CN101818169B - Method for improving content of protein and combined lysine in wheat seeds - Google Patents
Method for improving content of protein and combined lysine in wheat seeds Download PDFInfo
- Publication number
- CN101818169B CN101818169B CN2009102630847A CN200910263084A CN101818169B CN 101818169 B CN101818169 B CN 101818169B CN 2009102630847 A CN2009102630847 A CN 2009102630847A CN 200910263084 A CN200910263084 A CN 200910263084A CN 101818169 B CN101818169 B CN 101818169B
- Authority
- CN
- China
- Prior art keywords
- cflr
- gene
- protein
- lysine
- puc18
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to the field of wheat breeding, in particular to a method for improving content of protein and combined lysine in wheat seeds, which guides high chili lysine protein gene (cflr) into conventional wheat by adopting a genetic engineering method and expresses the gene to improve the content of the protein and the combined lysine in the wheat seeds. The method is characterized by comprising the following steps of: constructing an expression vector pAHC25-Cf1r of the high chili lysine protein gene (cflr); guiding the pAHC25-Cf1r into an acceptor wheat embryo cell through a gene gun to perform callus induction and plant regeneration on the wheat embryo cell so as to obtain a T5-generation transgenic homozygous strain; and detecting cflr gene expression abundance in progeny seeds of the T5-generation transgenic homozygous strain, measuring the content of the protein and the combined lysine in the seeds, and screening the strains of which the content of the protein and the combined lysine in the seeds is remarkably improved. Compared with the conventional germ plasm breeding method, the method has the advantages of short breeding cycle, obvious improvement effect and little influence on important agronomic traits.
Description
Technical field
The present invention relates to field of wheat breeding,, improve gross protein and combined lysine content in the wheat seed by adopting gene engineering method that capsicum high-lysine protein gene (cflr) is imported conventional wheat and expressing.
Technical background
Wheat is as one of global important crops, and its seed goods are not only supplied with people's heat, and is the important plant protein sources of people, can be processed into numerous food such as steamed bun, noodles, bread, biscuit, cake.Yet, because a kind of indispensable amino acid---the scarcity of Methionin in the wheat seed protein has influenced the proteic utilization fully of its seed.The average content of Methionin (Duan Min etc. about 0.44% only in the wheat seed storage protein, 1997), and the Methionin desired contents that international food and agricultural organization (FAO) announces is 5.5%, the contents level that the proteic lysine content of wheat seed requires far below FAO, if and the content of Methionin increases by 0.2% in the whole meal flour, its available protein just can increase by 60%, thereby it is significant therefore to improve wheat grain lysine content improvement aleuronat quality.
Cereal crop lysine contents such as corn, paddy rice and wheat are generally very low, in recent decades, along with the foundation of the development of molecular biology and Measurement for Biochemistry and gramineous crop genetic conversion system and perfect, by the lysine content of genetically modified approach raising crop seed, mainly contain the progress of following two aspects at present:
By regulation and control plant Methionin synthetic with catabolic pathway in the expression of key gene improve the content of free Methionin in the plant seed: Monsanto Technology LLC is by suppressing a key gene---the expression of LKR/SDH of lysine catabolic approach initiating terminal in the corn kernel, increased the content of free Methionin in the transgenic corn seed, and to the transgenic corn seed application patent (CN101389212); U.S.'s molecule genetics research and Development Co., Ltd be then by introducing the level that dihydrodipicolinate synthase (DHDFS) gene that a feedback inhibition to free L-Methionin has resistance improves free L-Methionin in the plant in dicotyledonss such as corn, and to the application of this kind method patent (CN10138465); Monsanto Technology LLC is again by introducing a DHDFS gene that the feedback inhibition of free L-Methionin is had resistance in plant, and suppress LKR/SDH expression of gene in the seed simultaneously, regulate and control to increase the lysine level the plant seed simultaneously from synthetic and katabolism two aspects of Methionin, and to transgenic plant seed and the application of DNA carrier construction patent (CN101321873); The Weimingkaituo Agro-Biological Technology Co., Ltd., Beijing introduces paddy rice with bacterium dihydrodipicolinate synthase gene, suppress oryza sativa l. KR/SDH expression of gene simultaneously, obtained in the seed free lysine content and improved 18 times transgenic paddy rice than wild-type, and to this kind method and carrier application patent (CN1834252).
2. by introduce the content that the heterologous gene that is rich in high-lysine improves combined lysine in the plant seed in plant: the high-lysine protein gene SBgLR that China Agricultural University will clone from the potato gene group imports in the corn, make it specific expressed in corn kernel, increased Methionin and the Protein content in the corn seed, and SBgLR gene and this kind are improved Methionin and Protein content in the seeds of gramineous crops the method application patent (CN1317570).
Utilize naturally occurring high-lysine protein gene to carry out transgenic research, can eliminate de novo synthesis or, strengthen the stability that it accumulates in seed through artificial reconstructed design high-lysine protein gene possibility potential danger.Naturally the high-lysine gene that exists of having cloned at present has: from the tsb gene of tomato pollen, SBgLR gene, st-901 gene and sb401 gene from potato, and from the wblrp gene of Semen Psophocarpi tetragonolobi, these high-lysine genes are transferred to paddy rice, and (Wu is superfine, 2008), corn (YU JJ etc., 2004; Lang Zhihong etc., 2004), wheat (Meng Chaomin etc., 2004), romaine lettuce various plants such as (Li Xingtao etc., 2006).High-lysine gene cflr among the present invention be our new gene of from capsicum, cloning (
Http:// www.ncbi.nlm.nih.gov/GenBank:EU367999), the content of Methionin is up to 21.2% (Sun Xiaobo etc. in its coded albumen, 2008), be higher than reported at present derive from plant of Solanaceae potato and tomato lysine-rich protein GARP, ST2901, SBgLR and TSB (lysine content is respectively 18.6%, 17.8%, 18.9% and 18.0%), and the lysine-rich protein LYS (lysine content is 10.8%) in the Semen Psophocarpi tetragonolobi, be the highest naturally occurring albumen of present known lysine content.The albumen of cflr coded by said gene is non-pollen specific expressing protein simultaneously, and by comparing with the enBank database, discovery and allergen protein and toxalbumin do not have homologous sequence, therefore this gene is used for can not producing behind the wheat transgenic and causes the anaphylactoid albumen of people easily, thereby can improve the edible safety of transgenic wheat.The present invention adopts gene engineering method that the cflr gene is imported common wheat and expresses, and has improved gross protein and combined lysine content in the wheat seed by a relatively large margin.
Reference:
1. section is quick, Wen Ruiyun, and Li Lan, etc. Shaanxi wheat variety resources quality is identified preliminary study [J]. Shaanxi agricultural sciences, 1997 (3): 27-28.
2. Wu Chao, Fu Yaping etc. change the harvest index of the crisp stem paddy rice of high-lysine protein gene and the research [J] of stalk lysine content. Zhejiang agricultural journal, 2008,20 (4): 225-230.
3.YU?JJ，PENG?P.ZhANG?XJ，et?al.Seed-specific?expres?sion?of?a?lysine?richprotein?sb401gene?significantly?increases?both?lysine?and?total?proteincontent?in?nlaize?seeds[J].Mol?Breeding，2004，14(1)：1-7.
4. Lang Zhi is grand, Yu Jingjuan, and Zhu Dengyun is etc. the clone of high-lysine protein gene SBgLR and to improving the effect [J] of protein and lysine content in the corn seed. Journal of Agricultural Biotechnology, 2004,12 (5): 487-492.
5. Meng Chao is quick, Chen Xuqing, and Liang Rongqi, etc. the high-lysine content gene is in the expression and the lysine content analysis [J] thereof of transgenic wheat. Science Bulletin, 2004,49 (19): 1731-1736.
6. Li Xing great waves, Li Xia, Zhang Jinwen. expression and the genetic transformation [J] of high-lysine protein gene in transgenic lettuce. use and the environmental organism journal 2006,12 (4): 472-475.
7. Sun Xiao ripple, the room is auspicious, Yu Guihong, etc. capsicum high-lysine protein gene cflr Full Length cDNA Cloning and tissue expression feature [J] thereof. gardening journal, 2008,35 (9): 1310-1316.
Summary of the invention
Technical problem to be solved
At wheat seed Methionin scarcity, thereby influence the problem of its seed nutritive value, provide a kind of and improve combined lysine content and method of protein in the wheat seed by genetically engineered.
