CN111004817B - Agrobacterium-mediated rice genetic transformation method - Google Patents

Abstract

The invention discloses an agrobacterium-mediated rice genetic transformation method. The invention also discloses a culture medium for tissue culture of japonica rice and indica rice, which consists of solutes and a solvent, wherein the solutes comprise potassium nitrate, ammonium sulfate, monopotassium phosphate, magnesium sulfate heptahydrate, calcium chloride dihydrate, manganese sulfate, zinc sulfate heptahydrate, boric acid, potassium iodide, copper sulfate pentahydrate, sodium molybdate dihydrate, cobalt chloride hexahydrate, glycine, vitamin B1, vitamin B6, nicotinic acid, inositol, ferrous sulfate heptahydrate and disodium ethylenediamine tetraacetate. The universal tissue culture medium developed by the invention has the following advantages: 1. through the optimized combination of major elements, trace elements, organic matters and hormones, the calluses of japonica rice and indica rice can be induced and seedlings can be regenerated; 2. through agrobacterium mediation, both japonica rice and indica rice can realize stable transformation.

Description

Agrobacterium-mediated rice genetic transformation method

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an agrobacterium-mediated rice genetic transformation method, in particular to an agrobacterium-mediated genetic transformation method suitable for japonica rice and indica rice.

Background

In the history of artificial planting in China for at least 7000 years, rice is differentiated into two subspecies of indica rice and japonica rice under long-term evolution and artificial domestication, and the indica rice is mainly planted in China for a long time, and the proportion of japonica rice is less than 30%, so that indica rice is more concerned in the research aspect of rice genetic transformation. However, due to the fact that japonica rice is good in quality and taste, with the economic development and the improvement of living standard, the rice consumption of urban and rural residents tends to change from indica rice to japonica rice in recent years. According to the benefit data of rice variety-based cost in 2016, the net profit per mu of japonica rice is 1.5 times that of indica rice and 2.9 times that of indica rice, and the yield per mu is comparable to that of indica rice, so that the research on japonica rice and indica rice needs to be carried forward in two ways no matter the yield, quality and economic value are measured, or the national food safety is considered.

In the research of rice genetic transformation, japonica rice is generally considered to be easier to establish a high-efficiency and stable transformation system than indica rice, and indica rice is difficult to tissue culture and transform, so the establishment of the transformation system is bound by japonica and indica varieties. However, from the practical application perspective, if a genetic transformation system capable of taking account of both japonica rice and indica rice can be developed, and the genetic transformation requirements of both japonica rice and indica rice can be met, the development cost can be reduced undoubtedly, and a more efficient and high-quality foundation support is provided for technical research and production development.

Disclosure of Invention

The invention aims to provide a genetic transformation method suitable for indica rice and japonica rice.

In order to achieve the above object, the present invention provides, in the first place, a culture medium for genetic transformation of rice, which is referred to as medium RC. The culture medium RC is composed of solutes and a solvent, wherein the solutes comprise potassium nitrate, ammonium sulfate, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, calcium chloride dihydrate, manganese sulfate, zinc sulfate heptahydrate, boric acid, potassium iodide, copper sulfate pentahydrate, sodium molybdate dihydrate, cobalt chloride hexahydrate, glycine, vitamin B1, vitamin B6, nicotinic acid, inositol, ferrous sulfate heptahydrate and disodium ethylene diamine tetraacetate.

Further, each liter of the culture medium RC comprises 2300-2850mg of potassium nitrate, 380-490mg of ammonium sulfate, 210-420mg of monopotassium phosphate, 175-447.5mg of magnesium sulfate heptahydrate, 550mg of calcium chloride dihydrate 270, 15-30mg of manganese sulfate, 6-12mg of zinc sulfate heptahydrate, 5-15mg of boric acid, 4-8mg of potassium iodide, 0.025-0.05mg of copper sulfate pentahydrate, 0.25-0.5mg of sodium molybdate dihydrate, 0.025-0.05mg of cobalt chloride hexahydrate, 1.2-2.5mg of glycine, 11-1.2 mg of vitamin B, 60.5-1 mg of vitamin B, 0.5-1mg of nicotinic acid and 0-100mg of inositol (the mass of inositol can be 0), 28-55mg of ferrous sulfate heptahydrate and 37-74.5mg of disodium ethylene diamine tetraacetate.

Further, the solvent is double distilled water;

the concentration of the potassium nitrate in the culture medium RC is 2300-2850mg/L, 2300mg/L, 2650mg/L, 2750mg/L or 2850 mg/L;

the concentration of the ammonium sulfate in the culture medium RC is 380-490mg/L or 380mg/L or 490 mg/L;

the concentration of the potassium dihydrogen phosphate in the culture medium RC is 210-420mg/L or 210mg/L or 420 mg/L;

the concentration of the magnesium sulfate heptahydrate in the culture medium RC is 175-447.5mg/L or 175mg/L or 447.5 mg/L;

the concentration of the calcium chloride dihydrate in the culture medium RC is 270-550mg/L, or 270mg/L or 550 mg/L;

the concentration of the manganese sulfate in the culture medium RC is 15-30mg/L or 15mg/L or 23mg/L or 30 mg/L;

the concentration of the zinc sulfate in the culture medium RC is 6-12mg/L or 6mg/L or 12 mg/L;

the concentration of the boric acid in the culture medium RC is 5-15mg/L or 5mg/L or 10mg/L or 15 mg/L;

the concentration of the potassium iodide in the culture medium RC is 4-8mg/L or 4mg/L or 6mg/L or 8 mg/L;

the concentration of the copper sulfate pentahydrate in the culture medium RC is 0.025-0.05mg/L or 0.025mg/L or 0.03mg/L or 0.05 mg/L;

the concentration of the sodium molybdate dihydrate in the culture medium RC is 0.25-0.5mg/L or 0.25mg/L or 0.3mg/L or 0.5 mg/L;

the concentration of the cobalt chloride hexahydrate in the culture medium RC is 0.025-0.05mg/L or 0.025mg/L or 0.03mg/L or 0.05 mg/L;

the concentration of the glycine in the culture medium RC is 1.2-2.5mg/L, or 1.2mg/L, or 2.5 mg/L;

the concentration of the vitamin B1 in the culture medium RC is 1-1.2mg/L or 1mg/L or 1.2 mg/L;

the concentration of the vitamin B6 in the culture medium RC is 0.5-1mg/L or 0.5mg/L or 1 mg/L;

the concentration of the nicotinic acid in the culture medium RC is 0.5-1mg/L or 0.5mg/L or 1 mg/L;

the concentration of the inositol in the culture medium RC is 0-100mg/L or 0mg/L or 100 mg/L;

the concentration of the ferrous sulfate heptahydrate in the culture medium RC is 28-55mg/L or 28mg/L or 42mg/L or 55 mg/L;

the concentration of the disodium ethylene diamine tetraacetate in the culture medium RC is 37-74.5mg/L or 37mg/L or 56mg/L or 74.5 mg/L.

In order to achieve the above objects, the present invention further provides a subculture medium, an induction medium, a co-culture medium, a recovery medium, a screening medium, a regeneration medium and a rooting medium for genetic transformation of rice.

The subculture medium is obtained by uniformly mixing the culture medium RC with sucrose or maltose, sorbitol, hydrolyzed casein, glutamine, proline and 2, 4-D.

Further, the concentration of the sucrose or maltose in the secondary culture medium is 20-30g/L or 20g/L or 30 g/L;

the concentration of the sorbitol in the subculture medium is 10-20g/L or 10g/L or 20 g/L;

the concentration of the hydrolyzed casein in the subculture medium is 500-800mg/L or 500mg/L or 600mg/L or 800 mg/L;

the concentration of the glutamine in the secondary culture medium is 500-800mg/L or 500mg/L or 600mg/L or 800 mg/L;

the concentration of the proline in the secondary culture medium is 500-800mg/L or 500mg/L or 800 mg/L;

the concentration of the 2,4-D in the subculture medium is 1.5-2mg/L or 1.5mg/L or 2 mg/L.

Further, the pH of the subculture medium was 5.8.

The induction culture medium is obtained by uniformly mixing the subculture medium and the plant gel.

Further, the concentration of the plant gel in the induction culture medium is 2.5-4g/L or 2.5g/L or 3g/L or 4 g/L.

Further, the pH of the induction medium was 5.8.

The co-culture medium is obtained by uniformly mixing the induction culture medium and the acetosyringone.

Further, the concentration of the acetosyringone in the co-culture medium is 100-200uM or 100uM or 200 uM.

Further, the co-cultivation medium has a pH of 5.4.

The recovery culture medium is obtained by uniformly mixing the induction culture medium and timentin.

Further, the concentration of the timentin in the recovery medium is 200-300mg/L or 200mg/L or 300 mg/L.

Further, the recovery medium has a pH of 5.8.

The screening culture medium is obtained by uniformly mixing the induction culture medium, timentin and a screening agent.

Further, the concentration of the timentin in the screening culture medium is 200-300mg/L or 200mg/L or 300 mg/L;

the concentration of the screening agent in the screening culture medium is 35-65mg/L or 35mg/L or 45mg/L or 50mg/L or 65 mg/L.

Further, the screening agent is hygromycin.

The pH of the screening medium was 5.8.

The regeneration culture medium is obtained by removing 2,4-D in the induction culture medium and then uniformly mixing with timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid.

Further, the concentration of the timentin in the regeneration medium is 150-400mg/L or 150mg/L or 200mg/L or 400 mg/L;

the concentration of the kinetin in the regeneration culture medium is 0.5-1mg/L or 0.5mg/L or 1 mg/L;

the concentration of the 6-benzylaminopurine in the regeneration medium is 1-2mg/L or 1mg/L or 1.5mg/L or 2 mg/L;

the concentration of the naphthylacetic acid in the regeneration culture medium is 0.2-0.3mg/L or 0.2mg/L or 0.3 mg/L.

Further, the pH of the regeneration medium was 5.8.

The rooting culture medium is obtained by uniformly mixing 1/2 the culture medium RC, cane sugar, naphthylacetic acid and plant gel.

