CN101200725B - Separating clone of rice wide compatibility gene S5 and uses thereof - Google Patents

Abstract

The present invention relates to the technical field of plant gene engineering and concretely relates to the separation clone of paddy wide compatibility gene S5, a function validation and an application thereof for improving the paddy. The segment of the gene contains paddy wide compatibility gene coding aspartic proteinase. Subspecific Indica-Japonica paddy has strong hybrid advantage than varietal paddy, but the sterility of the subspecific Indica-Japonica hybrid restricts using the hybrid advantage thereof. The wide compatibility gene cloned by the present invention can conquer the sterility of the subspecific Indica-Japonica hybrid of the paddy and accordingly uses the strong hybrid advantage of the subspecific Indica-Japonica to further improve the output of the paddy.

Description

The separating clone of rice wide compatibility gene S 5 and application

Technical field

The present invention relates to the plant gene engineering technology field.Be specifically related to a kind of separating clone, functional verification and the application in rice modification of rice wide compatibility gene S 5.

Background technology

Paddy rice belongs to the Oryza (Oryzeae) of Gramineae (Gramineae), Agrostidoideae (Pooideae), is divided into two cultivation seed rice: Asia cultivated rice (Oryza sativa L.) and African cultivated rice (Oryza glaberrima).The Asia cultivated rice is divided into Xian subspecies (ssp.indica) and round-grained rice subspecies (ssp.japonica) again.Two subspecies exist evident difference in form and heredity, also exist simultaneously dysgenesia, subspecies indica and japonica hybrid often shows as sterile or half sterile (Kato S, Kosaka H, Hara S (1928) On the affinity of ricevarieties as shown by fertility of hybrid plants.Bull Sci Fac Agric Kyushu Univ, 3:132-147; Oka HI (1988) Origin of cultivated rice.Scientific Societies Press, Tokyo, Japan pp 181-209; Liu KD, Zhou ZQ, Xu CG, Zhang Q, Saghai Maroof MA (1996) An analysis of hybrid sterility in riceusing a diallel cross of 21 parents involving indica, japonica and wide compatibility varieties.Euphytica 90:275-280).Have than hybrid vigour stronger between rice varieties between the paddy rice indica and japonica subspecies, but the sterility of subspecies indica and japonica hybrid has limited its heterotic utilization.Japan scholar Ikehashi and Araki (Ikehashi H, Araki H (1984) Varietyscreening of compatibility types revealed in F1 fertility of distant cross in rice.Jpn J Breed34:304-313), by research to 74 kinds of different ecological type rice varieties intermolecular hybrid results, find the hybridization of some rice varieties and indica rice, hybrid all shows as and can educate, their rice varieties that these are special be called wide affine kind (Wide Compatibility Variety, WCV).Wide compatibility gene in the wide affine kind of paddy rice can effectively overcome the sterility of subspecies indica and japonica hybrid.

The investigator utilizes various genetic markers that the sterile phenomenon of paddy rice subspecies indica and japonica hybrid has been carried out extensive studies.Studies show that the site that influences the small ear fertility corresponds respectively to blastular fertility and pollen fertility, illustrate that male abortion and female abortion all have very important effect to the inter subspecific hybrid abortion.

Ikehashi and Araki (Ikehashi H, Araki H (1986) Genetics of F1 sterility in remote crosses ofrice.In:IRRI (ed) Rice genetics.IRRI, Manila, pp 119-130) at first wide compatibility gene is positioned between the 6th chromosomal chromogene C and the glutinous trait gene wx, and called after S5.They point out that by the investigation to the fertility separating resulting S5 site is one group of multiple allelomorphos: S5-n (extensively affine), S5-i (long-grained nonglutinous rice), S5-j (japonica rice).Wherein, by the zygote that S5-n/S5-n, S5-n/S5-i, S5-n/S5-j combine, hybrid fertile is normal.And, then show as sterile or half sterile by the zygote that S5-j/S5-i forms.

The discovery of wide affine kind makes the utilization of paddy rice subspecies indica and japonica hybrid advantage become possibility.The present invention is intended to further improve the biological yield of hybrid rice by to powerful hybrid vigour between the research better utilised paddy rice indica and japonica subspecies of rice wide compatibility gene S 5.

Summary of the invention

The objective of the invention is rice wide compatibility gene S 5 of separating clone from paddy rice, this gene is carried out functional verification and the application in rice modification.Described gene and aspartyl protease gene order height homology.Utilize this gene to overcome the sterility of paddy rice subspecies indica and japonica hybrid, thereby hybrid vigour powerful between indica and japonica subspecies is brought into play, further improve the biological yield of paddy rice.