Technical scheme
The object of the present invention is achieved like this:
A kind of method that improves protein and combined lysine content in the wheat seed is characterized in that following steps:
A, capsicum high-lysine protein gene cflr expression vector pAHC25-cflr of structure;
B, pAHC25-cflr is imported acceptor wheat immature embryo cell by particle gun;
C, described wheat immature embryo cell is carried out callus of induce, plant regeneration, obtain transgenosis plant to be selected;
D, above-mentioned transgenosis plant to be selected is carried out Molecular Detection, obtain positive transfer-gen plant, positive transfer-gen plant obtains T by selfing and PCR screening
5The transgenosis homozygous lines;
E, detection T
5For the cflr gene expression abundance in the transgenosis homozygous lines progeny seed, the content of protein and combined lysine in the mensuration seed;
F, filter out the transfer-gen plant that protein and combined lysine content are significantly increased in the seed;
Described capsicum high-lysine protein gene cflr expression vector pAHC25-cflr obtains by following steps:
A, structure plasmid PUC18-PCN
With the pBI2301 that contains Nos 3 ' sequence see Seq No.4 (
Http:// www.ncbi.nlm.nih.gov/GenBank:AF234316) be template, 5 '-GCC
CTGCAGCGTTCAAACATTTGGCAATAAAG-3 ' (containing the PstI restriction enzyme site) and 5 '-GCC
AAGCTTCCCGATCTAGTAACATAGATGAC-3 ' (containing the HindIII restriction enzyme site) is a primer amplification Nos3 ' sequence, wherein said Nos3 ' sequence be known nucleic acid sequence (
Http:// www.ncbi.nlm.nih.gov/GenBank:AF485783) see Seq No.1,1% agarose electrophoresis is carried out purifying to the PCR product and is reclaimed, with PUC18 be basic plasmid (
Http:// www.ncbi.nlm.nih.gov/GenBank:A02710) (Fig. 2), adopt restriction enzyme HindIII and PstI that Nos 3 ' fragment and PUC18 are carried out complete double digestion respectively, 1% agarose electrophoresis reclaims endonuclease bamhi, uses T
416 ℃ of connections of dna ligase are spent the night, and (the 20ul reaction system contains 1 * T
4The dna ligase damping fluid, PUC18 fragment 0.03pmol, Nos3 ' fragment 0.3pmol, 350uT
4Dna ligase), (method for transformation is with reference to " molecular cloning experiment guide " second edition to connect product transformed into escherichia coli DH5 α competent cell, the P55-56 page or leaf, Science Press, 1992), get the flat board that the coating of e.colidh5 suspension contains the 100mg/L penbritin after the conversion, the positive colony of antagonism penbritin increases and extracts plasmid, take enzyme to cut the exactness that is connected with the method validation that checks order, obtain plasmid called after PUC18-N; With the cDNA that contains cflr gene coded sequence capsicum blade is template, with primer 5 '-GCC
GGATCCATGGGTTGTGGGGAATCAAAGCACGCAGTT-GCA-3 ' (containing the BamHI restriction enzyme site) and 5 '-GCC
C TGCAGTTAATCTGTTTT-CAAATCTGTTGT-3 ' (containing the PstI restriction enzyme site) pcr amplification cflr gene coded sequence, wherein said cflr gene be known nucleic acid sequence (
Http:// www.ncbi.nlm.nih.gov/GenBank:EU367999) see Seq No.2, described capsicum (Capsicum frutescens L.) cultivar " river vegetables No. 7 " comes from vegetables testing ground, Jiangsu Province Agriculture Science Institute, getting it becomes strain top young leaflet tablet to extract RNA, reverse transcription makes up a cDNA library, and is template with this library; 1% agarose electrophoresis is carried out purifying to the PCR product and is reclaimed, and is carrier with PUC18-N, adopt restriction enzyme BamHI and PstI that cflr gene coded sequence and PUC18-N carrier are carried out complete double digestion respectively, 1% agarose electrophoresis reclaims endonuclease bamhi, uses T
416 ℃ of connections of dna ligase are spent the night, and (the 20ul reaction system contains 1 * T
4The dna ligase damping fluid, PUC18-N fragment 0.03pmol, Nos3 ' fragment 0.3pmol, 350uT
4Dna ligase), transformed into escherichia coli is chosen positive colony and is extracted plasmid and take enzyme to cut the exactness that is connected with the method validation that checks order, and obtains plasmid called after PUC18-CN; With paddy rice (Oryza sativa) the blade genome that contains the pGluB gene promoter is template, with primer 5 '-GCC
GAGCTCAAGCTTTTTTTGAGGAATTTTAGAAGT TGAACAG-3 ' (containing the SacI restriction enzyme site) and 5 '-GCC
GGATCCCTTAAGCTAATTGAT-GTG AGTTCAAAG-3 ' (containing the BamHI restriction enzyme site) increase the pGluB full length sequence, wherein said pGluB gene promoter be known nucleic acid sequence (
Http:// www.ncbi.nlm.nih.gov/GenBank:AY427569) see Seq No.3,1% agarose electrophoresis, the PCR product is carried out purifying to be reclaimed, with PUC18-CN is carrier, adopt restriction enzyme BamHI and SacI that pGluB and PUC18-CN are carried out complete double digestion respectively, 1% agarose electrophoresis reclaims endonuclease bamhi, uses T
416 ℃ of connections of dna ligase are spent the night, and (the 20ul reaction system contains 1 * T
4The dna ligase damping fluid, PUC18-CN fragment 0.03pmol, Nos3 ' fragment 0.3pmol, 350uT
4Dna ligase), transformed into escherichia coli is chosen positive colony and is extracted plasmid and take enzyme to cut the exactness that is connected with the method validation that checks order, and obtains plasmid called after PUC18-PCN.
B, preparation pAHC25-cflr expression vector:
Adopt restriction enzyme HindIII that the PUC18-PCN plasmid DNA is carried out complete degestion, downcut pGluB+cflr+Nos3 ' mosaic gene fragment, adopt 0.8% agarose electrophoresis, the endonuclease bamhi about 2.24kb is reclaimed; Adopt restriction enzyme HindIII that pAHC25 plasmid DNA (Fig. 3) is carried out complete degestion, excise original expression cassette, adopt 0.8% agarose electrophoresis, the endonuclease bamhi about 5.5kb is reclaimed; Use T
4Dna ligase reclaims 16 ℃ of connections of fragment to two and spends the night that (the 20ul reaction system contains 1 * T
4The dna ligase damping fluid, pAHC25 fragment 0.03pmol, pGluB1+cflr+Nos 3 ' mosaic gene fragment 0.3pmol, 350uT
4Dna ligase), connect product transformed into escherichia coli DH5 α competent cell, get the flat board that the coating of e.colidh5 suspension contains the 100mg/L penbritin after the conversion, the positive colony of antagonism penbritin increases and extracts plasmid, take enzyme to cut the exactness that is connected with the method validation that checks order, obtain plasmid called after pAHC25-cflr, be the expression vector pAHC25-cflr (see figure 4) of capsicum high-lysine protein gene cflr.
Adopt the particle gun transgenic method that the expression vector that makes up is imported acceptor wheat immature embryo cell, obtain transgenosis plant to be selected (all vast equality of reference, the improvement of wheat cdna marksmanship transformation technology, Jiangsu agricultural journal by callus of induce, plant regeneration, 1999,15 (1): 62-64); Described acceptor
Described wheat is meant the hexaploid conventional wheat; Described rataria is meant 12-14 days the rataria in back of blooming.
In an application of the invention: plant to be selected is carried out Molecular Detection, obtain to integrate and express the positive transfer-gen plant of cflr gene, positive transfer-gen plant obtains T by selfing and PCR screening
5For the transgenosis homozygous lines; Detect T
5For the cflr gene expression abundance in the transgenosis homozygous lines progeny seed, and measure the content of protein and combined lysine in the seed, screening also obtains the wheat transgenic strain system that total protein and combined lysine content are significantly increased in the seed.
Described Molecular Detection is PCR and RT-PCR analytical procedure.Pcr analysis is meant the genomic dna (thymus nucleic acid) that extracts transgenic wheat to be selected and offspring thereof, as template the cflr gene fragment is carried out pcr amplification, can amplify the positive transfer-gen plant of plant of corresponding gene fragment.It is 5 '-CACCGTTCCAAAGAAC-AAGAGATC-3 ' and 5 '-CCCGATCTAGTAACATAGATGAC-3 ' that the first round PCR of cflr gene detects primer, amplification condition: 95 ℃ 3 minutes, 94 ℃ 1 minute, 57 ℃ 1 minute, 72 ℃ 1 minute, carry out 35 circulations, last 72 ℃ are extended 10min.The amplified fragments size is 880bp, detects electrophorogram and sees accompanying drawing 5.The first round PCR product of cflr gene is diluted 30 times, get 1 μ l and do template, with 5 '-CACCGTTCCAAAGAACAAGAGATC-3 ' and 5 '-TTAATCTGTTTTCAAATCTGTTGT-3 ' is that primer carries out nested PCR, amplification condition: 95 ℃ 3 minutes, 94 ℃ 1 minute, 58 ℃ 1 minute, 72 ℃ 50 seconds, carry out 35 circulations, last 72 ℃ are extended 10min.The amplified fragments size is 624bp, detects electrophorogram and sees (Fig. 6).
RT-PCR analyzes and to be meant and to extract the transgenic wheat positive plant back 12 days young tender seed RNA (Yeast Nucleic Acid) of blooming, reverse transcription synthesizes cDNA article one chain, as template the cflr gene fragment is carried out pcr amplification, the plant that can amplify corresponding gene fragment be for expressing the positive transfer-gen plant of cflr gene, and is confidential reference items detection cflr expression of gene abundance by wheat Actin (Actin muscle) gene.The PCR detection primer that detects cflr genetic expression is 5 '-TTAATCTGTTTTCAAATC TGTTGT-3 ' and 5 '-ATGGGTTGTGGGGAATCAAAGCACGCAG-3 ', amplification condition: 94 ℃ 3 minutes, 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 50 seconds, carry out 35 circulations, last 72 ℃ are extended 10min.The amplified fragments size is 672bp, detects electrophorogram and sees (Fig. 7).
The PCR detection primer that detects the cflr gene expression abundance is 5 '-ATGGGTTGTGGGGAATCAA AGCAC-3 ' and 5 '-TTAATCTGTTTTCAAATCTGTTGT-3 ', wheat Actin gene primer is 5 '-TGTTGTTCTCAGTGGAGGTTCT-3 ' and 5 '-CATTATTTCATACAGCAGGCAAG-3 ', amplification condition: 94 ℃ 3 minutes, 94 ℃ 1 minute, 58 ℃ 45 seconds, 72 ℃ 1 minute, 17-35 circulation, 72 ℃ are extended 10min.Detect electrophorogram and see (Fig. 8).