Further, the concentration of the sucrose in the rooting medium is 10-20g/L or 10g/L or 20 g/L;

the concentration of the naphthylacetic acid in the rooting culture medium is 0.1-0.5mg/L or 0.1mg/L or 0.5 mg/L;

the concentration of the plant gel in the rooting medium is 2.5-3.5g/L or 2.5g/L or 3g/L or 3.5 g/L.

Further, the rooting medium has a pH of 5.8.

In one embodiment of the invention, when the rice varieties are Wuyujing 23 and Wuyujing 27,

the culture medium RC (marked as culture medium RC I) consists of solute and solvent, wherein the solvent is double distilled water, and the solute and the concentration thereof are respectively as follows: 2300mg/L of potassium nitrate, 380mg/L of ammonium sulfate, 420mg/L of monopotassium phosphate, 175mg/L of magnesium sulfate heptahydrate, 550mg/L of calcium chloride dihydrate, 15mg/L of manganese sulfate, 12mg/L of zinc sulfate heptahydrate, 10mg/L of boric acid, 8mg/L of potassium iodide, 0.05mg/L of copper sulfate pentahydrate, 0.5mg/L of sodium molybdate dihydrate, 0.05mg/L of cobalt chloride hexahydrate, 2.5mg/L of glycine, 11/L of vitamin B11mg, 60.5mg/L of vitamin B, 0.5mg/L of nicotinic acid, 0mg/L of inositol, 42mg/L of ferrous sulfate heptahydrate and 56mg/L of disodium ethylenediamine tetraacetate.

The induction culture medium (marked as an induction culture medium RC-1) is obtained by uniformly mixing the culture medium RC I with sucrose, sorbitol, hydrolyzed casein, glutamine, proline, 2,4-D and plant gel, the concentration of the sucrose in the induction culture medium RC-1 is 30g/L, the concentration of the sorbitol in the induction culture medium RC-1 is 20g/L, the concentration of the hydrolyzed casein in the induction culture medium RC-1 is 600mg/L, the concentration of the glutamine in the induction culture medium RC-1 is 600mg/L, the concentration of the proline in the induction culture medium RC-1 is 800mg/L, and the concentration of the 2,4-D in the induction culture medium RC-1 is 2mg/L, the concentration of the plant gel in the induction medium RC-1 is 3 g/L.

The subculture medium (denoted as subculture medium-1) is obtained by removing the plant gel from the induction medium RC-1.

The co-culture medium (denoted as co-culture medium RCO-1) is obtained by mixing the induction medium RC-1 and acetosyringone. The concentration of the acetosyringone in the co-culture medium RCO-1 is 200 uM.

The recovery culture medium (denoted as recovery culture medium REC-1) is obtained by uniformly mixing the induction culture medium RC-1 and timentin. The concentration of the timentin in the recovery medium REC-1 is 300 mg/L.

The screening culture medium (marked as screening culture medium RSH-1) is obtained by uniformly mixing the induction culture medium RC-1, the timentin and the hygromycin. The concentration of the timentin in the screening medium RSH-1 is 300mg/L, and the concentration of the hygromycin in the screening medium RSH-1 is 35 mg/L.

The regeneration culture medium (marked as regeneration culture medium RG-1) is obtained by removing 2,4-D in the induction culture medium RC-1 and then uniformly mixing with timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid. The concentration of the timentin in the regeneration medium RG-1 is 200mg/L, the concentration of the kinetin in the regeneration medium RG-1 is 1mg/L, the concentration of the 6-benzylaminopurine in the regeneration medium RG-1 is 1mg/L, and the concentration of the naphthylacetic acid in the regeneration medium RG-1 is 0.2 mg/L.

In another embodiment of the invention, when the rice varieties are Nipponbare, Longjing 31 and round-grained nonglutinous 65B,

the culture medium RC (denoted as culture medium RC II) consists of solute and solvent, wherein the solvent is double distilled water, and the solute and the concentration thereof are respectively as follows: 2650mg/L potassium nitrate, 490mg/L ammonium sulfate, 210mg/L potassium dihydrogen phosphate, 447.5mg/L magnesium sulfate heptahydrate, 270mg/L calcium chloride dihydrate, 30mg/L manganese sulfate, 6mg/L zinc sulfate heptahydrate, 5mg/L boric acid, 4mg/L potassium iodide, 0.025mg/L copper sulfate pentahydrate, 0.25mg/L sodium molybdate dihydrate, 0.025mg/L cobalt chloride hexahydrate, 1.2mg/L glycine, 11.2mg/L vitamin B, 61mg/L vitamin B, 1mg/L nicotinic acid, 100mg/L inositol, 28mg/L ferrous sulfate heptahydrate, and 37mg/L disodium ethylenediaminetetraacetate.

The induction culture medium (marked as an induction culture medium RC-2) is obtained by uniformly mixing the culture medium RC II with sucrose, sorbitol, hydrolyzed casein, glutamine, proline, 2,4-D and plant gel, the concentration of the sucrose in the induction culture medium RC-2 is 30g/L, the concentration of the sorbitol in the induction culture medium RC-2 is 10g/L, the concentration of the hydrolyzed casein in the induction culture medium RC-2 is 500mg/L, the concentration of the glutamine in the induction culture medium RC-2 is 500mg/L, the concentration of the proline in the induction culture medium RC-2 is 500mg/L, the concentration of the 2,4-D in the induction culture medium RC-2 is 1.5mg/L, the concentration of the plant gel in the induction medium RC-2 is 3 g/L.

The subculture medium (denoted as subculture medium-2) is obtained by removing the plant gel from the induction medium RC-2.

The co-culture medium (denoted as co-culture medium RCO-2) is obtained by mixing the induction medium RC-2 and acetosyringone. The concentration of the acetosyringone in the co-culture medium RCO-2 is 200 uM.

The recovery culture medium (denoted as recovery culture medium REC-2) is obtained by uniformly mixing the induction culture medium RC-2 and timentin. The concentration of the timentin in the recovery medium REC-2 is 300 mg/L.

The screening culture medium (marked as screening culture medium RSH-2) is obtained by uniformly mixing the induction culture medium RC-2, the timentin and the hygromycin. The concentration of the timentin in the screening medium RSH-2 is 300mg/L, and the concentration of the hygromycin in the screening medium RSH-2 is 65 mg/L.

The regeneration culture medium (marked as regeneration culture medium RG-2) is obtained by removing 2,4-D in the induction culture medium RC-2 and then uniformly mixing with timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid. The concentration of the timentin in the regeneration medium RG-2 is 200mg/L, the concentration of the kinetin in the regeneration medium RG-2 is 1mg/L, the concentration of the 6-benzylaminopurine in the regeneration medium RG-2 is 1.5mg/L, and the concentration of the naphthylacetic acid in the regeneration medium RG-2 is 0.3 mg/L.

In another embodiment of the present invention, the rice variety C815s, Huanghuazhan,

the culture medium RC (denoted as culture medium RC III) consists of solute and solvent, wherein the solvent is double distilled water, and the solute and the concentration thereof are respectively as follows: potassium nitrate 2750mg/L, ammonium sulfate 380mg/L, monopotassium phosphate 420mg/L, magnesium sulfate heptahydrate 175mg/L, calcium chloride dihydrate 550mg/L, manganese sulfate 15mg/L, zinc sulfate heptahydrate 12mg/L, boric acid 10mg/L, potassium iodide 8mg/L, copper sulfate pentahydrate 0.05mg/L, sodium molybdate dihydrate 0.5mg/L, cobalt chloride hexahydrate 0.05mg/L, glycine 2.5mg/L, vitamin B11mg/L, vitamin B60.5mg/L, nicotinic acid 0.5mg/L, inositol 0mg/L, ferrous sulfate heptahydrate 42mg/L, and disodium edetate 56 mg/L.

The induction culture medium (marked as an induction culture medium RC-3) is obtained by uniformly mixing the culture medium RC III with maltose, sorbitol, hydrolyzed casein, glutamine, proline, 2,4-D and plant gel, the concentration of the maltose in the induction culture medium RC-3 is 30g/L, the concentration of the sorbitol in the induction culture medium RC-3 is 10g/L, the concentration of the hydrolyzed casein in the induction culture medium RC-3 is 500mg/L, the concentration of the glutamine in the induction culture medium RC-3 is 600mg/L, the concentration of the proline in the induction culture medium RC-3 is 800mg/L, and the concentration of the 2,4-D in the induction culture medium RC-3 is 2mg/L, the concentration of the plant gel in the induction medium RC-3 is 3 g/L.

The subculture medium (denoted as subculture medium-3) is obtained by removing the plant gel from the induction medium RC-3.

The co-culture medium (denoted as co-culture medium RCO-3) is obtained by mixing the induction medium RC-3 and acetosyringone. The concentration of the acetosyringone in the co-culture medium RCO-3 is 200 uM.

The recovery culture medium (denoted as recovery culture medium REC-3) is obtained by uniformly mixing the induction culture medium RC-3 and timentin. The concentration of the timentin in the recovery medium REC-3 is 200 mg/L.

The screening culture medium (marked as screening culture medium RSH-3) is obtained by uniformly mixing the induction culture medium RC-3, the timentin and the hygromycin. The concentration of the timentin in the screening medium RSH-3 is 200mg/L, and the concentration of the hygromycin in the screening medium RSH-3 is 50 mg/L.

The regeneration culture medium (marked as regeneration culture medium RG-3) is obtained by removing 2,4-D in the induction culture medium RC-3 and then uniformly mixing with timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid. The concentration of the timentin in the regeneration medium RG-3 is 200mg/L, the concentration of the kinetin in the regeneration medium RG-3 is 0.5mg/L, the concentration of the 6-benzylaminopurine in the regeneration medium RG-3 is 2mg/L, and the concentration of the naphthylacetic acid in the regeneration medium RG-3 is 0.3 mg/L.