The present invention relates to separate and use the dna fragmentation of the wide compatibility gene S 5 of a coding aspartyl protease, and this segmental mechanism of action is set forth.Wherein, described fragment perhaps is equivalent to the height homologous DNA sequence shown in the SEQ ID NO:1-3 basically shown in sequence table SEQ ID NO:1-3, and perhaps its function is equivalent to the subfragment of sequence shown in the SEQ ID NO:1-3.

Can adopt the dna fragmentation of the wide compatibility gene S 5 of having cloned to make probe, screening obtains gene of the present invention or homologous gene from cDNA and genomic library.Equally, also can adopt round pcr, from genome, mRNA and cDNA amplification obtain S5 gene of the present invention and any interested section of DNA or with its homologous section of DNA.Adopt above technology, can separate the sequence that obtains comprising the S5 gene,, can obtain the wide affine transfer-gen plant of long-grained nonglutinous rice japonica rice with this sequence and any expression vector transformed plant that can guide foreign gene in plant, to express.Gene of the present invention can add any strong promoter or inducible promoter in being building up to plant expression vector the time before its transcription initiation Nucleotide.Gene of the present invention also can use enhanser in being building up to plant expression vector the time, and these enhanser zones can be ATG initiator codon and neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the translation of whole sequence.

Carrying S5 expression carrier of the present invention can be by using Ti-plasmids, plant viral vector, directly DNA transforms, microinjection, conventional biotechnological means such as electroporation imports vegetable cell (Weissbach (1998) Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2ndEdition)).Can use to comprise S5 expression carrier rice transformation long-grained nonglutinous rice of the present invention and japonica rice subspecies, cultivate wide affine kind.

The present invention will be further described below in conjunction with specific embodiment.

Description of drawings

Sequence table SEQ ID No:1 shows be separating clone of the present invention include S5-n gene coding region sequence dna fragment.Sequence table SEQ IDNo:2 shows be separating clone of the present invention include S5-j gene coding region sequence dna fragment.Sequence table SEQ ID No:3 shows be separating clone of the present invention include S5-i gene coding region sequence dna fragment.

Fig. 1: S5 gene clone and isolation identification schema.

Fig. 2: long-grained nonglutinous rice, japonica rice and wide affine kind hybrid fertile synoptic diagram under the S5 genetic effect.

Fig. 3: complementary vector construction synoptic diagram.

Fig. 4: the structure of genetic transformation carrier pCAMBIA1301.

Fig. 5: T ₁Can educate with negative plant (right side) small ear of transgenosis for transgenic positive plant (left side) small ear is sterile.

Fig. 6: T ₁All can educate for negative plant (a) of transgenosis and transgenic positive plant (b) pollen.

Fig. 7: T ₁Can educate and the abortion of transgenic positive plant (b) blastular for negative plant (a) blastular of transgenosis.Scale length 50 μ m.

Fig. 8: T ₀For transgenic positive plant and negative plant (a) of transgenosis and T ₁For transgenic positive plant and negative plant (b) blastular of transgenosis fertility, pollen fertility and small ear fertility diagram.

Fig. 9: wide affine kind, japonica rice and long-grained nonglutinous rice S5 gene cDNA structural representation.

Figure 10: wide affine kind, japonica rice and long-grained nonglutinous rice S5 protein structure synoptic diagram.

Figure 11: the S5 gene is the expression level synoptic diagram in the rice at whole growth periods different tissues.The chip data that uses comprises 25 kinds of different tissues under long-grained nonglutinous rice Zhenshan 97 and Minghui 63 different growing stages.

Figure 12: vitro detection S5 albumen absolute activity (a) and relative reactivity (b).Wherein absolute activity is blank determination with water, and relative reactivity is a blank determination with the highest point of this protein-active.White histogram signal proteolytic enzyme is active under condition of different pH, and dark histogram signal protease activity is suppressed by pepstatin A.

Figure 13: SDS-PAGE glue figure shows S5 albumen self montage activity under condition of different pH.

Figure 14: the expressive site of S5 gene in paddy rice determined in situ hybridization.(a) this gene is expressed at Ballila integument and sporocyte; (b) this gene is expressed in 02428 megarchidium and sporocyte; (c) this gene is expressed in the Ballila microsporocyte.Scale length is 25 μ m.