Transgenic wheat seed total protein content is measured with near-infrared analyzer, the mensuration of protein bound attitude lysine content adopts ninhydrin colorimetry, and (concrete operations are with reference to Meng Chaomin etc., the high-lysine content gene is in the expression and the lysine content analysis thereof of transgenic wheat, Science Bulletin, 2004,49 (19): 1731-1736.), get 3 multiple averages value for institute's test sample product.
Beneficial effect
1, compare with the germplasm method of cultivation of routine, have that cultivation period is short, improved effect obviously, to the little characteristics of Main Agronomic Characters influence.
2, transgenic wheat seed total protein content is measured with near-infrared analyzer, the mensuration of protein bound attitude lysine content adopts ninhydrin colorimetry, and (concrete operations are with reference to Meng Chaomin etc., the high-lysine content gene is in the expression and the lysine content analysis thereof of transgenic wheat, Science Bulletin, 2004,49 (19): 1731-1736.), get 3 multiple averages value for institute's test sample product.
Protein and combined lysine Determination on content the results are shown in Table 1 in the transgenic wheat seed, in 12 detected strain transgenic lines, there were significant differences for the content that 11 strains are arranged is grain protein and its acceptor varietal check (CK), the amplification that 6 strains system is wherein arranged is more than 10%, the highest increase by 22.6%; The lysine content that 10 strains are arranged is the seed dry weight is significantly improved, and 8 strain systems reach utmost point conspicuous level with the difference of its acceptor varietal check (CK), and the highest Y1-2 can reach 39.5%; Protein lysine content from seed, in detected plant, there are 9 corresponding contrasts of strain system to be significantly increased, wherein 4 strains system reaches utmost point conspicuous level with the difference of its acceptor varietal check (CK), and lysine content has improved 22.9% than acceptor contrast (CK) in the highest Y1-12 hectogram protein of amplification.
The strain of table 1 transgenic wheat is the measurement result [1] of protein content and combined lysine content (%)
| Strain system | Protein | Methionin I/g | Methionin II/g | Protein improves (%) | Methionin I improves (%) | Methionin II improves (%) |
| CK1 (raising 158) | 16.4 | 0.38 | 2.32 | - | - | - |
| Y1-1 | 18.9 | 0.5 | 2.65 | 15.2** | 31.6** | 14.2** |
| Y1-2 | 20.1 | 0.53 | 2.64 | 22.6** | 39.5** | 13.8** |
| Y1-3 | 17.3 | 0.41 | 2.37 | 5.5* | 7.9* | 2.3* |
| Y1-4 | 18.4 | 0.48 | 2.61 | 12.2** | 26.3** | 12.6** |
| Y1-5 | 18.6 | 0.45 | 2.42 | 13.4** | 18.4** | 4.4* |
| Y1-6 | 16.7 | 0.36 | 2.16 | 1.8* | - | - |
| Y1-7 | 17.5 | 0.41 | 2.34 | 6.7* | 7.9* | 1.1* |
| Y1-8 | 16.8 | 0.38 | 2.26 | 2.4* | - | - |
| Y1-9 | 18.1 | 0.45 | 2.49 | 10.4** | 18.4** | 7.3* |
| Y1-10 | 19.8 | 0.46 | 2.32 | 20.7** | 21.1** | 0.3 |
| Y1-11 | 17.8 | 0.42 | 2.36 | 8.5** | 10.5** | 1.8* |
| Y1-12 | 16.5 | 0.47 | 2.85 | 0.61 | 23.7** | 22.9** |
[1] Methionin I is the content of every 100g dry seeds; Methionin II is the content in every 100g crude protein.* represent p＜0.05, * * represents p＜0.01
Description of drawings
The synoptic diagram of Fig. 1 pAHC25-Cflr
The synoptic diagram of Fig. 2 PUC18
The synoptic diagram of Fig. 3 pAHC25
Fig. 4 expression vector pAHC25-Cflr building process synoptic diagram
The electrophorogram that the first round PCR of Fig. 5 part transgenosis plant capsicum to be selected high-lysine protein gene (cflr) detects, wherein
1:1-10 is a transgenosis plant to be selected.Wherein 1,5-7 is for changeing the positive plant of cflr gene.
2:11 raises wheat 158 contrasts for transgenosis not.
The positive plasmid contrast of 3:12.
4:13 is a dna molecular amount standard, and band is respectively 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom.
Second of Fig. 6 part transgenosis plant capsicum to be selected high-lysine protein gene (cflr) is taken turns the electrophorogram that PCR detects, wherein
1:1-10 is a transgenosis plant to be selected.Wherein 1,7 for changeing the positive plant of cflr gene.
2:11 raises wheat 158 contrasts for transgenosis not.
The positive plasmid contrast of 3:12.
4:13 is a dna molecular amount standard, and band is respectively 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom.
Fig. 7 part transfer-gen plant is expressed the electrophorogram of the PCR detection of capsicum high-lysine protein gene (cflr), wherein
1:1-12 is a transfer-gen plant.1-5 wherein, 7-12 is for expressing the positive plant of cflr gene.
2:13 raises wheat 158 contrasts for transgenosis not.
The positive plasmid contrast of 3:14.
4:15 is a dna molecular amount standard, and band is respectively 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom.
The PCR that Fig. 8 part transfer-gen plant capsicum high-lysine protein gene (cflr) is expressed abundance detects electrophorogram, wherein
1. band 1 is the RT-PCR amplification amount of housekeeping gene Actin in transfer-gen plant Y1-1 to Y1-12 (1-12 represents Y1-1 to Y1-12 respectively).
2. band 2 is the RT-PCR amplification amount of Cflr gene in transfer-gen plant Y1-1 to Y1-12 (1-12 represents Y1-1 to Y1-12 respectively);
Embodiment
Embodiment 1:
A kind of method that improves protein and combined lysine content in the wheat seed, carry out according to the following steps:
A, structure plasmid PUC18-PCN
With pBI2301 is template, 5 '-GCC
CTGCAGCGTTCAAACATTTGGCAATAAAG-3 ' (containing the PstI restriction enzyme site) and 5 '-GCC
AAGCTTCCCGATCTAGTAACATAGATGAC-3 ' (containing the HindIII restriction enzyme site) is a primer amplification Nos3 ' sequence, wherein said Nos3 ' sequence be known nucleic acid sequence (
Http:// www.ncbi.nlm.nih.gov/GenBank:AF485783), 1% agarose electrophoresis, the PCR product is carried out purifying to be reclaimed, with PUC18 is basic plasmid (Fig. 2), adopt restriction enzyme HindIII and PstI that Nos3 ' fragment and PUC18 are carried out complete double digestion respectively, 1% agarose electrophoresis reclaims endonuclease bamhi, uses T
416 ℃ of connections of dna ligase are spent the night, and (the 20ul reaction system contains 1 * T
4The dna ligase damping fluid, PUC18 fragment 0.03pmol, Nos3 ' fragment 0.3pmol, 350uT
4Dna ligase), (method for transformation is with reference to " molecular cloning experiment guide " second edition to connect product transformed into escherichia coli DH5 α competent cell, the P55-56 page or leaf, Science Press, 1992), get the flat board that the coating of e.colidh5 suspension contains the 100mg/L penbritin after the conversion, the positive colony of antagonism penbritin increases and extracts plasmid, take enzyme to cut the exactness that is connected with the method validation that checks order, obtain plasmid called after PUC18-N; CDNA with the capsicum blade is a template, with primer 5 '-GCC
GGATCCATGGGTTGTGGGGAATCAAAGCACGCAGTT-GCA-3 ' (containing the BamHI restriction enzyme site) and 5 '-GCC
CTGCAGThe wherein said cflr gene coded sequence of TTAATCTGTTTT-CAAATCTGTTGT-3 ' (containing the PstI restriction enzyme site) amplification cflr gene coded sequence be known nucleic acid sequence (
Http:// www.ncbi.nlm.nih.gov/GenBank:EU367999), 1% agarose electrophoresis, the PCR product is carried out purifying to be reclaimed, with PUC18-N is carrier, adopt restriction enzyme BamHI and PstI that cflr gene coded sequence and PUC18-N carrier are carried out complete double digestion respectively, 1% agarose electrophoresis reclaims endonuclease bamhi, uses T
416 ℃ of connections of dna ligase are spent the night, and (the 20ul reaction system contains 1 * T
4The dna ligase damping fluid, PUC18-N fragment 0.03pmol, Nos3 ' fragment 0.3pmol, 350uT
4Dna ligase), transformed into escherichia coli is chosen positive colony and is extracted plasmid and take enzyme to cut the exactness that is connected with the method validation that checks order, and obtains plasmid called after PUC18-CN; With the rice genome is template, with primer 5 '-GCC
GAGCTCAAGCTTTTTTTGAGGAATTTTAGAAGTTGAACAG-3 ' (containing the SacI restriction enzyme site) and 5 '-GCC
GGATCCCTTAAGCTAATTGAT-GTGAGTTCAAAG-3 ' (containing the BamHI restriction enzyme site) increase the pGluB full length sequence, 1% agarose electrophoresis, the PCR product is carried out purifying to be reclaimed, with PUC18-CN is carrier, adopt restriction enzyme BamHI and SacI that pGluB1 and PUC18-CN are carried out complete double digestion respectively, 1% agarose electrophoresis reclaims endonuclease bamhi, uses T
416 ℃ of connections of dna ligase are spent the night, and (the 20ul reaction system contains 1 * T
4The dna ligase damping fluid, PUC18-CN fragment 0.03pmol, Nos3 ' fragment 0.3pmol, 350uT
4Dna ligase), transformed into escherichia coli is chosen positive colony and is extracted plasmid and take enzyme to cut the exactness that is connected with the method validation that checks order, and obtains plasmid called after PUC18-PCN.