In another embodiment of the invention, when the rice variety is Guangzhou 63-4S, Wushan si miao, Guangdong jinsi miao No. 2, 9311,

the culture medium RC (denoted as culture medium RC IV) consists of solute and solvent, wherein the solvent is double distilled water, and the solute and the concentration thereof are respectively as follows: 2850mg/L of potassium nitrate, 380mg/L of ammonium sulfate, 420mg/L of monopotassium phosphate, 175mg/L of magnesium sulfate heptahydrate, 550mg/L of calcium chloride dihydrate, 23mg/L of manganese sulfate, 12mg/L of zinc sulfate heptahydrate, 15mg/L of boric acid, 6mg/L of potassium iodide, 0.03mg/L of copper sulfate pentahydrate, 0.3mg/L of sodium molybdate dihydrate, 0.03mg/L of cobalt chloride hexahydrate, 2.5mg/L of glycine, 11mg/L of vitamin B, 60.5mg/L of vitamin B, 0.5mg/L of nicotinic acid, 0mg/L of inositol, 55mg/L of ferrous sulfate heptahydrate and 74.5mg/L of disodium ethylenediamine tetraacetate.

The induction culture medium (marked as an induction culture medium RC-4) is obtained by uniformly mixing the culture medium RC IV with maltose, sorbitol, hydrolyzed casein, glutamine, proline, 2,4-D and plant gel, the concentration of the maltose in the induction culture medium RC-4 is 30g/L, the concentration of the sorbitol in the induction culture medium RC-4 is 10g/L, the concentration of the hydrolyzed casein in the induction culture medium RC-4 is 800mg/L, the concentration of the glutamine in the induction culture medium RC-4 is 800mg/L, the concentration of the proline in the induction culture medium RC-4 is 800mg/L, the concentration of the 2,4-D in the induction culture medium RC-4 is 1.5mg/L, the concentration of the plant gel in the induction medium RC-4 is 3 g/L.

The subculture medium (denoted as subculture medium-4) is obtained by removing the plant gel from the induction medium RC-4.

The co-culture medium (denoted as co-culture medium RCO-4) is obtained by mixing the induction medium RC-4 and acetosyringone. The concentration of the acetosyringone in the co-culture medium RCO-4 is 200 uM.

The recovery culture medium (denoted as recovery culture medium REC-4) is obtained by uniformly mixing the induction culture medium RC-4 and timentin. The concentration of the timentin in the recovery medium REC-4 is 200 mg/L.

The screening culture medium (marked as screening culture medium RSH-4) is obtained by uniformly mixing the induction culture medium RC-4, the timentin and the hygromycin. The concentration of the timentin in the screening medium RSH-4 is 200mg/L, and the concentration of the hygromycin in the screening medium RSH-4 is 45 mg/L.

The regeneration culture medium (marked as regeneration culture medium RG-4) is obtained by removing 2,4-D in the induction culture medium RC-4 and then uniformly mixing with timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid. The concentration of the timentin in the regeneration medium RG-4 is 200mg/L, the concentration of the kinetin in the regeneration medium RG-4 is 0.5mg/L, the concentration of the 6-benzylaminopurine in the regeneration medium RG-4 is 2mg/L, and the concentration of the naphthylacetic acid in the regeneration medium RG-4 is 0.2 mg/L.

The rooting medium consists of solutes and a solvent, the solvent is double distilled water, and the solutes and the concentrations thereof are respectively as follows: 1150mg/L potassium nitrate, 190mg/L ammonium sulfate, 210mg/L potassium dihydrogen phosphate, 87.5mg/L magnesium sulfate heptahydrate, 275mg/L calcium chloride dihydrate, 7.5mg/L manganese sulfate, 6mg/L zinc sulfate heptahydrate, 5mg/L boric acid, 4mg/L potassium iodide, 0.025mg/L copper sulfate pentahydrate, 0.25mg/L sodium molybdate dihydrate, 0.025mg/L cobalt chloride hexahydrate, 1.25mg/L glycine, 10.5 mg/L vitamin B, 60.25mg/L vitamin B, 0.25mg/L nicotinic acid, 0mg/L inositol, 21mg/L ferrous sulfate heptahydrate, 28mg/L disodium ethylenediaminetetraacetate, 15g/L sucrose, 0.1mg/L naphthylacetic acid, and 3g/L vegetable gel.

The application of the culture medium in any one of the following a1) -a4) also belongs to the protection scope of the invention:

a1) culturing rice callus;

a2) preparing a product for culturing rice callus;

a3) genetic transformation of rice;

a4) preparing the genetically transformed rice product.

In order to achieve the above object, the present invention also provides a method for genetic transformation of rice.

The rice genetic transformation method provided by the invention comprises the following steps:

1) culturing rice seeds in the induction culture medium to obtain callus after induction culture;

2) culturing the callus after induction culture in the subculture medium to obtain the callus after subculture;

3) infecting the callus after subculture in agrobacterium tumefaciens resuspension to obtain infected callus;

the agrobacterium tumefaciens resuspension is obtained by oscillating and uniformly mixing agrobacterium tumefaciens containing a target gene expression vector in an infection liquid containing acetosyringone; the staining solution is obtained by uniformly mixing the culture medium RC with hydrolyzed casein, proline, sucrose and glucose;

4) sucking the infection liquid on the surface of the infected callus, and then carrying out dark culture on sterile filter paper soaked with the infection liquid to obtain the callus without brown spots on the surface;

5) culturing the callus without brown spots on the surface in the screening culture medium to obtain resistant callus;

6) culturing the resistant callus in a regeneration culture medium until the resistant callus grows green leaves to obtain rice seedlings;

7) and culturing the rice seedling in the rooting culture medium to obtain a transgenic rice plant.

Further, in the above-mentioned case,

the step 1) is also preceded by a step of sterilizing the rice seeds; the sterilization method comprises the following steps: after husking mature rice seeds, soaking and sterilizing the seeds in 75% (volume fraction) ethanol solution for 1min, then soaking and sterilizing the seeds in sodium hypochlorite solution with effective chlorine of 2% for 20-30min, and cleaning the seeds with sterilizing water for 3-5 times to obtain sterilized seeds.

In the step 1), the culture condition is dark culture at 32-35 ℃ for 16-24 days.

In the step 2), the culture condition is 120-200rpm, and dark culture is carried out at 26-28 ℃ for 7-10 days; specifically 120rpm, dark culture at 28 deg.C for 7-10 days.

In the step 3), the agrobacterium containing the target gene expression vector is agrobacterium EHA105 containing a recombinant vector pG 0051. The agrobacterium containing the target gene expression vector also comprises an activation step before being uniformly mixed with the infection liquid. The activated medium was YET medium containing rifampicin (25ug/ml) and kanamycin (50 ug/ml). The YET culture medium comprises solvent and solute, the solvent is double distilled water, the solute and its concentration are respectively: 5g/L of yeast extract, 10g/L of peptone, 5g/L of sodium chloride and 15g/L of agar. The activation condition is dark culture at 28 ℃ for 36-48 hours.

The concentration of the acetosyringone in the infection liquid is 100-;

the concentration of the hydrolyzed casein in the staining solution is 200-400mg/L or 200mg/L or 300mg/L or 400 mg/L;

the concentration of the proline in the invasion liquid is 200-500mg/L or 200mg/L or 300mg/L or 500 mg/L;

the concentration of the sucrose in the staining solution is 20 g/L;

the concentration of the glucose in the staining solution is 10 g/L.

OD of the staining solution₆₆₀0.1-0.2, and the infection condition is soaking for 10-15min at room temperature.

In the step 4), the dark culture condition is that the dark culture is carried out for 1 to 2 days at the temperature of between 19 and 21 ℃.

The step 4) also comprises the following steps: transferring to the recovery culture medium for culture if the dark cultured callus has brown spots on the surface; the recovery culture time was 3 days.

In the step 5), the culture condition is dark culture at 28-32 ℃ for 18-24 days, specifically dark culture at 30 ℃ for 18-24 days.

In the step 6), the culture condition is 25-28 ℃, and the culture is carried out for 15-25 days under the condition that the illumination period is 16h of white light/8 h of darkness.

In the step 7), the culture condition is 25-28 ℃, and the culture is carried out for 8-10 days under the condition that the illumination period is 16h of white light/8 h of darkness.

In order to achieve the above objects, the present invention also provides a product for genetic transformation of rice; said product comprising said induction medium and/or said subculture medium and/or said recovery medium and/or said screening medium and/or said regeneration medium and/or said rooting medium and/or said invasion solution.

Further, the product also comprises YET culture medium.

Further, the YET medium is YET medium containing rifampicin and kanamycin.

The application of the product in rice genetic transformation or preparation of rice genetic transformation products also belongs to the protection scope of the invention.

In the above culture medium or application or method, the rice may be indica rice and/or japonica rice. The indica rice can be C815S, HUAHUAZHAN, GUANGZHAN 63-4S, WUSHANSUIMIAO, YUEJINGSUIMIAO No. 2 or 9311; the japonica rice can be Wuyujing 23, Wuyujing 27, Nipponbare 31 or Ningjing 65B.

The universal tissue culture medium developed by the invention has the following advantages:

1. through the optimized combination of major elements, trace elements, organic matters and hormones, the calluses of japonica rice and indica rice can be induced and seedlings can be regenerated.

2. Through agrobacterium mediation, both japonica rice and indica rice can realize stable transformation.

The invention develops a culture medium for tissue culture of japonica and indica rice by optimized combination of major elements, trace elements, organic matters and hormones, and realizes stable genetic transformation of japonica and indica rice in an agrobacterium-mediated manner.

Drawings

FIG. 1 is a tissue culture induction diagram of indica rice (9311) and japonica rice (japonica 65B).

FIG. 2 is a table diagram showing genetic transformation of indica rice (9311) and japonica rice (japonica 65B).

FIG. 3 shows the result of PCR detection using indica rice (9311) as an example. The PCR detection of the sample was 9311 in each lane.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Indica rice material varieties in the following examples are as follows: huanghuazhan is a product of Hunan nongfeng breed limited company. It accounts for 63-4S (examined and approved in Jiangsu in 2003, and the number is Su examined rice 200303). Wushan seedling (2016 Anhui approved, number: Anhui rice 2016055). Yuejingsi Miao No. 2 (Hainan approval 2010, No.: Qiongju 2010025). 9311 is a product of Jiangsu gold land species industry Co. C815S is described in literature: chenliyun, two-line hybrid rice research: the biological material is available to the applicant in shanghai science and technology press 2012-1-1, and is used only for repeating the relevant experiments of the present invention, and is not used for other purposes.