Embodiment

Following examples further define the present invention, and have described the method (the invention flow process as shown in Figure 1) that the present invention's separating clone on above-mentioned previous work basis includes the dna fragmentation and the checking S5 gene function of S5 gene complete coding section.According to following description and these embodiment, those skilled in the art can determine essential characteristic of the present invention, and under the situation that does not depart from spirit and scope of the invention, the present invention are made various changes and modification, so that its suitable various uses and condition.

Embodiment 1: separating clone includes the dna fragmentation of S5 constant gene segment C

1. utilize map based cloning technical evaluation rice wide compatibility gene S 5

Three parents have been used when making up target group among the present invention: 02428, Nanjing 11 and Balilla.02428 is the wide affine kind of a round-grained rice type, be to select two japonica rice variety Yunnan crab paddy and Shanghai Ji Bang rice for use, handle with radioinduction respectively, and the storeroom that filters out through high light efficiency hybridization, (the Zou Jiangshi etc. that seed selection becomes from the offspring, wide affine choosing is 02428 Preliminary Exploitation at Hybrids of Indica and Japonica. Scientia Agricultura Sinica, and 1989,22:6-14).The middle Xian kind that Nanjing 11 is bred for the academy of agricultural sciences, Jiangsu belongs to the triumph Xian strain of deriving.Bali draws (Balilla) to draw from gondola round-grained rice type kind.

The present invention has made up three friendship F that comprise 7000 individual plants in previous work ₁Large group.Spring in 1999 was prepared 11 cross combinations of 02428/ Nanjing in Lingshui, Hainan.Plant F in Wuhan summer in the same year ₁For plant, screen positive individual plant.Winter in 1999,, and divide the container made of bamboo, wicker, ratten, etc. with base, Lingshui, hybrid rice container made of bamboo, wicker, ratten, etc. migration Hainan as far as possible.In 2000 springs, as female parent, hand over F with a large amount of preparations three of Balilla with 02428/ Nanjing, the 11 true hybrid rice container made of bamboo, wicker, ratten, etc.s ₁Hybrid.Summer in 2000,, divide individual plant plant 02428/ Nanjing 11//Balilla three to hand over F in Hua Zhong Agriculture University (Wuhan) rice test field in paddy growth season ₁Colony becomes seedling 7000 strains at last altogether.

Investigate 7000 strains three and hand over F ₁The individual plant of all high setting percentages in the colony has obtained the setting percentage of strain more than 1000 altogether at the individual plant more than 70%.Therefrom picked at random 202 strain setting percentages carry out DNA extracting and labeled analysis at the true hybrid individual plant more than 70%, the molecule marker of S5 section is recombinated to exchange analyze.The extracting of DNA is carried out (Murray MG, Thompson W F (1980) Rapid isolation of high molecular weight plant DNA.Nucl Acids Res.8:4321-4325) by the CTAB method of Murray and Thompson.The rflp analysis of molecule marker, comprise that the DNA enzyme is cut, electrophoresis, commentaries on classics film and hybridization, undertaken by people's such as Liu (Liu K D et al. (1997) A genome-wideanalysis of wide compatibility in rice and the precise location of the S5 locus in the molecularmap.Theor Appl Genet.95:809-814) experimental arrangement.The S5 gene is limited between molecule marker N29 and the 23D12R, and the result is as shown in table 1.

Table 1 utilizes the location of 202 plant height setting percentage individual plants to wide compatibility gene

Choose SSR mark RM253 or PCR-RFLP mark C11 and RG213 the individual plant of all high setting percentages is scanned, individual plant is used SSR mark RM276 and RM225 screens.Wherein, mark RM225, RM253 and C11 are positioned at the side of gene S5, and mark RG213 and RM276 are positioned at the opposite side of gene S5.Screened 44 strains altogether the individual plant of reorganization has taken place between mark.The molecule marker that utilizes the S5 section has carried out recombination analysis to the reorganization individual plant of this 44 plant height setting percentage, and the result shows that wide compatibility gene S 5 is limited between molecule marker 7B1 and the 15D2, and respectively there is a reorganization individual plant at two ends, and the recombinate information of individual plant of part is as shown in table 2.