B, preparation pAHC25-Cflr expression vector: adopt restriction enzyme HindIII to PUC18
-PCN plasmid DNA is carried out complete degestion, downcuts pGluB+cflr+Nos3 ' mosaic gene fragment, adopts 0.8% agarose electrophoresis, and the endonuclease bamhi about 2.24kb is reclaimed; Adopt restriction enzyme HindIII that pAHC25 plasmid (Fig. 3) DNA is carried out complete degestion, excise original expression cassette, adopt 0.8% agarose electrophoresis, the endonuclease bamhi about 5.5kb is reclaimed; Use T
4Dna ligase reclaims 16 ℃ of connections of fragment to two and spends the night that (the 20ul reaction system contains 1 * T
4The dna ligase damping fluid, pAHC25 fragment 0.03pmol, pGluB+cflr+Nos3 ' mosaic gene fragment 0.3pmol, 350uT
4Dna ligase), connect product transformed into escherichia coli DH5 α competent cell, get the flat board that the coating of e.colidh5 suspension contains the 100mg/L penbritin after the conversion, the positive colony of antagonism penbritin increases and extracts plasmid, take enzyme to cut the exactness that is connected with the method validation that checks order, obtain plasmid called after PAHC25-Cflr, be the expression vector (seeing accompanying drawing 1) of capsicum high-lysine protein gene (cflr).
C, employing particle gun transgenic method import acceptor wheat immature embryo cell with the expression vector that makes up, obtain transgenosis plant to be selected (all vast equality of reference, the improvement of wheat cdna marksmanship transformation technology, Jiangsu agricultural journal by callus of induce, plant regeneration, 1999,15 (1): 62-64); Described acceptor wheat is meant the hexaploid conventional wheat; Described rataria is meant 12-14 days the rataria in back of blooming.
D, above-mentioned transgenosis plant to be selected is carried out Molecular Detection, obtain positive transfer-gen plant, positive transfer-gen plant obtains T by selfing and PCR screening
5The transgenosis homozygous lines;
E, detection T
5For the cflr gene expression abundance in the transgenosis homozygous lines progeny seed, the content of protein and combined lysine in the mensuration seed;
F, filter out the transfer-gen plant that protein and combined lysine content are significantly increased in the seed;
In an application of the invention: plant to be selected is carried out Molecular Detection, obtain to integrate and express the positive transfer-gen plant of cflr gene, positive transfer-gen plant obtains T by selfing and PCR screening
5For the transgenosis homozygous lines; Detect T
5For the cflr gene expression abundance in the transgenosis homozygous lines progeny seed, and measure the content of protein and combined lysine in the seed, screening also obtains the wheat transgenic strain system that total protein and combined lysine content are significantly increased in the seed.
Described Molecular Detection is PCR and RT-PCR analytical procedure.Pcr analysis is meant the genomic dna (thymus nucleic acid) that extracts transgenic wheat to be selected and offspring thereof, as template the cflr gene fragment is carried out pcr amplification, can amplify the positive transfer-gen plant of plant of corresponding gene fragment.It is 5 '-CACCGTTCCAAAGAAC-AAGAGATC-3 ' and 5 '-CCCGATCTAGTAACATAGATGAC-3 ' that the first round PCR of cflr gene detects primer, amplification condition: 95 ℃ 3 minutes, 94 ℃ 1 minute, 57 ℃ 1 minute, 72 ℃ 1 minute, carry out 35 circulations, last 72 ℃ are extended 10min.The amplified fragments size is 880bp, detects electrophorogram and sees accompanying drawing 4.The first round PCR product of cflr gene is diluted 30 times, get 1 μ l and do template, with 5 '-CACCGTTCCAAAGAACAAGAGATC-3 ' and 5 '-TTAATCTGTTTTCAAATCTGTTGT-3 ' is that primer carries out nested PCR, amplification condition: 95 ℃ 3 minutes, 94 ℃ 1 minute, 58 ℃ 1 minute, 72 ℃ 50 seconds, carry out 35 circulations, last 72 ℃ are extended 10min.The amplified fragments size is 624bp, detects electrophorogram and sees accompanying drawing 5.
RT-PCR analyzes and to be meant and to extract the transgenic wheat positive plant back 12 days young tender seed RNA (Yeast Nucleic Acid) of blooming, reverse transcription synthesizes cDNA article one chain, as template the cflr gene fragment is carried out pcr amplification, the plant that can amplify corresponding gene fragment be for expressing the positive transfer-gen plant of cflr gene, and is confidential reference items detection cflr expression of gene abundance by wheat Actin (Actin muscle) gene.The PCR detection primer that detects cflr genetic expression is 5 '-TTAATCTGTTTTCAAATCTGTTGT-3 ' and 5 '-ATGGGTTGTGGGGAATCAAAGCACGCAG-3 ', amplification condition: 94 ℃ 3 minutes, 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 50 seconds, carry out 35 circulations, last 72 ℃ are extended 10min.The amplified fragments size is 672bp, detects electrophorogram and sees accompanying drawing 6.The PCR that detects the cflr gene expression abundance detects primer and is 5 '-ATGGGTTGTGGGGAATCAAAGCAC-3 ' and 5 ' TTAATCTGTTTTCAAATCTGTTGT-3 ', wheat Actin gene primer is 5 '-TGTTGTTCTCAGTGGAGGTTCT-3 ' and 5 '-CATTATTTCATACAGCAGGCAAG-3 ', amplification condition: 94 ℃ 3 minutes, 94 ℃ 1 minute, 58 ℃ 45 seconds, 72 ℃ 1 minute, 17-35 circulation, 72 ℃ are extended 10min.Detect electrophorogram and see accompanying drawing 7.
Transgenic wheat seed total protein content is measured with near-infrared analyzer, the mensuration of protein bound attitude lysine content adopts ninhydrin colorimetry, and (concrete operations are with reference to Meng Chaomin etc., the high-lysine content gene is in the expression and the lysine content analysis thereof of transgenic wheat, Science Bulletin, 2004,49 (19): 1731-1736.), get 3 multiple averages value for institute's test sample product.
Protein and combined lysine Determination on content the results are shown in Table 1 in the transgenic wheat seed, in 12 detected strain transgenic lines, there were significant differences for the content that 11 strains are arranged is grain protein and its acceptor varietal check (CK), the amplification that 6 strains system is wherein arranged is more than 10%, the highest increase by 22.6%; The lysine content that 10 strains are arranged is the seed dry weight is significantly improved, and 8 strain systems reach utmost point conspicuous level with the difference of its acceptor varietal check (CK), and the highest Y1-2 can reach 39.5%; Protein lysine content from seed, in detected plant, there are 9 corresponding contrasts of strain system to be significantly increased, wherein 4 strains system reaches utmost point conspicuous level with the difference of its acceptor varietal check (CK), and lysine content has improved 22.9% than acceptor contrast (CK) in the highest Y1-12 hectogram protein of amplification.