The japonica rice material varieties in the following examples are as follows: longjing 31 is a product of Heilongjiang Jia Mus reclamation Rui variety. Wuyujing 23 and Wuyujing 27 are products of Jiangsu Zhongjiang species industries, Inc. Japonica 65B is described in literature: zhang Cheng, Chen ya Jun, Wang Xian, Panxiu, Diufen, Shao Guojun, Dian I early flowering round-grained nonglutinous rice three-line sterile line round-grained nonglutinous rice 65A breeding, hybrid rice, 2017, the public can obtain from the applicant, the biomaterial is only used for repeating the relevant experiments of the invention, and can not be used as other purposes. Nipponqing is described in the literature: the establishment and preservation of the suspension cell line of the fine rice in Japan, Yi DeDong, Hubao, was publicly available at the applicant, university of northeast agriculture, 2006, and the biomaterial was only used for repeating the relevant experiments of the present invention, and was not used for other purposes.

The reagents and sources referred to in the following examples are as follows: nitric acidPotassium (Simga-P8291), ammonium sulfate (Simga-A3920), potassium dihydrogen phosphate (Amresco-0781), magnesium sulfate heptahydrate (Simga-M7506), calcium chloride dihydrate (Simga-C7902), manganese sulfate (Simga-M7899), zinc sulfate heptahydrate (Simga-Z0251), boric acid (Simga-B6768), calcium chloride dihydrate (Simga-C7902), potassium iodide (Simga-P8166), copper sulfate pentahydrate (domestic), sodium molybdate dihydrate (domestic), cobalt chloride hexahydrate (domestic), glycine (Simga-G8898), vitamin B1(Simga-T1270), vitamin B6(Simga-P6280), nicotinic acid (Simga-N mgN 0761), inositol (Simga-I7508), ferrous sulfate heptahydrate (Siaa-F8633), disodium ethylenediaminetetraacetate (Na-EDTA (Na)₂EDTA, Sigma-E6635), maltose (Simga-M5885), sucrose (Simga-V900116), glucose (Amresco-0188) sorbitol (Simga-S3889), casein hydrolysate (Simga-C7290), glutamine (Simga-G8540), proline (Simga-P0380), 2,4-D (Simga-D7299), phytol (Phytagel, Simga-P8169), acetosyringone (Simga-D134406), timentin (GOLDBIO COM-T-104), hygromycin (Phytoech-H385), kinetin (GOLDBIO COM K-100-25), 6-benzylaminopurine (Simga-B3408), naphthylacetic acid (Simga-N0640), peptone (Sigma-P5905), yeast extract (Sigma-Y1625), sodium chloride (Sigma-S-M068), kanamycin (GOLDBIO) COM-120-B765-16225), and kanamycin (GOLDBIO-D765 25), Agar (Sigma-A1296).

Example 1A culture Medium suitable for the growth of calli of japonica and indica rice

First, culture medium RC

The invention designs a culture medium suitable for callus growth of japonica rice and indica rice, wherein a basic salt part is named as RC, a solvent of the RC is double distilled water, and solutes and concentrations thereof are respectively as follows: 2300mg/L of potassium nitrate, 380mg/L of ammonium sulfate, 420mg/L of monopotassium phosphate, 175mg/L of magnesium sulfate heptahydrate, 550mg/L of calcium chloride dihydrate, 15mg/L of manganese sulfate, 12mg/L of zinc sulfate heptahydrate, 10mg/L of boric acid, 8mg/L of potassium iodide, 0.05mg/L of copper sulfate pentahydrate, 0.5mg/L of sodium molybdate dihydrate, 0.05mg/L of cobalt chloride hexahydrate, 2.5mg/L of glycine, 11/L of vitamin B11mg, 60.5mg/L of vitamin B, 0.5mg/L of nicotinic acid, 0mg/L of inositol, 42mg/L of ferrous sulfate heptahydrate and 56mg/L of disodium ethylenediamine tetraacetate.

Second, the culture medium is suitable for the growth of the callus of the japonica rice material (Wu Yu Jing 23, Wu Yu Jing 27)

1. Preparation of induction culture medium RC-1 of japonica rice materials (Wu Yu Jing 23, Wu Yu Jing 27): the following components were added to the culture medium RC: sucrose, sorbitol, hydrolyzed casein, glutamine, proline, 2,4-D and vegetable gel, so that the concentrations thereof are respectively: 30g/L of sucrose, 20g/L of sorbitol, 600mg/L of hydrolyzed casein, 600mg/L of glutamine, 800mg/L of proline, 2, 4-D2 mg/L and 3g/L of plant gel to obtain an induction culture medium which is named RC-1. The pH of the induction medium RC-1 was 5.8, and the medium was sterilized at 121 ℃ for 15 minutes for use.

2. Preparation of japonica rice material (Wu Yu Jing 23, Wu Yu Jing 27) subculture medium-1: removing the plant gel in the induction culture medium RC-1 to obtain a subculture medium-1. The pH of the subculture medium-1 was 5.8.

3. Preparation of a japonica rice material (Wu Yu Jing 23, Wu Yu Jing 27) co-culture medium RCO-1: after the induction culture medium RC-1 is sterilized, acetosyringone is added when the culture medium is cooled to 50 ℃ to ensure that the concentration of the acetosyringone is 200uM, and the co-culture medium RCO-1 is obtained. The pH of the co-cultivation medium RCO-1 was 5.4.

4. Preparation of a recovery culture medium REC-1 of japonica rice materials (Wu Yu Jing 23 and Wu Yu Jing 27): after the induction culture medium RC-1 is sterilized, timentin is added when the culture medium is cooled to 50 ℃ so that the concentration of timentin is 300mg/L, and a recovery culture medium REC-1 is obtained. The recovery medium REC-1 had a pH of 5.8.

5. Preparation of a japonica rice material (Wu Yu Jing 23, Wu Yu Jing 27) screening culture medium RSH-1: after the induction medium RC-1 was sterilized, timentin and hygromycin were added when the medium was cooled to 50 ℃ to concentrations: 300mg/L of timentin and 35mg/L of hygromycin to obtain the screening culture medium RSH-1. The pH of the screening medium RSH-1 was 5.8.

6. Preparation of regeneration culture medium RG-1 of japonica rice materials (Wu Yu Jing 23 and Wu Yu Jing 27): removing 2,4-D in the induction culture medium RC-1, sterilizing at 121 ℃ for 15 minutes, and adding timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid when the culture medium is cooled to 50 ℃ so that the concentrations are respectively as follows: 200mg/L of timentin, 1mg/L of kinetin, 1mg/L of 6-benzylaminopurine and 0.2mg/L of naphthylacetic acid to obtain a regeneration culture medium RG-1. The pH of the regeneration medium RG-1 was 5.8.

Thirdly, the culture medium is suitable for the growth of the callus of the japonica rice materials (Nipponbare, Longjing 31 and Japonica 65B)

1. Preparation of induction culture medium RC-2 of japonica rice materials (Nipponbare, Longjing 31 and Japonica 65B): the concentration of each solute in the culture medium RC is adjusted, and the following components are added: sucrose, sorbitol, hydrolyzed casein, glutamine, proline, 2,4-D and plant gel to obtain an induction medium named RC-2. The concentrations of solutes in callus induction medium RC-2 were as follows: 2650mg/L potassium nitrate, 490mg/L ammonium sulfate, 210mg/L potassium dihydrogen phosphate, 447.5mg/L magnesium sulfate heptahydrate, 270mg/L calcium chloride dihydrate, 30mg/L manganese sulfate, 6mg/L zinc sulfate heptahydrate, 5mg/L boric acid, 4mg/L potassium iodide, 0.025mg/L copper sulfate pentahydrate, 0.25mg/L sodium molybdate dihydrate, 0.025mg/L cobalt chloride hexahydrate, 1.2mg/L glycine, 11.2mg/L vitamin B, 61mg/L vitamin B, 1mg/L nicotinic acid, 100mg/L inositol, 28mg/L ferrous sulfate heptahydrate, 37mg/L disodium ethylenediaminetetraacetate, 30g/L sucrose, 10g/L sorbitol, 500mg/L casein hydrolysate, 500mg/L glutamine, 500mg/L proline, 2, 4-D1.5 mg/L and plant gel 3 g/L. The pH of the induction medium RC-2 was 5.8, and the medium was sterilized at 121 ℃ for 15 minutes for use.

2. Preparation of japonica rice material (Nipponbare, Longjing 31 and Japonica 65B) subculture medium-2: removing the plant gel in the induction culture medium RC-2 to obtain a subculture medium-2. The pH of the subculture medium-2 was 5.8.

3. Preparation of a japonica rice material (Nipponbare, Longjing 31 and Japonica 65B) co-culture medium RCO-2: after the induction culture medium RC-2 is sterilized, acetosyringone is added when the culture medium is cooled to 50 ℃ to ensure that the concentration of the acetosyringone is 200uM, and the co-culture medium RCO-2 is obtained. The pH of the co-cultivation medium RCO-2 was 5.4.

4. Preparation of a recovery culture medium REC-2 of japonica rice materials (Nipponbare, Longjing 31 and Japonica 65B): after the induction culture medium RC-2 is sterilized, timentin is added when the culture medium is cooled to 50 ℃ so that the concentration of timentin is 300mg/L, and a recovery culture medium REC-2 is obtained. The recovery medium REC-2 had a pH of 5.8.

5. Preparation of a japonica rice material (Nipponbare, Longjing 31 and Japonica 65B) screening culture medium RSH-2: after the induction medium RC-2 was sterilized, timentin and hygromycin were added when the medium was cooled to 50 ℃ to concentrations: 300mg/L of timentin and 65mg/L of hygromycin to obtain the screening culture medium RSH-2. The pH of the screening medium RSH-2 was 5.8.