Table 2 utilizes the gene type assay (partial data) of the molecule marker of S5 section to 44 strains reorganization individual plant

^aGenotype?0?of?each?locus?was?composed?of?an?allele?from?02428?and?an?allele?from?Balilla

^bGenotype?1?of?each?locus?was?composed?of?an?allele?from?Nanjing?11?and?an?allele?from?Balilla

The above results is positioned at wide compatibility gene S 5 on the DNA section of about 40kb between two subclone molecule marker 7B1 and the 15D2.Utilize the FGENSH software on the http://www.softberry.com website dna fragmentation of 40kb between molecule marker 7B1 and the 15D2 to be carried out the prediction of open reading frame (open reading frame:ORF), detected 5 complete ORF s altogether, Blaxt X homology analysis is found candidate gene ORF5 and aspartate protease (eukaryotic aspartyl protease) height homology.

2. the performance of the structure of genetic transformation carrier and transfer-gen plant

Gene S5 of the present invention site is one group of multiple allelomorphos: S5-n (extensively affine), S5-i (long-grained nonglutinous rice), S5-j (japonica rice).Wherein, by the zygote that S5-n/S5-n, S5-n/S5-i, S5-n/S5-j combine, hybrid fertile is normal.And, then show as sterile or half sterile (Fig. 2) by the zygote that S5-j/S5-i forms.According to the function of this gene, the applicant takes the long-grained nonglutinous rice fragment is changed over to the strategy of japonica rice plant, verifies from the fertility phenotype of transfer-gen plant (genotype S5-j/S5-j+S5-i).This gene will produce sterile phenotype.

Complementary construction of carrier is: according to long-grained nonglutinous rice Nanjing 11 genome sequences design PCR primer ASPHF (5 '-TAAAAAGCTTCATCATGGGCTGCTGCTAGATGGA-3 ') and ASPHR (5 '-TGCTAAGCTTTACGAGGTCATGGGTTGAAGTCCT-3 ') the candidate gene section is increased out, the used reagent of complementary carrier external source pcr amplification reaction is from Takara company, reaction conditions is: 94 ℃, and 3min; 94 ℃, 1min, 60 ℃, 1min, 68 ℃, 6min, 30cycles; 72 ℃, 5min.

Complementary vector construction synoptic diagram as shown in Figure 3.The PCR product is directly cut with the HindIII enzyme, binary vector (Fig. 4) pCAMBIA1301 is (from Australian CAMBIA laboratory (Center for the Application of Molecular Biology to InternationalAgriculture), carry the agriculture bacillus mediated genetic transformation carrier of the corn strong promoter Ubiquitinl with composing type and overexpression feature) also adopt the HindIII enzyme to cut, connect behind the dephosphorylation.Transformed into escherichia coli DH10 β (available from Invitrogen company), screening positive clone.The employing agrobacterium mediation method transforms, agrobacterium strains is super virulent strain EHA105 (Sun X, Cao Y, Yang Z, Xu C, Li X, Wang S, Zhang Q (2004) Xa26, a gene conferring resistance to Xanthomonas oryzae pv.oryzae inrice, encoding a LRR receptor kinase-like protein.Plant J 37:517-527), genetically modified acceptor is japonica rice variety Balilla.

The key step of genetic transformation of the present invention, substratum and compound method thereof are as described below:

(1) reagent and solution abbreviation

The abbreviation of the used plant hormone of substratum is expressed as follows among the present invention: 6-BA (6-BenzylaminoPurine, 6-benzyladenine); CN (Carbenicillin, Pyocianil); KT (Kinetin, kinetin); NAA (Napthalene acetic acid, naphthylacetic acid); IAA (Indole-3-acetic acid, indolylacetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid, 2,4 dichlorophenoxyacetic acid); AS (Acetosringone, Syringylethanone); CH (Casein Enzymatic Hydrolysate, caseinhydrolysate); HN (Hygromycin B, Totomycin); DMSO (Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); N6max (N6 macroelement composition solution); N6mix (N6 trace element composition solution); MSmax (MS macroelement composition solution); MSmix (MS trace element composition solution)

(2) main solution formula

1) N6 substratum macroelement mother liquor (according to 10 times of concentrated solutions (10X) preparation)

Saltpetre (KNO ₃) 28.3 grams

Potassium primary phosphate (KH ₂PO ₄) 4.0 grams

Ammonium sulfate ((NH ₄) ₂SO ₄) 4.63 grams

Sal epsom (MgSO ₄7H ₂O) 1.85 grams

Calcium chloride (CaCl ₂2H ₂O) 1.66 grams

Mentioned reagent is dissolved one by one, be settled to 1000 milliliters with distilled water under the room temperature then.

2) N6 substratum trace element mother liquor (is prepared according to 100 times of concentrated solutions (100X)

Potassiumiodide (KI) 0.08 gram

Boric acid (H ₃BO ₃) 0.16 gram

Manganous sulfate (MnSO ₄4H ₂O) 0.44 gram

Zinc sulfate (ZnSO ₄7H ₂O) 0.15 gram

Mentioned reagent is at room temperature dissolved and be settled to 1000 milliliters with distilled water.