The strain of table 1 transgenic wheat is the measurement result of protein content and combined lysine content (%)
[1]
| Strain system | Protein | Methionin I/g | Methionin II/g | Protein improves (%) | Methionin I improves (%) | Methionin II improves (%) |
| CK1 (raising 158) | 16.4 | 0.38 | 2.32 | - | - | - |
| Y1-1 | 18.9 | 0.5 | 2.65 | 15.2** | 31.6** | 14.2** |
| Y1-2 | 20.1 | 0.53 | 2.64 | 22.6** | 39.5** | 13.8** |
| Y1-3 | 17.3 | 0.41 | 2.37 | 5.5* | 7.9* | 2.3* |
| Y1-4 | 18.4 | 0.48 | 2.61 | 12.2** | 26.3** | 12.6** |
| Y1-5 | 18.6 | 0.45 | 2.42 | 13.4** | 18.4** | 4.4* |
| Y1-6 | 16.7 | 0.36 | 2.16 | 1.8* | - | - |
| Y1-7 | 17.5 | 0.41 | 2.34 | 6.7* | 7.9* | 1.1* |
| Y1-8 | 16.8 | 0.38 | 2.26 | 2.4* | - | - |
| Y1-9 | 18.1 | 0.45 | 2.49 | 10.4** | 18.4** | 7.3* |
| Y1-10 | 19.8 | 0.46 | 2.32 | 20.7** | 21.1** | 0.3 |
| Y1-11 | 17.8 | 0.42 | 2.36 | 8.5** | 10.5** | 1.8* |
| Y1-12 | 16.5 | 0.47 | 2.85 | 0.61 | 23.7** | 22.9** |
[1] Methionin I is the content of every 100g dry seeds; Methionin II is the content in every 100g crude protein.* represent p＜0.05, * * represents p＜0.01
Sequence table
SEQUENCE?LISTING
＜110〉Jiangsu Province Agriculture Science Institute
＜120〉a kind of method that improves protein and combined lysine content in the wheat seed
<130>
<160>4
<170>PatentIn?version?3.3
<210>1
<211>253
<212>DNA
＜213〉artificial sequence
<400>1
cgttcaaaca?tttggcaata?aagtttctta?agattgaatc?ctgttgccgg?tcttgcgatg 60
attatcatat?aatttctgtt?gaattacgtt?aagcatgtaa?taattaacat?gtaatgcatg 120
acgttattta?tgagatgggt?ttttatgatt?agagtcccgc?aattatacat?ttaatacgcg 180
atagaaaaca?aaatatagcg?cgcaaactag?gataaattat?cgcgcgcggt?gtcatctatg 240
ttactagatc?ggg 253
<210>2
<211>672
<212>DNA
＜213〉artificial sequence
<400>2
atgggttgtg?gggaatcaaa?gcacgcagtt?gcaacggaaa?aagccaccgt?tccaaagaac 60
aagagatcat?tgagttctaa?atccaatgga?gaaactcaaa?tttctcaaga?aagtgtcaag 120
aaaaatacag?aaaatggaga?atctggggtt?gcagaaacgg?cgaaaacaag?tgatgagaaa 180
gtagaggtta?aagccaaggt?ggatgaggca?actgcaccca?aagtggtggc?tgtagaaaaa 240
gaaaaagcta?aagaaaagtc?tgagaagaaa?gaaatggtgg?gaacaacaga?ggaggttttt 300
gctgaaaaga?aggaagaaaa?agttgtggaa?tctcaacctg?gagagaagaa?gaattcaaat 360
gatgaaacaa?ctccagctgt?tgctgctgta?gataagacag?aatcagttga?agagattaat 420
gtgcaagaca?aagctgagga?gaccattaag?ccaatcgaag?aagagaaaaa?gaaggaagaa 480
gttaccgctg?ttactgaggc?cacagatgct?gctaaatcag?aaagtgccaa?ggatgctgat 540
aaaccagaaa?gtgccaagga?tgttgataaa?atagaaactg?tcaaggatgc?taataagcca 600
gagacagagg?aaaagccaaa?tgagaagaaa?gcaactgaga?catcaacaac?aacagatttg 660
aaaacagatt?aa 672
<210>3
<211>1318
<212>DNA
＜213〉artificial sequence
<400>3
tttttgagga?attttagaag?ttgaacagag?tcaatcgaac?agacagttga?agagatatgg 60
attttctaag?attaattgat?tctctgtata?aagaaaaaaa?gtattattga?attaaatgga 120
aaaagaaaaa?ggaaaaaggg?gatggcttct?gctttttggg?ctgaaggcgg?cgtgtggcca 180
gcgtgctgcg?tgcggacagc?gagcgaacac?acgacggagc?agctacgacg?aacgggggac 240
cgagtggacc?ggacgaggat?gtggcctagg?acgagtgcac?aaggctagtg?gactcggtcc 300
ccgcgcggta?tcccgagtgg?tccactgtct?gcaaacacga?ttcacataga?gcgggcagac 360
gcgggagccg?tcctaggtgc?accggaagca?aatccgtcgc?ctgggtggat?ttgagtgaca 420
cggcccacgt?gtagcctcac?agctctccgt?ggtcagatgt?gtaaaattat?cataatatgt 480
gtttttcaaa?tagttaaata?atatatatag?gcaagttata?tgggtcaata?agcagtaaaa 540
aggcttatga?catggtaaaa?ttacttacac?caatatgcct?tactgtctga?tatattttac 600
atgacaacaa?agttacaagt?acgtcattta?aaaatacaag?ttacttatca?attgtagtgt 660
atcaagtaaa?tgacaacaaa?cctacaaatt?tgctattttg?aaggaacact?taaaaaaatc 720
aataggcaag?ttatatagtc?aataaactgc?aagaaggctt?atgacatgga?aaaattacat 780
acaccaatat?gctttattgt?ccggtatatt?ttacaagaca?acaaagttat?aagtatgtca 840
tttaaaaata?caagttactt?atcaattgtc?aagtaaatga?aaacaaacct?acaaatttgt 900
tattttgaag?gaacacctaa?attatcaaat?atagcttgct?acgcaaaatg?acaacatgct 960
tacaagttat?tatcatctta?aagttagact?catcttctca?agcataagag?ctttatggtg 1020
caaaaacaaa?tataatgaca?aggcaaagat?acatacatat?taagagtatg?gacagacatt 1080
tctttaacaa?actccatttg?tattactcca?aaagcaccag?aagtttgtca?tggctgagtc 1140
atgaaatgta?tagttcaatc?ttgcaaagtt?gcctttcctt?ttgtactgtg?ttttaacact 1200
acaagccata?tattgtctgt?acgtgcaaca?aactatatca?ccatgtatcc?caagatgctt 1260
ttttattgct?atataaacta?gcttggtctg?tctttgaact?cacatcaatt?agcttaag 1318
<210>4
<211>11633
<212>DNA
＜213〉artificial sequence
<400>4
catggtagat?ctgagggtaa?atttctagtt?tttctccttc?attttcttgg?ttaggaccct 60
tttctctttt?tatttttttg?agctttgatc?tttctttaaa?ctgatctatt?ttttaattga 120
ttggttatgg?tgtaaatatt?acatagcttt?aactgataat?ctgattactt?tatttcgtgt 180
gtctatgatg?atgatgatag?ttacagaacc?gacgactcgt?ccgtcctgta?gaaaccccaa 240
cccgtgaaat?caaaaaactc?gacggcctgt?gggcattcag?tctggatcgc?gaaaactgtg 300
gaattgatca?gcgttggtgg?gaaagcgcgt?tacaagaaag?ccgggcaatt?gctgtgccag 360
gcagttttaa?cgatcagttc?gccgatgcag?atattcgtaa?ttatgcgggc?aacgtctggt 420
atcagcgcga?agtctttata?ccgaaaggtt?gggcaggcca?gcgtatcgtg?ctgcgtttcg 480
atgcggtcac?tcattacggc?aaagtgtggg?tcaataatca?ggaagtgatg?gagcatcagg 540
gcggctatac?gccatttgaa?gccgatgtca?cgccgtatgt?tattgccggg?aaaagtgtac 600
gtatcaccgt?ttgtgtgaac?aacgaactga?actggcagac?tatcccgccg?ggaatggtga 660
ttaccgacga?aaacggcaag?aaaaagcagt?cttacttcca?tgatttcttt?aactatgccg 720
gaatccatcg?cagcgtaatg?ctctacacca?cgccgaacac?ctgggtggac?gatatcaccg 780
tggtgacgca?tgtcgcgcaa?gactgtaacc?acgcgtctgt?tgactggcag?gtggtggcca 840
atggtgatgt?cagcgttgaa?ctgcgtgatg?cggatcaaca?ggtggttgca?actggacaag 900
gcactagcgg?gactttgcaa?gtggtgaatc?cgcacctctg?gcaaccgggt?gaaggttatc 960
tctatgaact?cgaagtcaca?gccaaaagcc?agacagagtc?tgatatctac?ccgcttcgcg 1020
tcggcatccg?gtcagtggca?gtgaagggcc?aacagttcct?gattaaccac?aaaccgttct 1080
actttactgg?ctttggtcgt?catgaagatg?cggacttacg?tggcaaagga?ttcgataacg 1140
tgctgatggt?gcacgaccac?gcattaatgg?actggattgg?ggccaactcc?taccgtacct 1200
cgcattaccc?ttacgctgaa?gagatgctcg?actgggcaga?tgaacatggc?atcgtggtga 1260
ttgatgaaac?tgctgctgtc?ggctttcagc?tgtctttagg?cattggtttc?gaagcgggca 1320
acaagccgaa?agaactgtac?agcgaagagg?cagtcaacgg?ggaaactcag?caagcgcact 1380
tacaggcgat?taaagagctg?atagcgcgtg?acaaaaacca?cccaagcgtg?gtgatgtgga 1440
gtattgccaa?cgaaccggat?acccgtccgc?aaggtgcacg?ggaatatttc?gcgccactgg 1500
cggaagcaac?gcgtaaactc?gacccgacgc?gtccgatcac?ctgcgtcaat?gtaatgttct 1560
gcgacgctca?caccgatacc?atcagcgatc?tctttgatgt?gctgtgcctg?aaccgttatt 1620
acggatggta?tgtccaaagc?ggcgatttgg?aaacggcaga?gaaggtactg?gaaaaagaac 1680
ttctggcctg?gcaggagaaa?ctgcatcagc?cgattatcat?caccgaatac?ggcgtggata 1740
cgttagccgg?gctgcactca?atgtacaccg?acatgtggag?tgaagagtat?cagtgtgcat 1800
ggctggatat?gtatcaccgc?gtctttgatc?gcgtcagcgc?cgtcgtcggt?gaacaggtat 1860
ggaatttcgc?cgattttgcg?acctcgcaag?gcatattgcg?cgttggcggt?aacaagaaag 1920
ggatcttcac?tcgcgaccgc?aaaccgaagt?cggcggcttt?tctgctgcaa?aaacgctgga 1980
ctggcatgaa?cttcggtgaa?aaaccgcagc?agggaggcaa?acaagctagc?caccaccacc 2040
accaccacgt?gtgaattaca?ggtgaccagc?tcgaatttcc?ccgatcgttc?aaacatttgg 2100
caataaagtt?tcttaagatt?gaatcctgtt?gccggtcttg?cgatgattat?catataattt 2160
ctgttgaatt?acgttaagca?tgtaataatt?aacatgtaat?gcatgacgtt?atttatgaga 2220
tgggttttta?tgattagagt?cccgcaatta?tacatttaat?acgcgataga?aaacaaaata 2280
tagcgcgcaa?actaggataa?attatcgcgc?gcggtgtcat?ctatgttact?agatcgggaa 2340