6. Preparation of a regeneration culture medium RG-2 of japonica rice materials (Nipponbare, Longjing 31 and Japonica 65B): removing 2,4-D in the induction culture medium RC-2, sterilizing at 121 ℃ for 15 minutes, and adding timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid when the culture medium is cooled to 50 ℃ so that the concentrations are respectively as follows: 200mg/L of timentin, 1mg/L of kinetin, 1.5mg/L of 6-benzylaminopurine and 0.3mg/L of naphthylacetic acid to obtain a regeneration culture medium RG-2. The pH of the regeneration medium RG-2 was 5.8.

Fourthly, the culture medium is suitable for the growth of the calluses of the indica rice material (C815s, Huazhan)

1. Preparation of indica rice material (C815s, HUANGHUAZHAN) induction culture medium RC-3: the concentration of potassium nitrate in the culture medium RC is adjusted to 2750mg/L, and the following components are added: maltose, sorbitol, hydrolyzed casein, glutamine, proline, 2,4-D and vegetable gel, so that the concentrations are: 30g/L of maltose, 10g/L of sorbitol, 500mg/L of hydrolyzed casein, 600mg/L of glutamine, 800mg/L of proline, 2, 4-D2 mg/L and 3g/L of plant gel to obtain an induction medium which is named RC-3. The pH of the induction medium RC-3 was 5.8, and the medium was sterilized at 121 ℃ for 15 minutes for use.

2. Preparation of indica rice material (C815s, Huanghuazhan) subculture medium-3: removing the plant gel in the induction culture medium RC-3 to obtain a subculture medium-3. The pH of the subculture medium-3 was 5.8.

3. Preparation of indica rice material (C815s, Huanghuazhan) co-culture medium RCO-3: after the induction culture medium RC-3 is sterilized, acetosyringone is added when the culture medium is cooled to 50 ℃ to ensure that the concentration of the acetosyringone is 200uM, and the co-culture medium RCO-3 is obtained. The pH of the co-cultivation medium RCO-3 was 5.4.

4. Preparation of indica rice material (C815s, Huanghuazhan) recovery medium REC-3: after the induction culture medium RC-3 is sterilized, timentin is added when the culture medium is cooled to 50 ℃ so that the concentration of timentin is 200mg/L, and a recovery culture medium REC-3 is obtained. The recovery medium REC-3 had a pH of 5.8.

5. Preparation of indica rice material (C815s, Huanghuazhan) screening medium RSH-3: after the induction medium RC-3 was sterilized, timentin and hygromycin were added when the medium was cooled to 50 ℃ to concentrations: 200mg/L of timentin and 50mg/L of hygromycin to obtain a screening culture medium RSH-3. The pH of the screening medium RSH-3 was 5.8.

6. Preparation of regeneration medium RG-3 of indica rice material (C815s, HUANGHUAZHAN): removing 2,4-D in the induction culture medium RC-3, sterilizing at 121 ℃ for 15 minutes, and adding timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid when the culture medium is cooled to 50 ℃ so that the concentrations are respectively as follows: 200mg/L of timentin, 0.5mg/L of kinetin, 2mg/L of 6-benzylaminopurine and 0.3mg/L of naphthylacetic acid to obtain a regeneration culture medium RG-3. The pH of the regeneration medium RG-3 was 5.8.

Culture medium suitable for growth of calluses of indica rice materials (Guangzhan 63-4S, Wushan Miao, Yuejingmiao No. 2 and 9311)

1. Preparation of indica rice material (Guangzhansi Miao, Wushan Miao, Yuejingsi Miao No. 2, 9311) induction culture medium: adjusting the potassium nitrate concentration in the culture medium RC to be 2850mg/L, the boric acid concentration to be 15mg/L, the manganese sulfate concentration to be 23mg/L, the potassium iodide concentration to be 6mg/L, the copper sulfate pentahydrate concentration to be 0.03mg/L, the sodium molybdate dihydrate concentration to be 0.3mg/L, the cobalt chloride hexahydrate concentration to be 0.03mg/L, the ferrous sulfate heptahydrate concentration to be 55mg/L and the disodium ethylenediamine tetraacetate concentration to be 74.5mg/L, and adding maltose, sorbitol, hydrolyzed casein, glutamine, proline, 2,4-D and plant gel to ensure that the concentrations are respectively: 30g/L of maltose, 10g/L of sorbitol, 800mg/L of hydrolyzed casein, 800mg/L of glutamine, 800mg/L of proline, 1.5mg/L of 2,4-D and 3g/L of plant gel to obtain an induction medium which is named as RC-4. The pH of the induction medium RC-4 was 5.8, and the medium was sterilized at 121 ℃ for 15 minutes for use.

2. Preparation of a subculture medium-4 of indica rice materials (Guangzhan 63-4S, Wushan Miao, Yuejingmiao No. 2 and 9311): removing the plant gel in the induction culture medium RC-4 to obtain a subculture medium-4. The pH of the subculture medium-4 was 5.8.

3. Preparation of indica rice material (Guangzhansi Miao, Wushan Miao, Yuejingsi Miao No. 2, 9311) co-culture medium RCO-4: after the induction culture medium RC-4 is sterilized, acetosyringone is added when the culture medium is cooled to 50 ℃ to ensure that the concentration of the acetosyringone is 200uM, and the co-culture medium RCO-4 is obtained. The pH of the co-cultivation medium RCO-4 was 5.4.

4. Preparation of recovery culture medium REC-4 of indica rice material (Guangzhan 63-4S, Wushan Miao, Yuejingmiao No. 2, 9311): after the induction culture medium RC-4 is sterilized, timentin is added when the culture medium is cooled to 50 ℃ so that the concentration of timentin is 200mg/L, and a recovery culture medium REC-4 is obtained. The recovery medium REC-4 had a pH of 5.8.

5. Preparation of screening culture medium RSH-4 of indica rice material (Guangzhan 63-4S, Wushan Miao, Yuejingmiao No. 2, 9311): after the induction medium RC-4 medium was sterilized, timentin and hygromycin were added when the medium was cooled to 50 ℃ to concentrations of: 200mg/L of timentin and 45mg/L of hygromycin to obtain a screening culture medium RSH-4. The pH of the screening medium RSH-4 was 5.8.

6. Preparation of regeneration culture medium RG-4 of indica rice material (Guangzhan 63-4S, Wushan Miao, Yuejingmiao No. 2, 9311): removing 2,4-D in the induction culture medium RC-4, sterilizing at 121 ℃ for 15 minutes, and adding timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid when the culture medium is cooled to 50 ℃ so that the concentrations are respectively as follows: 200mg/L of timentin, 0.5mg/L of kinetin, 2mg/L of 6-benzylaminopurine and 0.2mg/L of naphthylacetic acid to obtain a regeneration culture medium RG-4. The pH of the regeneration medium RG-4 was 5.8.

Rooting culture medium for materials of six, japonica rice and indica rice

The rooting culture medium of japonica rice and indica rice materials is named as RT: adding sucrose, naphthylacetic acid and plant gel on the basis of 1/2 culture medium RC to make the concentrations respectively as follows: 15g/L of sucrose, 0.1mg/L of naphthylacetic acid and 3g/L of plant gel to obtain a rooting culture medium RT. The pH value of the rooting medium RT is 5.8, and the rooting medium RT is sterilized for 15 minutes at 121 ℃ for later use.

Seven, infection liquid

The infection liquid of japonica rice and indica rice materials is named as RIn: hydrolyzed casein, proline, sucrose and glucose were added to the culture medium RC to make the concentrations thereof respectively: hydrolyzing casein 300mg/L, proline 300mg/L, sucrose 20g/L and glucose 10g/L to obtain an infection liquid RIn. The pH of the staining solution RIn was 5.2. Sterilizing at 121 ℃ for 15 minutes for later use.

Eight, agrobacterium activating culture medium

The agrobacterium activating culture medium is YET culture medium, which is composed of solvent and solute, the solvent is double distilled water, the solute and its concentration are: yeast extract 5g/L, peptone 10g/L, sodium chloride 5g/L, agar 15g/L, 121 ℃ sterilization for 15 minutes, when the medium is cooled to 50 ℃ adding rifampicin and kanamycin, respectively to make their concentrations: rifampicin 25mg/L, kanamycin 50 mg/L. YET the pH of the medium was 7.

Example 2 Agrobacterium-mediated genetic transformation of Rice (indica, japonica)

Respectively taking japonica rice materials: wu Yu Jing 23, Nipponbare, Longjing 31 and Jing 65B; indica rice material: C815S, Huanghuazhan, Guangzhan 63-4S, Wushan Miao, Yuejingmiao No. 2 and 9311 were used as the test seed material, and the transgenic rice was prepared by genetic transformation using the culture medium corresponding to each material in example 1. The method comprises the following specific steps:

preparation of transgenic Rice

First, callus induction culture

1. Sterilization of seeds

Removing hull from mature rice seed, soaking in 75% (volume fraction) ethanol solution for sterilization for 1min, soaking in sodium hypochlorite solution with effective chlorine of 2% for sterilization for 20-30min, and washing with sterilized water for 3-5 times to obtain sterilized seed.

2. Callus induction

And (3) drying the sterilized seeds obtained in the step (1) in an ultra-clean workbench, inoculating the seeds to a callus induction culture medium, placing 12-16 seeds in each dish, and culturing for 16-24 days in a dark room at the temperature of 32-35 ℃. Calculating the efficiency of inducing different varieties to generate embryogenic callus according to the following formula: successful induced derivative/effective seed number. The statistical results of the induction efficiencies of the different varieties are shown in table 1.

TABLE 1 efficiency of embryogenic callus induction for different varieties

Second, subculture

And (3) selecting 15-20 blocks of the yellow callus particles with hard texture and glossy feeling obtained in the first step, inoculating the blocks into a triangular flask (the volume of the triangular flask is 200mL) containing 75mL of subculture medium, and harvesting for infection after dark culture for 7-10 days at the temperature of 28 ℃ at 120 rpm.

Third, agroinfection

1. Preparation of Agrobacterium

1) Preparation of recombinant vectors

The pr35s, RFP, T35s// prZmUbi-01, HPT, tNos fragment shown in the 131 nd-4846 of the sequence 1 are inserted into the T-DNA region of the modified pCAMBIA3301 vector to obtain a recombinant vector pG 0051. The nucleotide sequence of the recombinant vector pG0051 is shown in sequence 1.

