. The active substance according to claim 9, characterized in that it is selected from the group consisting of: rose honey, bamboo rice extract, dihydroflavonoid derivatives, elderberry extract, sand plant mixture, snow chrysanthemum extract, bamboo leaching extract , Peach gum aqueous solution, peony extract microemulsion, Jinghuahua extract, fragrance wood extract, mulberry polysaccharide extract, composite seed extract, composite flower extract, thorn fruit extract, Saccharomyces cerevisiae extract, ginseng Seed extract, Echinacea extract, Peony seed extract, gentian extract, Limonium extract, milk seed extract, thorny young leaf extract, pomegranate extract-containing composition, snow ginseng One or more selected from the group consisting of extracts, snow chrysanthemum extracts, thorn rose extracts, balsamina extracts, green daisy extracts, and acacia extracts Compositions.

Images