ttaaactatc?agtgtttgac?aggatatatt?ggcgggtaaa?cctaagagaa?aagagcgttt 2400
attagaataa?cggatattta?aaagggcgtg?aaaaggttta?tccgttcgtc?catttgtatg 2460
tgcatgccaa?ccacagggtt?cccctcggga?tcaaagtact?ttgatccaac?ccctccgctg 2520
ctatagtgca?gtcggcttct?gacgttcagt?gcagccgtct?tctgaaaacg?acatgtcgca 2580
caagtcctaa?gttacgcgac?aggctgccgc?cctgcccttt?tcctggcgtt?ttcttgtcgc 2640
gtgttttagt?cgcataaagt?agaatacttg?cgactagaac?cggagacatt?acgccatgaa 2700
caagagcgcc?gccgctggcc?tgctgggcta?tgcccgcgtc?agcaccgacg?accaggactt 2760
gaccaaccaa?cgggccgaac?tgcacgcggc?cggctgcacc?aagctgtttt?ccgagaagat 2820
caccggcacc?aggcgcgacc?gcccggagct?ggccaggatg?cttgaccacc?tacgccctgg 2880
cgacgttgtg?acagtgacca?ggctagaccg?cctggcccgc?agcacccgcg?acctactgga 2940
cattgccgag?cgcatccagg?aggccggcgc?gggcctgcgt?agcctggcag?agccgtgggc 3000
cgacaccacc?acgccggccg?gccgcatggt?gttgaccgtg?ttcgccggca?ttgccgagtt 3060
cgagcgttcc?ctaatcatcg?accgcacccg?gagcgggcgc?gaggccgcca?aggcccgagg 3120
cgtgaagttt?ggcccccgcc?ctaccctcac?cccggcacag?atcgcgcacg?cccgcgagct 3180
gatcgaccag?gaaggccgca?ccgtgaaaga?ggcggctgca?ctgcttggcg?tgcatcgctc 3240
gaccctgtac?cgcgcacttg?agcgcagcga?ggaagtgacg?cccaccgagg?ccaggcggcg 3300
cggtgccttc?cgtgaggacg?cattgaccga?ggccgacgcc?ctggcggccg?ccgagaatga 3360
acgccaagag?gaacaagcat?gaaaccgcac?caggacggcc?aggacgaacc?gtttttcatt 3420
accgaagaga?tcgaggcgga?gatgatcgcg?gccgggtacg?tgttcgagcc?gcccgcgcac 3480
gtctcaaccg?tgcggctgca?tgaaatcctg?gccggtttgt?ctgatgccaa?gctggcggcc 3540
tggccggcca?gcttggccgc?tgaagaaacc?gagcgccgcc?gtctaaaaag?gtgatgtgta 3600
tttgagtaaa?acagcttgcg?tcatgcggtc?gctgcgtata?tgatgcgatg?agtaaataaa 3660
caaatacgca?aggggaacgc?atgaaggtta?tcgctgtact?taaccagaaa?ggcgggtcag 3720
gcaagacgac?catcgcaacc?catctagccc?gcgccctgca?actcgccggg?gccgatgttc 3780
tgttagtcga?ttccgatccc?cagggcagtg?cccgcgattg?ggcggccgtg?cgggaagatc 3840
aaccgctaac?cgttgtcggc?atcgaccgcc?cgacgattga?ccgcgacgtg?aaggccatcg 3900
gccggcgcga?cttcgtagtg?atcgacggag?cgccccaggc?ggcggacttg?gctgtgtccg 3960
cgatcaaggc?agccgacttc?gtgctgattc?cggtgcagcc?aagcccttac?gacatatggg 4020
ccaccgccga?cctggtggag?ctggttaagc?agcgcattga?ggtcacggat?ggaaggctac 4080
aagcggcctt?tgtcgtgtcg?cgggcgatca?aaggcacgcg?catcggcggt?gaggttgccg 4140
aggcgctggc?cgggtacgag?ctgcccattc?ttgagtcccg?tatcacgcag?cgcgtgagct 4200
acccaggcac?tgccgccgcc?ggcacaaccg?ttcttgaatc?agaacccgag?ggcgacgctg 4260
cccgcgaggt?ccaggcgctg?gccgctgaaa?ttaaatcaaa?actcatttga?gttaatgagg 4320
taaagagaaa?atgagcaaaa?gcacaaacac?gctaagtgcc?ggccgtccga?gcgcacgcag 4380
cagcaaggct?gcaacgttgg?ccagcctggc?agacacgcca?gccatgaagc?gggtcaactt 4440
tcagttgccg?gcggaggatc?acaccaagct?gaagatgtac?gcggtacgcc?aaggcaagac 4500
cattaccgag?ctgctatctg?aatacatcgc?gcagctacca?gagtaaatga?gcaaatgaat 4560
aaatgagtag?atgaatttta?gcggctaaag?gaggcggcat?ggaaaatcaa?gaacaaccag 4620
gcaccgacgc?cgtggaatgc?cccatgtgtg?gaggaacggg?cggttggcca?ggcgtaagcg 4680
gctgggttgt?ctgccggccc?tgcaatggca?ctggaacccc?caagcccgag?gaatcggcgt 4740
gacggtcgca?aaccatccgg?cccggtacaa?atcggcgcgg?cgctgggtga?tgacctggtg 4800
gagaagttga?aggccgcgca?ggccgcccag?cggcaacgca?tcgaggcaga?agcacgcccc 4860
ggtgaatcgt?ggcaagcggc?cgctgatcga?atccgcaaag?aatcccggca?accgccggca 4920
gccggtgcgc?cgtcgattag?gaagccgccc?aagggcgacg?agcaaccaga?ttttttcgtt 4980
ccgatgctct?atgacgtggg?cacccgcgat?agtcgcagca?tcatggacgt?ggccgttttc 5040
cgtctgtcga?agcgtgaccg?acgagctggc?gaggtgatcc?gctacgagct?tccagacggg 5100
cacgtagagg?tttccgcagg?gccggccggc?atggccagtg?tgtgggatta?cgacctggta 5160
ctgatggcgg?tttcccatct?aaccgaatcc?atgaaccgat?accgggaagg?gaagggagac 5220
aagcccggcc?gcgtgttccg?tccacacgtt?gcggacgtac?tcaagttctg?ccggcgagcc 5280
gatggcggaa?agcagaaaga?cgacctggta?gaaacctgca?ttcggttaaa?caccacgcac 5340
gttgccatgc?agcgtacgaa?gaaggccaag?aacggccgcc?tggtgacggt?atccgagggt 5400
gaagccttga?ttagccgcta?caagatcgta?aagagcgaaa?ccgggcggcc?ggagtacatc 5460
gagatcgagc?tagctgattg?gatgtaccgc?gagatcacag?aaggcaagaa?cccggacgtg 5520
ctgacggttc?accccgatta?ctttttgatc?gatcccggca?tcggccgttt?tctctaccgc 5580
ctggcacgcc?gcgccgcagg?caaggcagaa?gccagatggt?tgttcaagac?gatctacgaa 5640
cgcagtggca?gcgccggaga?gttcaagaag?ttctgtttca?ccgtgcgcaa?gctgatcggg 5700
tcaaatgacc?tgccggagta?cgatttgaag?gaggaggcgg?ggcaggctgg?cccgatccta 5760
gtcatgcgct?accgcaacct?gatcgagggc?gaagcatccg?ccggttccta?atgtacggag 5820
cagatgctag?ggcaaattgc?cctagcaggg?gaaaaaggtc?gaaaaggtct?ctttcctgtg 5880
gatagcacgt?acattgggaa?cccaaagccg?tacattggga?accggaaccc?gtacattggg 5940
aacccaaagc?cgtacattgg?gaaccggtca?cacatgtaag?tgactgatat?aaaagagaaa 6000
aaaggcgatt?tttccgccta?aaactcttta?aaacttatta?aaactcttaa?aacccgcctg 6060
gcctgtgcat?aactgtctgg?ccagcgcaca?gccgaagagc?tgcaaaaagc?gcctaccctt 6120
cggtcgctgc?gctccctacg?ccccgccgct?tcgcgtcggc?ctatcgcggc?cgctggccgc 6180
tcaaaaatgg?ctggcctacg?gccaggcaat?ctaccagggc?gcggacaagc?cgcgccgtcg 6240
ccactcgacc?gccggcgccc?acatcaaggc?accctgcctc?gcgcgtttcg?gtgatgacgg 6300
tgaaaacctc?tgacacatgc?agctcccgga?gacggtcaca?gcttgtctgt?aagcggatgc 6360
cgggagcaga?caagcccgtc?agggcgcgtc?agcgggtgtt?ggcgggtgtc?ggggcgcagc 6420
catgacccag?tcacgtagcg?atagcggagt?gtatactggc?ttaactatgc?ggcatcagag 6480
cagattgtac?tgagagtgca?ccatatgcgg?tgtgaaatac?cgcacagatg?cgtaaggaga 6540
aaataccgca?tcaggcgctc?ttccgcttcc?tcgctcactg?actcgctgcg?ctcggtcgtt 6600
cggctgcggc?gagcggtatc?agctcactca?aaggcggtaa?tacggttatc?cacagaatca 6660
ggggataacg?caggaaagaa?catgtgagca?aaaggccagc?aaaaggccag?gaaccgtaaa 6720
aaggccgcgt?tgctggcgtt?tttccatagg?ctccgccccc?ctgacgagca?tcacaaaaat 6780
cgacgctcaa?gtcagaggtg?gcgaaacccg?acaggactat?aaagatacca?ggcgtttccc 6840
cctggaagct?ccctcgtgcg?ctctcctgtt?ccgaccctgc?cgcttaccgg?atacctgtcc 6900
gcctttctcc?cttcgggaag?cgtggcgctt?tctcatagct?cacgctgtag?gtatctcagt 6960
tcggtgtagg?tcgttcgctc?caagctgggc?tgtgtgcacg?aaccccccgt?tcagcccgac 7020
cgctgcgcct?tatccggtaa?ctatcgtctt?gagtccaacc?cggtaagaca?cgacttatcg 7080
ccactggcag?cagccactgg?taacaggatt?agcagagcga?ggtatgtagg?cggtgctaca 7140
gagttcttga?agtggtggcc?taactacggc?tacactagaa?ggacagtatt?tggtatctgc 7200
gctctgctga?agccagttac?cttcggaaaa?agagttggta?gctcttgatc?cggcaaacaa 7260
accaccgctg?gtagcggtgg?tttttttgtt?tgcaagcagc?agattacgcg?cagaaaaaaa 7320
ggatctcaag?aagatccttt?gatcttttct?acggggtctg?acgctcagtg?gaacgaaaac 7380
tcacgttaag?ggattttggt?catgcattct?aggtactaaa?acaattcatc?cagtaaaata 7440
taatatttta?ttttctccca?atcaggcttg?atccccagta?agtcaaaaaa?tagctcgaca 7500
ctgttctt?ccccgatatc?ctccctgatc?gaccggacgc?agaaggcaat?gtcataccac 7560
ttgtccgccc?tgccgcttct?cccaagatca?ataaagccac?ttactttgcc?atctttcaca 7620
aagatgttgc?tgtctcccag?gtcgccgtgg?gaaaagacaa?gttcctcttc?gggcttttcc 7680
gtctttaaaa?aatcatacag?ctcgcgcgga?tctttaaatg?gagtgtcttc?ttcccagttt 7740
tcgcaatcca?catcggccag?atcgttattc?agtaagtaat?ccaattcggc?taagcggctg 7800
tctaagctat?tcgtataggg?acaatccgat?atgtcgatgg?agtgaaagag?cctgatgcac 7860
tccgcataca?gctcgataat?cttttcaggg?ctttgttcat?cttcatactc?ttccgagcaa 7920
aggacgccat?cggcctcact?catgagcaga?ttgctccagc?catcatgccg?ttcaaagtgc 7980
aggacctttg?gaacaggcag?ctttccttcc?agccatagca?tcatgtcctt?ttcccgttcc 8040
acatcatagg?tggtcccttt?ataccggctg?tccgtcattt?ttaaatatag?gttttcattt 8100
tctcccacca?gcttatatac?cttagcagga?gacattcctt?ccgtatcttt?tacgcagcgg 8160
tatttttcga?tcagtttttt?caattccggt?gatattctca?ttttagccat?ttattatttc 8220