2) Preparation of recombinant Agrobacterium

Introducing the pG0051 vector prepared in the step 1) into Agrobacterium EHA105(EHA105 is a product of Shanghai-Wei-Biotechnology Limited, CAT #: AC1010), and identifying to obtain the EHA105 Agrobacterium containing the pG0051 vector. EHA105 Agrobacterium containing pG0051 vector was streaked on YET medium containing 50ug/ml kanamycin and 25ug/ml rifampicin and cultured in the dark at 28 ℃ for 36-48 hours.

2. Preparation of Agrobacterium Reptile solution

Scraping the agrobacterium on the agrobacterium plate in the step 1 into the infection liquid RIn added with acetosyringone (final concentration is 100uM), shaking and mixing uniformly to obtain OD₆₆₀The suspension is 0.1-0.2 Agrobacterium tumefaciens resuspension.

3. Infection by infection

And (4) transferring the callus collected in the step two into a sterilization tube containing the agrobacterium tumefaciens resuspension, and soaking for 10-15min at room temperature.

Four, co-culture and recovery culture

And (3) collecting the callus immersed in the agrobacterium tumefaciens suspension in the third step into an aseptic empty dish (6-8 layers of sterilized filter paper are paved in the dish), placing the aseptic dish on a clean bench for airing, wherein the filter paper can be replaced once during airing, and the callus is not adhered to each other when the filter paper is not soaked rapidly and the dish is shaken. Then dispersing the callus particles in a co-culture medium paved with sterile filter paper, and culturing in the dark at 19-21 ℃ for 1-2 days. Transferring to a recovery medium for 3 days and transferring to a screening medium if the callus surface has brown spots after dark culture, and directly transferring to the screening medium if the callus surface has no brown spots.

Screening and culturing

And (3) uniformly placing the callus obtained in the fourth step on a screening culture medium, carrying out dark culture on the callus at the temperature of 30 ℃ for 18-24 days, and thus obtaining the resistant callus. The cure rates of different varieties are calculated according to the following formula: total number of calli surviving HPT selection/number of calli selected. The statistical results of the cure resistance are shown in Table 2.

Sixth, regeneration culture

Transferring the resistance callus obtained by screening in the fifth step to a regeneration culture medium, placing 5-7 callus grains on each dish, culturing for 15-25 days at 25-28 ℃ under illumination (the illumination period is 16 h/8 h in the dark) and then transferring to a rooting culture medium for rooting culture. The regeneration rate (regeneration emergence efficiency) of different varieties is calculated according to the following formula: total number of calli that could emerge/total number of regeneration initiation calli. The regeneration rate statistics are shown in table 2.

Seventhly, rooting culture

Transferring the seedlings differentiated from each clone to a rooting tank containing a rooting culture medium, placing 3-5 seedlings in each tank, and culturing for 8-10 days at 25-28 ℃ under illumination (the illumination period is 16 h/8 h in darkness) to obtain transgenic rice.

(II) identification of transgenic Rice

Extracting DNA of transgenic rice leaves, adopting a primer F: gcatcaggtcggagacgctgtcgaac and primer R: gagatgctttttgttcgcttgg, PCR amplification is carried out, and the transgenic rice with the size of 535bp obtained by the PCR amplification is positive transgenic rice. And calculating the regeneration positive rate and the transformation efficiency of different varieties. The regeneration positive rate is the total number of HPT positive seedlings/total number of regeneration seedlings detected by PCR, and the transformation efficiency is the cure resistance rate multiplied by the regeneration positive rate. The partial PCR assay results of 9311 transformation positive T0 seedlings are shown in FIG. 3.

TABLE 2 Agrobacterium transformation efficiencies of different varieties

Variety of (IV) C	Screening callus number	Rate of resistance to healing	Regeneration rate	Positive rate of regeneration	Conversion efficiency
						Huanghuazhan (Long-shaped)	280	21％	46％	98％	9.5％
C815s (indica)	280	38％	64％	92％	22.4％
						9311 (Long-shaped)	280	24％	63％	100％	15％
Guangzhan 63-4S (indica)	280	12％	29％	100％	3.5％
						Wushan Miao (Long shaped)	280	16％	49％	100％	7.8％
Yuejingsi Miao No. 2 (Long-shaped)	280	18％	45％	100％	8.1％
						Dragon and round-grained rice 31 (round-grained rice)	280	22％	42％	100％	9.3％
Nipponbare (japonica)	280	49％	50％	96％	23.5％
						Japonica rice 65B (Japonica)	280	30％	38％	100％	11.4％
Wu Yu Jing 23 (round-grained)	280	9％	31％	100％	2.79％

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> agriculture and forestry academy of sciences of Beijing City

<120> agrobacterium tumefaciens-mediated rice genetic transformation method

<160>1

<170>PatentIn version 3.5

<210>1

<211>11252

<212>DNA

<213>Artificial Sequence

<400>1

ggtggcagga tatattgtgg tgtaaacatg gcactagcct caccgtcttc gcagacgagg 60

ccgctaagtc gcagctacgc tctcaacggc actgactagg tagtttaaac gtgcacttaa 120

ttaaggtacc ccactggatt ttggttttag gaattagaaa ttttattgat agaagtattt 180

tacaaataca aatacatact aagggtttct tatatgctca acacatgagc gaaaccctat 240

aagaacccta attcccttat ctgggaacta ctcacacatt attatagaga gagatagatt 300

tgtagagaga gactggtgat ttcagctaca ggaacaggtg gtggcggccc tcggtgcgct 360

cgtactgctc cacgatggtg tagtcctcgt tgtgggaggt gatgtccagc ttggcgtcca 420

cgtagtagta gccgggcagc tgcacgggct tcttggccat gtagatagac ttgaactcca 480

ccaggtagtg gccgccgtcc ttcagcttca gggccttgtg ggtttcgccc ttcagcacgc 540

cgtcgcgggg gtacaggcgc tcggtggagg cctcccagcc catggtcttc ttctgcatca 600

cggggccgtc ggaggggaag ttcacgccga tgaacttcac cttgtagatg aagcagccgt 660

cctggaggga ggagtcctgg gtcacggtcg ccacgccgcc gtcctcgaag ttcatcacgc 720

gctcccactt gaagccctcg gggaaggaca gcttcttgta gtcggggatg tcggcggggt 780

gcttcacgta caccttggag ccgtactgga actgggggga caggatgtcc caggcgaagg 840

gcagggggcc gcccttcgtc accttcagct tcacggtgtt gtggccctcg taggggcggc 900

cctcgccctc gccctcgatc tcgaactcgt ggccgttcac ggtgccctcc atgcgcacct 960

tgaagcgcat gaactcggtg atgacgttct cggaggaggc catggatcct gtcctctcca 1020

aatgaaatga acttccttat atagaggaag ggtcttgcga aggatagtgg gattgtgcgt 1080

catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac gtggttggaa 1140

cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga ccactgtcgg 1200

cagaggcatc ttcaacgatg gcctttcctt tatcgcaatg atggcatttg taggagccac 1260

cttccttttc cactatcttc acaataaagt gacagatagc tgggcaatgg aatccgagga 1320

ggtttccgga tattaccctt tgttgaaaag tctcaattgc cctttggtct tctgagactg 1380

tatctttgat atttttggag tagacaagcg tgtcgtgctc caccatgttg acgaagattt 1440

tcttcttgtc attgagtcgt aagagactct gtatgaactg ttcgccagtc tttacggcga 1500

gttctgttag gtcctctatt tgaatctttg actccatggg gcgcctgtcc gggcgcgcct 1560

ggtggatcgt ccgcctaggc tgcagtgcag cgtgacccgg tcgtgcccct ctctagagat 1620

aatgagcatt gcatgtctaa gttataaaaa attaccacat attttttttg tcacacttgt 1680

ttgaagtgca gtttatctat ctttatacat atatttaaac tttactctac gaataatata 1740

atctatagta ctacaataat atcagtgttt tagagaatca tataaatgaa cagttagaca 1800

tggtctaaag gacaattgag tattttgaca acaggactct acagttttat ctttttagtg 1860

tgcatgtgtt ctcctttttt tttgcaaata gcttcaccta tataatactt catccatttt 1920

attagtacat ccatttaggg tttagggtta atggttttta tagactaatt tttttagtac 1980

atctatttta ttctatttta gcctctaaat taagaaaact aaaactctat tttagttttt 2040

ttatttaata atttagatat aaaatagaat aaaataaagt gactaaaaat taaacaaata 2100

ccctttaaga aattaaaaaa actaaggaaa catttttctt gtttcgagta gataatgcca 2160

gcctgttaaa cgccgtcgac gagtctaacg gacaccaacc agcgaaccag cagcgtcgcg 2220

tcgggccaag cgaagcagac ggcacggcat ctctgtcgct gcctctggac ccctctcgag 2280

agttccgctc caccgttgga cttgctccgc tgtcggcatc cagaaattgc gtggcggagc 2340

ggcagacgtg agccggcacg gcaggcggcc tcctcctcct ctcacggcac cggcagctac 2400

gggggattcc tttcccaccg ctccttcgct ttcccttcct cgcccgccgt aataaataga 2460

caccccctcc acaccctctt tccccaacct cgtgttgttc ggagcgcaca cacacacaac 2520

cagatctccc ccaaatccac ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc 2580