3) molysite (Fe ₂EDTA) stock solution (according to the preparation of 100X concentrated solution)

With 3.73 gram b diammonium disodium edta (Na ₂EDTA2H ₂O) and 2.78 the gram FeSO ₄7H ₂O dissolves respectively, mixes and is settled to 1000 milliliters with distilled water, bathes 2 hours to 70 ℃ of temperature, and 4 ℃ of preservations are standby.

4) VITAMIN stock solution (according to the preparation of 100X concentrated solution)

Nicotinic acid (Nicotinic acid) 0.1 gram

VITMAIN B1 (Thiamine HCl) 0.1 gram

Vitamin B6 (Pyridoxine HCl) 0.1 gram

Glycine (Glycine) 0.2 gram

Inositol (Inositol) 10 grams

Adding distil water is settled to 1000 milliliters, and 4 ℃ of preservations are standby.

5) MS substratum macroelement mother liquor (MSmax mother liquor) (according to the preparation of 10X concentrated solution)

Ammonium nitrate (NH ₄NO ₃) 16.5 grams

Saltpetre 19.0 grams

Potassium primary phosphate 1.7 grams

Sal epsom 3.7 grams

Calcium chloride 4.4 grams

Mentioned reagent is at room temperature dissolved, and be settled to 1000 milliliters with distilled water.

6) MS substratum trace element mother liquor (MSmin mother liquor) (according to the preparation of 100X concentrated solution)

Manganous sulfate (MnSO ₄4H ₂O) 2.23 grams

Zinc sulfate (ZnSO ₄7H ₂O) 0.86 gram

Boric acid (H ₃BO ₃) 0.62 gram

Potassiumiodide (KI) 0.083 gram

Sodium orthomolybdate (Na ₂MoO ₄2H ₂O) 0.025 gram

Copper sulfate (CuSO ₄5H ₂O) 0.0025 gram

Cobalt chloride (CoCl ₂6H ₂O) 0.0025 gram

Mentioned reagent is at room temperature dissolved, and be settled to 1000 milliliters with distilled water.

7) 2, the preparation of 4-D stock solution (1 mg/ml);

Weigh 2,100 milligrams of 4-D dissolved 5 minutes with 1 milliliter of 1N potassium hydroxide, added then to be settled to 100 milliliters after 10 ml distilled waters dissolve fully, preserved under room temperature.

8) preparation of 6-BA stock solution (1 mg/ml):

Weigh 100 milligrams of 6-BA,, be settled to 100 milliliters, room temperature preservation after adding the dissolving fully of 10 ml distilled waters then with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes.

9) preparation of naphthylacetic acid (NAA) stock solution (1 mg/ml):

Weigh 100 milligrams of NAA, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, be settled to 100 milliliters after adding the dissolving fully of 10 ml distilled waters then, 4 ℃ of preservations are standby.

10) preparation of indolylacetic acid (IAA) stock solution (1 mg/ml):

Weigh 100 milligrams of IAA, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, be settled to 100 milliliters after adding the dissolving fully of 10 ml distilled waters then, 4 ℃ of preservations are standby.

11) preparation of glucose stock solution (0.5 grams per milliliter):

Weigh glucose 125 grams, be settled to 250 milliliters with dissolved in distilled water then, the back 4 ℃ of preservations of sterilizing are standby.

12) preparation of AS stock solution:

Weigh AS 0.392 gram, add 10 milliliters of dissolvings of DMSO, divide to be filled in 1.5 milliliters of centrifuge tubes, 4 ℃ of preservations are standby.

13) 1N potassium hydroxide stock solution

Weigh potassium hydroxide 5.6 grams, be settled to 100 milliliters with dissolved in distilled water, room temperature preservation is standby.

(3) be used for the culture medium prescription that rice genetic transforms

1) inducing culture

100 milliliters in N6max mother liquor (getting the 10X concentrated solution that has prepared, down together)

10 milliliters in N6mix mother liquor (getting the 100X concentrated solution that has prepared, down together)

Fe ²⁺10 milliliters of EDTA stock solutions (getting the 100X concentrated solution that has prepared, down together)

10 milliliters of VITAMIN stock solutions (getting the 100X concentrated solution that has prepared, down together)

2,2.5 milliliters of 4-D stock solutions (get above-mentioned prepare)

Proline(Pro) (Proline) 0.3 gram

CH 0.6 gram

Sucrose 30 grams

Phytagel 3 grams

Adding distil water to 900 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, boil and be settled to 1000 milliliters, divide and install to 50 milliliters of triangular flasks (25 milliliters/bottle), sterilization according to a conventional method after sealing (for example sterilized 25 minutes down for 121 ℃, following medium sterilization method is identical with the sterilising method of basal culture medium).