cttcctcttt?tctacagtat?ttaaagatac?cccaagaagc?taattataac?aagacgaact 8280
ccaattcact?gttccttgca?ttctaaaacc?ttaaatacca?gaaaacagct?ttttcaaagt 8340
tgttttcaaa?gttggcgtat?aacatagtat?cgacggagcc?gattttgaaa?ccgcggtgat 8400
cacaggcagc?aacgctctgt?catcgttaca?atcaacatgc?taccctccgc?gagatcatcc 8460
gtgtttcaaa?cccggcagct?tagttgccgt?tcttccgaat?agcatcggta?acatgagcaa 8520
agtctgccgc?cttacaacgg?ctctcccgct?gacgccgtcc?cggactgatg?ggctgcctgt 8580
atcgagtggt?gattttgtgc?cgagctgccg?gtcggggagc?tgttggctgg?ctggtggcag 8640
gatatattgt?ggtgtaaaca?aattgacgct?tagacaactt?aataacacat?tgcggacgtt 8700
tttaatgtac?tgaattaacg?ccgaattaat?tcgggggatc?tggattttag?tactggattt 8760
tggttttagg?aattagaaat?tttattgata?gaagtatttt?acaaatacaa?atacatacta 8820
agggtttctt?atatgctcaa?cacatgagcg?aaaccctata?ggaaccctaa?ttcccttatc 8880
tgggaactac?tcacacatta?ttatggagaa?actcgagctt?gtcgatcgac?tctagctaga 8940
ggatcgatcc?gaaccccaga?gtcccgctca?gaagaactcg?tcaagaaggc?gatagaaggc 9000
gatgcgctgc?gaatcgggag?cggcgatacc?gtaaagcacg?aggaagcggt?cagcccattc 9060
gccgccaagc?tcttcagcaa?tatcacgggt?agccaacgct?atgtcctgat?agcggtccgc 9120
cacacccagc?cggccacagt?cgatgaatcc?agaaaagcgg?ccattttcca?ccatgatatt 9180
cggcaagcag?gcatcgccat?gtgtcacgac?gagatcctcg?ccgtcgggca?tgcgcgcctt 9240
gagcctggcg?aacagttcgg?ctggcgcgag?cccctgatgc?tcttcgtcca?gatcatcctg 9300
atcgacaaga?ccggcttcca?tccgagtacg?tgctcgctcg?atgcgatgtt?tcgcttggtg 9360
gtcgaatggg?caggtagccg?gatcaagcgt?atgcagccgc?cgcattgcat?cagccatgat 9420
ggatactttc?tcggcaggag?caaggtgaga?tgacaggaga?tcctgccccg?gcacttcgcc 9480
caatagcagc?cagtcccttc?ccgcttcagt?gacaacgtcg?agcacagctg?cgcaaggaac 9540
gcccgtcgtg?gccagccacg?atagccgcgc?tgcctcgtcc?tggagttcat?tcagggcacc 9600
ggacaggtcg?gtcttgacaa?aaagaaccgg?gcgcccctgc?gctgacagcc?ggaacacggc 9660
ggcatcagag?cagccgattg?tctgttgtgc?ccagtcatag?ccgaatagcc?tctccaccca 9720
agcggccgga?gaacctgcgt?gcaatccatc?ttgttcaatc?cccatggtcg?atcgacagat 9780
ctgcgaaagc?tcgagagaga?tagatttgta?gagagagact?ggtgatttca?gcgtgtcctc 9840
tccaaatgaa?atgaacttcc?ttatatagag?gaaggtcttg?cgaaggatag?tgggattgtg 9900
cgtcatccct?tacgtcagtg?gagatatcac?atcaatccac?ttgctttgaa?gacgtggttg 9960
gaacgtcttc?tttttccacg?atgctcctcg?tgggtggggg?tccatctttg?ggaccactgt 10020
cggcagaggc?atcttgaacg?atagcctttc?ctttatcgca?atgatggcat?ttgtaggtgc 10080
caccttcctt?ttctactgtc?cttttgatga?agtgacagat?agctgggcaa?tggaatccga 10140
ggaggtttcc?cgatattacc?ctttgttgaa?aagtctcaat?agccctttgg?tcttctgaga 10200
ctgtatcttt?gatattcttg?gagtagacga?gagtgtcgtg?ctccaccatg?ttatcacatc 10260
aatccacttg?ctttgaagac?gtggttggaa?cgtcttcttt?ttccacgatg?ctcctcgtgg 10320
gtgggggtcc?atctttggga?ccactgtcgg?cagaggcatc?ttgaacgata?gcctttcctt 10380
tatcgcaatg?atggcatttg?taggtgccac?cttccttttc?tactgtcctt?ttgatgaagt 10440
gacagatagc?tgggcaatgg?aatccgagga?ggtttcccga?tattaccctt?tgttgaaaag 10500
tctcaatagc?cctttggtct?tctgagactg?tatctttgat?attcttggag?tagacgagag 10560
tgtcgtgctc?caccatgttg?gcaagctgct?ctagccaata?cgcaaaccgc?ctctccccgc 10620
gcgttggccg?attcattaat?gcagctggca?cgacaggttt?cccgactgga?aagcgggcag 10680
tgagcgcaac?gcaattaatg?tgagttagct?cactcattag?gcaccccagg?ctttacactt 10740
tatgcttccg?gctcgtatgt?tgtgtggaat?tgtgagcgga?taacaatttc?acacaggaaa 10800
cagctatgac?catgattacg?aattcgagct?cggtacccgg?ggatcctcta?gagtcgacct 10860
gcaggcatgc?aagcttggca?ctggccgtcg?ttttacaacg?tcgtgactgg?gaaaaccctg 10920
gcgttaccca?acttaatcgc?cttgcagcac?atcccccttt?cgccagctgg?cgtaatagcg 10980
aagaggcccg?caccgatcgc?ccttcccaac?agttgcgcag?cctgaatggc?gaatgctaga 11040
gcagcttgag?cttggatcag?attgtcgttt?cccgccttca?gtttagcttc?atggagtcaa 11100
agattcaaat?agaggaccta?acagaactcg?ccgtaaagac?tggcgaacag?ttcatacaga 11160
gtctcttacg?actcaatgac?aagaagaaaa?tcttcgtcaa?catggtggag?cacgacacac 11220
ttgtctactc?caaaaatatc?aaagatacag?tctcagaaga?ccaaagggca?attgagactt 11280
ttcaacaaag?ggtaatatcc?ggaaacctcc?tcggattcca?ttgcccagct?atctgtcact 11340
ttattgtgaa?gatagtggaa?aaggaaggtg?gctcctacaa?atgccatcat?tgcgataaag 11400
gaaaggccat?cgttgaagat?gcctctgccg?acagtggtcc?caaagatgga?cccccaccca 11460
cgaggagcat?cgtggaaaaa?gaagacgttc?caaccacgtc?ttcaaagcaa?gtggattgat 11520
gtgatatctc?cactgacgta?agggatgacg?cacaatccca?ctatccttcg?caagaccctt 11580
cctctatata?aggaagttca?tttcatttgg?agagaacacg?ggggactctt?gac 11633
Claims (2)
1. method that improves protein and combined lysine content in the wheat seed is characterized in that following steps:
A, capsicum high-lysine protein gene cflr expression vector pAHC25-cflr of structure;
B, pAHC25-cflr is imported acceptor wheat immature embryo cell by particle gun;
C, described wheat immature embryo cell is carried out callus of induce, plant regeneration, obtain transgenosis plant to be selected;
D, above-mentioned transgenosis plant to be selected is carried out Molecular Detection, obtain positive transfer-gen plant, positive transfer-gen plant obtains T by selfing and PCR screening
5The transgenosis homozygous lines;
E, detection T
5For the cflr gene expression abundance in the transgenosis homozygous lines progeny seed, the content of protein and combined lysine in the mensuration seed;
F, filter out the transfer-gen plant that protein and combined lysine content are significantly increased in the seed; Wherein said capsicum high-lysine protein gene cflr expression vector pAHC25-cflr obtains by following steps:
A, preparation plasmid PUC18-PCN: with the plasmid pBI2301 that contains Nos3 ' sequence is template, 5 '-GCC
CTGCAGCGTTCAAACATTTGGCAATAAAG-3 ' and 5 '-GCC
AAGCTTCCCGATCTAG-TAACATAGATGAC-3 ' is a primer amplification Nos3 ' sequence, 1% agarose electrophoresis, the PCR product is carried out purifying to be reclaimed, with PUC18 is basic plasmid, adopt restriction enzyme HindIII and PstI that Nos3 ' fragment and PUC18 are carried out complete double digestion respectively, 1% agarose electrophoresis, endonuclease bamhi is reclaimed, connect the recovery fragment with the T4DNA ligase enzyme, transformed into escherichia coli, choose positive colony and extract plasmid and take enzyme to cut the exactness that is connected with the method validation that checks order, obtain plasmid called after PUC18-N; With the capsicum leaf cDNA library of containing the cflr gene coded sequence is template, with primer 5 '-GCC
GGATCCATGGGTTGTGGGGAATCAAAGCACGCAGTT-GC A-3 ' and 5 '-GCC
CTGCAG-TTAATCTGTTTTCAAATCTGTTGT-3 ' amplification cflr gene coded sequence, 1% agarose electrophoresis, the PCR product is carried out purifying to be reclaimed, with PUC18-N is carrier, adopt restriction enzyme BamHI and PstI that cflr gene coded sequence and PUC18-N carrier are carried out complete double digestion respectively, 1% agarose electrophoresis, endonuclease bamhi is reclaimed, connect the recovery fragment with the T4DNA ligase enzyme, transformed into escherichia coli, choose positive colony and extract plasmid and take enzyme to cut the exactness that is connected with the method validation that checks order, obtain plasmid called after PUC18-CN; With the rice genome that contains the pGluB gene promoter is template, with primer 5 ' GCC
GAGCTCAAGCTTTTTTTGAGGAATTTT AGAAGTTGAACAG-3 ' and 5 '-GCC