cccccccccc ctctctacct tctctagatc ggcgttccgg tccatggtta gggcccggta 2640

gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg tgctgctagc 2700

gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact tgccagtgtt 2760

tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg atttcatgat 2820

tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca atatatgccg 2880

tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt gatgatgtgg 2940

tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac ctggtggatt 3000

tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa ttgaagatga 3060

tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta ctgatgcata 3120

tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg cggtcgttca 3180

ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta ttaattttgg 3240

aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat ggaaatatcg 3300

atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat gatggcatat 3360

gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa acaagtatgt 3420

tttataatta ttttgatctt gatatacttg gatgatggca tatgcagcag ctatatgtgg 3480

atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc ttttgtcgat 3540

gctcaccctg ttgtttggtg ttacttctgc aggagctcat gaaaaagcct gaactcaccg 3600

cgacgtctgt cgagaagttt ctgatcgaaa agttcgacag cgtctccgac ctgatgcagc 3660

tctcggaggg cgaagaatct cgtgctttca gcttcgatgt aggagggcgt ggatatgtcc 3720

tgcgggtaaa tagctgcgcc gatggtttct acaaagatcg ttatgtttat cggcactttg 3780

catcggccgc gctcccgatt ccggaagtgc ttgacattgg ggagtttagc gagagcctga 3840

cctattgcat ctcccgccgt tcacagggtg tcacgttgca agacctgcct gaaaccgaac 3900

tgcccgctgt tctacaaccg gtcgcggagg ctatggatgc gatcgctgcg gccgatctta 3960

gccagacgag cgggttcggc ccattcggac cgcaaggaat cggtcaatac actacatggc 4020

gtgatttcat atgcgcgatt gctgatcccc atgtgtatca ctggcaaact gtgatggacg 4080

acaccgtcag tgcgtccgtc gcgcaggctc tcgatgagct gatgctttgg gccgaggact 4140

gccccgaagt ccggcacctc gtgcacgcgg atttcggctc caacaatgtc ctgacggaca 4200

atggccgcat aacagcggtc attgactgga gcgaggcgat gttcggggat tcccaatacg 4260

aggtcgccaa catcttcttc tggaggccgt ggttggcttg tatggagcag cagacgcgct 4320

acttcgagcg gaggcatccg gagcttgcag gatcgccacg actccgggcg tatatgctcc 4380

gcattggtct tgaccaactc tatcagagct tggttgacgg caatttcgat gatgcagctt 4440

gggcgcaggg tcgatgcgac gcaatcgtcc gatccggagc cgggactgtc gggcgtacac 4500

aaatcgcccg cagaagcgcg gccgtctgga ccgatggctg tgtagaagta ctcgccgata 4560

gtggaaaccg acgccccagc actcgtccga gggcaaagaa atagagtaga tgccgaccgg 4620

gatctgtcga tcgacaagct cgagtttctc cataataatg tgtgagtagt tcccagataa 4680

gggaattagg gttcctatag ggtttcgctc atgtgttgag catataagaa acccttagta 4740

tgtatttgta tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc 4800

cagtactaaa atccagatcc cccgaattaa ttcggcgtta attcagcctg caggacgcgt 4860

ttaattaagt gcacgcggcc gcctacttag tcaagagcct cgcacgcgac tgtcacgcgg 4920

ccaggatcgc ctcgtgagcc tcgcaatctg tacctagtgt ttaaactatc agtgtttgac 4980

aggatatatt ggcgggtaaa cctaagagaa aagagcgttt attagaataa cggatattta 5040

aaagggcgtg aaaaggttta tccgttcgtc catttgtatg tgcatgccaa ccacagggtt 5100

cccctcggga tcaaagtact ttgatccaac ccctccgctg ctatagtgca gtcggcttct 5160

gacgttcagt gcagccgtct tctgaaaacg acatgtcgca caagtcctaa gttacgcgac 5220

aggctgccgc cctgcccttt tcctggcgtt ttcttgtcgc gtgttttagt cgcataaagt 5280

agaatacttg cgactagaac cggagacatt acgccatgaa caagagcgcc gccgctggcc 5340

tgctgggcta tgcccgcgtc agcaccgacg accaggactt gaccaaccaa cgggccgaac 5400

tgcacgcggc cggctgcacc aagctgtttt ccgagaagat caccggcacc aggcgcgacc 5460

gcccggagct ggccaggatg cttgaccacc tacgccctgg cgacgttgtg acagtgacca 5520

ggctagaccg cctggcccgc agcacccgcg acctactgga cattgccgag cgcatccagg 5580

aggccggcgc gggcctgcgt agcctggcag agccgtgggc cgacaccacc acgccggccg 5640

gccgcatggt gttgaccgtg ttcgccggca ttgccgagtt cgagcgttcc ctaatcatcg 5700

accgcacccg gagcgggcgc gaggccgcca aggcccgagg cgtgaagttt ggcccccgcc 5760

ctaccctcac cccggcacag atcgcgcacg cccgcgagct gatcgaccag gaaggccgca 5820

ccgtgaaaga ggcggctgca ctgcttggcg tgcatcgctc gaccctgtac cgcgcacttg 5880

agcgcagcga ggaagtgacg cccaccgagg ccaggcggcg cggtgccttc cgtgaggacg 5940

cattgaccga ggccgacgcc ctggcggccg ccgagaatga acgccaagag gaacaagcat 6000

gaaaccgcac caggacggcc aggacgaacc gtttttcatt accgaagaga tcgaggcgga 6060

gatgatcgcg gccgggtacg tgttcgagcc gcccgcgcac gtctcaaccg tgcggctgca 6120

tgaaatcctg gccggtttgt ctgatgccaa gctggcggcc tggccggcca gcttggccgc 6180

tgaagaaacc gagcgccgcc gtctaaaaag gtgatgtgta tttgagtaaa acagcttgcg 6240

tcatgcggtc gctgcgtata tgatgcgatg agtaaataaa caaatacgca aggggaacgc 6300

atgaaggtta tcgctgtact taaccagaaa ggcgggtcag gcaagacgac catcgcaacc 6360

catctagccc gcgccctgca actcgccggg gccgatgttc tgttagtcga ttccgatccc 6420

cagggcagtg cccgcgattg ggcggccgtg cgggaagatc aaccgctaac cgttgtcggc 6480

atcgaccgcc cgacgattga ccgcgacgtg aaggccatcg gccggcgcga cttcgtagtg 6540

atcgacggag cgccccaggc ggcggacttg gctgtgtccg cgatcaaggc agccgacttc 6600

gtgctgattc cggtgcagcc aagcccttac gacatatggg ccaccgccga cctggtggag 6660

ctggttaagc agcgcattga ggtcacggat ggaaggctac aagcggcctt tgtcgtgtcg 6720

cgggcgatca aaggcacgcg catcggcggt gaggttgccg aggcgctggc cgggtacgag 6780

ctgcccattc ttgagtcccg tatcacgcag cgcgtgagct acccaggcac tgccgccgcc 6840

ggcacaaccg ttcttgaatc agaacccgag ggcgacgctg cccgcgaggt ccaggcgctg 6900

gccgctgaaa ttaaatcaaa actcatttga gttaatgagg taaagagaaa atgagcaaaa 6960

gcacaaacac gctaagtgcc ggccgtccga gcgcacgcag cagcaaggct gcaacgttgg 7020

ccagcctggc agacacgcca gccatgaagc gggtcaactt tcagttgccg gcggaggatc 7080

acaccaagct gaagatgtac gcggtacgcc aaggcaagac cattaccgag ctgctatctg 7140

aatacatcgc gcagctacca gagtaaatga gcaaatgaat aaatgagtag atgaatttta 7200

gcggctaaag gaggcggcat ggaaaatcaa gaacaaccag gcaccgacgc cgtggaatgc 7260

cccatgtgtg gaggaacggg cggttggcca ggcgtaagcg gctgggttgt ctgccggccc 7320

tgcaatggca ctggaacccc caagcccgag gaatcggcgt gacggtcgca aaccatccgg 7380

cccggtacaa atcggcgcgg cgctgggtga tgacctggtg gagaagttga aggccgcgca 7440

ggccgcccag cggcaacgca tcgaggcaga agcacgcccc ggtgaatcgt ggcaagcggc 7500

cgctgatcga atccgcaaag aatcccggca accgccggca gccggtgcgc cgtcgattag 7560

gaagccgccc aagggcgacg agcaaccaga ttttttcgtt ccgatgctct atgacgtggg 7620

cacccgcgat agtcgcagca tcatggacgt ggccgttttc cgtctgtcga agcgtgaccg 7680

acgagctggc gaggtgatcc gctacgagct tccagacggg cacgtagagg tttccgcagg 7740

gccggccggc atggccagtg tgtgggatta cgacctggta ctgatggcgg tttcccatct 7800

aaccgaatcc atgaaccgat accgggaagg gaagggagac aagcccggcc gcgtgttccg 7860

tccacacgtt gcggacgtac tcaagttctg ccggcgagcc gatggcggaa agcagaaaga 7920

cgacctggta gaaacctgca ttcggttaaa caccacgcac gttgccatgc agcgtacgaa 7980

gaaggccaag aacggccgcc tggtgacggt atccgagggt gaagccttga ttagccgcta 8040

caagatcgta aagagcgaaa ccgggcggcc ggagtacatc gagatcgagc tagctgattg 8100

gatgtaccgc gagatcacag aaggcaagaa cccggacgtg ctgacggttc accccgatta 8160

ctttttgatc gatcccggca tcggccgttt tctctaccgc ctggcacgcc gcgccgcagg 8220

caaggcagaa gccagatggt tgttcaagac gatctacgaa cgcagtggca gcgccggaga 8280

gttcaagaag ttctgtttca ccgtgcgcaa gctgatcggg tcaaatgacc tgccggagta 8340

cgatttgaag gaggaggcgg ggcaggctgg cccgatccta gtcatgcgct accgcaacct 8400

gatcgagggc gaagcatccg ccggttccta atgtacggag cagatgctag ggcaaattgc 8460

cctagcaggg gaaaaaggtc gaaaaggtct ctttcctgtg gatagcacgt acattgggaa 8520

cccaaagccg tacattggga accggaaccc gtacattggg aacccaaagc cgtacattgg 8580

gaaccggtca cacatgtaag tgactgatat aaaagagaaa aaaggcgatt tttccgccta 8640

aaactcttta aaacttatta aaactcttaa aacccgcctg gcctgtgcat aactgtctgg 8700

ccagcgcaca gccgaagagc tgcaaaaagc gcctaccctt cggtcgctgc gctccctacg 8760

ccccgccgct tcgcgtcggc ctatcgcggc cgctggccgc tcaaaaatgg ctggcctacg 8820

gccaggcaat ctaccagggc gcggacaagc cgcgccgtcg ccactcgacc gccggcgccc 8880

acatcaaggc accctgcctc gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc 8940