GGATCC-CTTAAGCTAATTGAT-GTGAGTTCAAAG-3 ' increase the pGluB full length sequence, 1% agarose electrophoresis, the PCR product is carried out purifying to be reclaimed, with PUC18-CN is carrier, adopt restriction enzyme BamHI and SacI that pGluB and PUC18-CN are carried out complete double digestion respectively, 1% agarose electrophoresis, endonuclease bamhi is reclaimed, connect the recovery fragment with the T4DNA ligase enzyme, transformed into escherichia coli, choose positive colony and extract plasmid and take enzyme to cut the exactness that is connected with the method validation that checks order, obtain plasmid called after PUC18-PCN; B, preparation pAHC25-Cflr expression vector: adopt restriction enzyme HindIII that the PUC18-PCN plasmid DNA is carried out complete degestion, downcut pGluB+cflr+Nos3 ' mosaic gene fragment, adopt 0.8% agarose electrophoresis, the endonuclease bamhi about 2.24kb is reclaimed; Adopt restriction enzyme HindIII that the pAHC25 plasmid DNA is carried out complete degestion, excise original expression cassette, adopt 0.8% agarose electrophoresis, the endonuclease bamhi about 5.5kb is reclaimed; Use T
4Dna ligase reclaims fragment to two and connects, transformed into escherichia coli, choose positive colony and extract plasmid and take enzyme to cut the exactness that is connected with the method validation that checks order, obtain plasmid called after pAHC25-cflr, be the expression vector of capsicum high-lysine protein gene cflr.
2. a kind of method that improves protein and combined lysine content in the wheat seed according to claim 1 is characterized in that described Molecular Detection is PCR and RT-PCR analytical procedure.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102630847A CN101818169B (en) | 2009-12-16 | 2009-12-16 | Method for improving content of protein and combined lysine in wheat seeds |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102630847A CN101818169B (en) | 2009-12-16 | 2009-12-16 | Method for improving content of protein and combined lysine in wheat seeds |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101818169A CN101818169A (en) | 2010-09-01 |
| CN101818169B true CN101818169B (en) | 2011-11-23 |
Family
ID=42653445
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102630847A Expired - Fee Related CN101818169B (en) | 2009-12-16 | 2009-12-16 | Method for improving content of protein and combined lysine in wheat seeds |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101818169B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102417913A (en) * | 2011-12-09 | 2012-04-18 | 江苏省农业科学院 | Method for improving salt tolerance of wheat |
| CN103484473B (en) * | 2013-09-04 | 2014-11-19 | 中国农业大学 | High-lysine/protein gene GhLRP and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1128881C (en) * | 2001-05-29 | 2003-11-26 | 中国农业大学 | Method for improving quality of gramineous crops |
| CN1128877C (en) * | 2001-05-29 | 2003-11-26 | 中国农业大学 | High-lysine protein gene and method for increasing content of lysine and protein in seeds of gramineous crops |
-
2009
- 2009-12-16 CN CN2009102630847A patent/CN101818169B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1128881C (en) * | 2001-05-29 | 2003-11-26 | 中国农业大学 | Method for improving quality of gramineous crops |
| CN1128877C (en) * | 2001-05-29 | 2003-11-26 | 中国农业大学 | High-lysine protein gene and method for increasing content of lysine and protein in seeds of gramineous crops |
Non-Patent Citations (4)
| Title |
|---|
| Sun X.et al.Capsicum frutescens lysine-rich protein (Cflr) mRNA |
| Sun,X.et al.Capsicum frutescens lysine-rich protein (Cflr) mRNA, complete cds.《GenBank:EU367999.1》.2008,1. * |
| YU JJ et al..Seed-specific expres sion of a lysine richprotein sb401gene significantly increases both lysine and total proteincontent in nlaize seeds.《Mol Breeding》.2004,第14卷(第1期),1-7. * |
| 孙晓波等.辣椒高赖氨酸蛋白基因cflr全长cDNA的克隆及其组织表达特征.《园艺学报》.2008,第35卷(第9期),1310-1316. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101818169A (en) | 2010-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107475256A (en) | It is a kind of based on more target sequence sgRNA expression vectors of endogenous tRNA systems of processing and its application in plant gene editor | |
| Jiang et al. | Sucrose metabolism gene families and their biological functions | |
| CN109652440A (en) | Application of the VQRn-Cas9&PmCDA1&UGI base editing system in plant gene editor | |
| Liu et al. | Identification and phylogenetic analysis of a novel starch synthase in maize | |
| CN109593776B (en) | Method for quickly and efficiently obtaining non-transgenic directional gene mutant plant and application | |
| CN106906214A (en) | Novel plant terminator sequence | |
| Chatterjee et al. | Reduced expression of a protein homologous to glycogenin leads to reduction of starch content in Arabidopsis leaves | |
| CN102264906A (en) | Vegetabile material, plants and a method of producing a plant having altered lignin properties | |
| Wan et al. | Mutant transcriptome sequencing provides insights into pod development in peanut (Arachis hypogaea L.) | |
| BRPI0719295B1 (en) | Method for determining the ability of a plant to accumulate sugar and to alter the ability of a plant to accumulate sugar | |
| CN113862283B (en) | Application of TGS1 gene in regulation and control of rice grain size and yield | |
| Feng et al. | GmPGL1, a thiamine thiazole synthase, is required for the biosynthesis of thiamine in soybean | |
| US20100175144A1 (en) | Cinnamyl-alcohol dehydrogenases | |
| German et al. | Cloning, expression and characterization of LeFRK3, the fourth tomato (Lycopersicon esculentum Mill.) gene encoding fructokinase | |
| CN101818169B (en) | Method for improving content of protein and combined lysine in wheat seeds | |
| CN114164230A (en) | Expression vector suitable for sugarcane genetic transformation and construction method and application thereof | |
| CN114317590B (en) | Method for mutating base C in plant genome into base T | |
| CN111321167B (en) | Construction method and application of heterologous protein expressed rolling circle replication recombinant vector | |
| WO2015103193A1 (en) | Maize cytoplasmic male sterility (cms) s-type restorer gene rf3 | |
| CN114317561B (en) | CRISPR/Cas 9-based broccoli gene fixed-point editing method | |
| CN108913715A (en) | A kind of construction method of plant expression plasmid carrier containing FLAG protein fusion label and its carrier | |
| CN102417913A (en) | Method for improving salt tolerance of wheat | |
| Sage et al. | Improving photosynthesis in rice: from small steps to giant leaps | |
| Du et al. | Molecular cloning and functional characterisation of the galactolipid biosynthetic gene TaMGD in wheat grain | |
| CN112940092B (en) | Corn ZmbHLH124 protein and application of coding gene thereof in regulating and controlling plant drought tolerance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111123 Termination date: 20121216 |