agctcccgga gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc 9000

agggcgcgtc agcgggtgtt ggcgggtgtc ggggcgcagc catgacccag tcacgtagcg 9060

atagcggagt gtatactggc ttaactatgc ggcatcagag cagattgtac tgagagtgca 9120

ccatatgcgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggcgctc 9180

ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc 9240

agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa 9300

catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt 9360

tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg 9420

gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg 9480

ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag 9540

cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc 9600

caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa 9660

ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg 9720

taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc 9780

taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac 9840

cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg 9900

tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt 9960

gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt 10020

catgcattct aggtactaaa acaattcatc cagtaaaata taatatttta ttttctccca 10080

atcaggcttg atccccagta agtcaaaaaa tagctcgaca tactgttctt ccccgatatc 10140

ctccctgatc gaccggacgc agaaggcaat gtcataccac ttgtccgccc tgccgcttct 10200

cccaagatca ataaagccac ttactttgcc atctttcaca aagatgttgc tgtctcccag 10260

gtcgccgtgg gaaaagacaa gttcctcttc gggcttttcc gtctttaaaa aatcatacag 10320

ctcgcgcgga tctttaaatg gagtgtcttc ttcccagttt tcgcaatcca catcggccag 10380

atcgttattc agtaagtaat ccaattcggc taagcggctg tctaagctat tcgtataggg 10440

acaatccgat atgtcgatgg agtgaaagag cctgatgcac tccgcataca gctcgataat 10500

cttttcaggg ctttgttcat cttcatactc ttccgagcaa aggacgccat cggcctcact 10560

catgagcaga ttgctccagc catcatgccg ttcaaagtgc aggacctttg gaacaggcag 10620

ctttccttcc agccatagca tcatgtcctt ttcccgttcc acatcatagg tggtcccttt 10680

ataccggctg tccgtcattt ttaaatatag gttttcattt tctcccacca gcttatatac 10740

cttagcagga gacattcctt ccgtatcttt tacgcagcgg tatttttcga tcagtttttt 10800

caattccggt gatattctca ttttagccat ttattatttc cttcctcttt tctacagtat 10860

ttaaagatac cccaagaagc taattataac aagacgaact ccaattcact gttccttgca 10920

ttctaaaacc ttaaatacca gaaaacagct ttttcaaagt tgttttcaaa gttggcgtat 10980

aacatagtat cgacggagcc gattttgaaa ccgcggtgat cacaggcagc aacgctctgt 11040

catcgttaca atcaacatgc taccctccgc gagatcatcc gtgtttcaaa cccggcagct 11100

tagttgccgt tcttccgaat agcatcggta acatgagcaa agtctgccgc cttacaacgg 11160

ctctcccgct gacgccgtcc cggactgatg ggctgcctgt atcgagtggt gattttgtgc 11220

cgagctgccg gtcggggagc tgttggctgg ct 11252

Claims (3)

1. A genetic transformation method of rice, comprising the steps of:

1) culturing rice seeds in an induction culture medium to obtain callus after induction culture;

2) culturing the callus after induction culture in a subculture medium to obtain the callus after subculture;

3) infecting the callus after subculture in agrobacterium tumefaciens resuspension to obtain infected callus;

the agrobacterium tumefaciens resuspension is obtained by oscillating and uniformly mixing agrobacterium tumefaciens containing a target gene expression vector in an infection liquid containing acetosyringone; the staining solution is obtained by uniformly mixing a culture medium, hydrolyzed casein, proline, sucrose and glucose;

4) sucking up infection liquid on the surface of the infected callus, dispersing callus particles in a co-culture medium paved with sterile filter paper, carrying out dark culture at 19-21 ℃ for 1-2 days, transferring the callus particles to a recovery medium for 3 days if the callus particles have brown spots on the surface after dark culture, and transferring the callus particles to a screening medium if the callus particles have no brown spots on the surface;

5) culturing the callus without brown spots on the surface in a screening culture medium to obtain resistant callus;

6) culturing the resistant callus in a regeneration culture medium until the resistant callus grows green leaves to obtain rice seedlings;

7) culturing the rice seedlings in a rooting culture medium to obtain transgenic rice plants;

the induction culture medium is obtained by uniformly mixing the subculture medium and the plant gel; the concentration of the plant gel in the induction medium is 3 g/L;

the subculture medium is obtained by uniformly mixing a culture medium with maltose, sorbitol, hydrolyzed casein, glutamine, proline and 2, 4-D; the concentration of the maltose in the subculture medium is 30 g/L; the concentration of the sorbitol in the subculture medium is 10 g/L; the concentration of the hydrolyzed casein in the subculture medium is 500-800 mg/L; the concentration of the glutamine in the secondary culture medium is 600-800 mg/L; the concentration of the proline in the subculture medium is 800 mg/L; the concentration of the 2,4-D in the subculture medium is 1.5-2 mg/L;

the co-culture medium is prepared by sterilizing an induction medium, and adding acetosyringone when the culture medium is cooled to 50 ℃ to ensure that the concentration of the acetosyringone is 200 uM;

after the recovery culture medium is an induction culture medium and is sterilized, adding timentin when the culture medium is cooled to 50 ℃ to ensure that the concentration of timentin is 200 mg/L;

the screening culture medium is obtained by uniformly mixing the induction culture medium, timentin and a screening agent; the concentration of the timentin in the screening medium is 200 mg/L; the concentration of the screening agent in the screening culture medium is 45-50 mg/L; the screening agent is hygromycin;

the regeneration culture medium is obtained by removing 2,4-D in the induction culture medium and then uniformly mixing with timentin, kinetin, 6-benzylaminopurine and naphthylacetic acid; the concentration of the timentin in the regeneration medium is 200 mg/L; the concentration of the kinetin in the regeneration culture medium is 0.5 mg/L; the concentration of the 6-benzylaminopurine in the regeneration medium is 2 mg/L; the concentration of the naphthylacetic acid in the regeneration culture medium is 0.2-0.3 mg/L;

the rooting culture medium is obtained by uniformly mixing 1/2 culture medium, sucrose, naphthylacetic acid and plant gel; the concentration of the sucrose in the rooting medium is 15 g/L; the concentration of the naphthylacetic acid in the rooting culture medium is 0.1 mg/L; the concentration of the plant gel in the rooting culture medium is 3 g/L;

the culture medium consists of a solute and a solvent, wherein the solute consists of potassium nitrate, ammonium sulfate, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, calcium chloride dihydrate, manganese sulfate, zinc sulfate heptahydrate, boric acid, potassium iodide, copper sulfate pentahydrate, sodium molybdate dihydrate, cobalt chloride hexahydrate, glycine, vitamin B1, vitamin B6, nicotinic acid, inositol, ferrous sulfate heptahydrate and disodium ethylene diamine tetraacetate;

the concentration of the potassium nitrate in the culture medium is 2750-2850 mg/L;

the concentration of the ammonium sulfate in the culture medium is 380 mg/L;

the concentration of the potassium dihydrogen phosphate in the culture medium is 420 mg/L;

the concentration of the magnesium sulfate heptahydrate in the culture medium is 175 mg/L;

the concentration of the calcium chloride dihydrate in the culture medium is 550 mg/L;

the concentration of the manganese sulfate in the culture medium is 15-23 mg/L;

the concentration of the zinc sulfate heptahydrate in the culture medium is 12 mg/L;

the concentration of the boric acid in the culture medium is 10-15 mg/L;

the concentration of the potassium iodide in the culture medium is 6-8 mg/L;

the concentration of the copper sulfate pentahydrate in the culture medium is 0.03-0.05 mg/L;

the concentration of the sodium molybdate dihydrate in the culture medium is 0.3-0.5 mg/L;

the concentration of the cobalt chloride hexahydrate in the culture medium is 0.03-0.05 mg/L;

the concentration of the glycine in the culture medium is 2.5 mg/L;

the concentration of the vitamin B1 in the culture medium is 1 mg/L;

the concentration of the vitamin B6 in the culture medium is 0.5 mg/L;

the concentration of the nicotinic acid in the culture medium is 0.5 mg/L;

the concentration of the inositol in the culture medium is 0 mg/L;

the concentration of the ferrous sulfate heptahydrate in the culture medium is 42-55 mg/L;

the concentration of the disodium ethylene diamine tetraacetate in the culture medium is 56-74.5 mg/L;

the rice is indica rice;

the indica rice is Huanghuazhan, C815S, Guangzhan 63-4S, Wushan Miao and/or Guangdong Jingmiao No. 2;

the step 1) is also preceded by a step of sterilizing the rice seeds;

in the step 1), the culture condition is dark culture at 32-35 ℃ for 16-24 days;

in the step 2), the culture conditions are 120-200rpm, and dark culture is carried out at 26-28 ℃ for 7-10 days;

in the step 3), the concentration of the acetosyringone in the staining solution is 100 uM;

the concentration of the hydrolyzed casein in the staining solution is 300 mg/L;

the concentration of the proline in the staining solution is 300 mg/L;

the concentration of the sucrose in the staining solution is 20 g/L;

the concentration of the glucose in the infection liquid is 10 g/L;

the OD660 of the staining solution is 0.1-0.2, and the staining condition is that the staining solution is soaked for 10-15min at room temperature;

in the step 5), the culture condition is dark culture at 28-32 ℃ for 18-24 days;

in the step 6), culturing for 15-25 days under the conditions of 25-28 ℃ and the illumination period of 16h of white light/8 h of darkness;

in the step 7), the culture condition is 25-28 ℃, and the culture is carried out for 8-10 days under the condition that the illumination period is 16h of white light/8 h of darkness.

2. A product for genetic transformation of rice, comprising the induction medium of claim 1, the subculture medium of claim 1, the co-cultivation medium of claim 1, the recovery medium of claim 1, the selection medium of claim 1, the regeneration medium of claim 1, the rooting medium of claim 1 and the infectious agent of claim 1.

3. Use of the product of claim 2 in the genetic transformation of rice or in the preparation of a genetically transformed product of rice; the rice is indica rice; the indica rice is HUANGHUAZHAN, C815S, Guangzhan 63-4S, Wushan Miao and/or Guangdong Jing Miao No. 2.

Images