2) subculture medium

100 milliliters in N6max mother liquor (10X)

10 milliliters in N6mix mother liquor (100X)

Fe ²⁺10 milliliters of EDTA stock solutions (100X)

10 milliliters of VITAMIN stock solutions (100X)

2,2.0 milliliters of 4-D stock solutions

Proline(Pro) 0.5 gram

CH 0.6 gram

Sucrose 30 grams

Phytagel 3 grams

Adding distil water to 900 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, boils and is settled to 1000 milliliters, divides to install to 50 milliliters of triangular flasks (25 milliliters/bottle), seals, as stated above sterilization.

3) pre-culture medium

12.5 milliliters in N6max mother liquor (10X)

1.25 milliliters in N6mix mother liquor (100X)

Fe ²⁺2.5 milliliters of EDTA stock solutions (100X)

2.5 milliliters of VITAMIN stock solutions (100X)

2,0.75 milliliter of 4-D stock solution

CH 0.15 gram

Sucrose 5 grams

Agar powder 1.75 grams

Adding distil water to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.6, seals, as stated above sterilization.Use preceding heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/ware) in the culture dish are poured in packing into.

4) be total to substratum

12.5 milliliters in N6max mother liquor (10X)

1.25 milliliters in N6mix mother liquor (100X)

Fe ²⁺2.5 milliliters of EDTA stock solutions (100X)

2.5 milliliters of VITAMIN stock solutions (100X)

2,0.75 milliliter of 4-D stock solution

CH 0.2 gram

Sucrose 5 grams

Agar powder 1.75 grams

Adding distil water to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.6, seals, as stated above sterilization.Use preceding heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/every ware) in the culture dish are poured in packing into.

5) suspension culture base

5 milliliters in N6max mother liquor (10X)

0.5 milliliter in N6mix mother liquor (100X)

Fe ²⁺0.5 milliliter of EDTA stock solution (100X)

1 milliliter of VITAMIN stock solution (100X)

2,0.2 milliliter of 4-D stock solution

CH 0.08 gram

Sucrose 2 grams

Adding distil water to 100 milliliter is regulated pH value to 5.4, divides in the triangular flask that installs to two 100 milliliters, seals, as stated above sterilization.Add 1 milliliter of aseptic glucose stock solution and 100 microlitre AS stock solutions before using.

6) select substratum

25 milliliters in N6max mother liquor (10X)

2.5 milliliters in N6mix mother liquor (100X)

Fe ²⁺2.5 milliliters of EDTA stock solutions (100X)

2.5 milliliters of VITAMIN stock solutions (100X)

2,0.625 milliliter of 4-D stock solution

CH 0.15 gram

Sucrose 7.5 grams

Agar powder 1.75 grams

Adding distil water to 250 milliliter is regulated pH value to 6.0, seals, as stated above sterilization.

Dissolving substratum before using adds 250 microlitre HN (50 mg/ml) and (25 milliliters/ware) in the culture dish are poured in 400 microlitre CN (250 mg/ml) packing into.(annotate: selecting substratum Pyocianil concentration for the first time is 400 mg/litre, and selecting substratum Pyocianil concentration for the second time and later on is 250 mg/litre).

7) break up substratum in advance

25 milliliters in N6max mother liquor (10X)

2.5 milliliters in N6mix mother liquor (100X)

Fe ²⁺2.5 milliliters of EDTA stock solutions (100X)

2.5 milliliters of VITAMIN stock solutions (100X)

0.5 milliliter of 6-BA stock solution

0.5 milliliter of KT stock solution

NAA stock solution 50 microlitres

IAA stock solution 50 microlitres

CH 0.15 gram

Sucrose 7.5 grams

Agar powder 1.75 grams

Adding distil water to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, seals, as stated above sterilization.Dissolving substratum before using, 250 microlitre HN (50 mg/ml), 250 microlitre CN (250 mg/ml), (25 milliliters/ware) in the culture dish are poured in packing into.

8) division culture medium

100 milliliters in N6max mother liquor (10X)

10 milliliters in N6mix mother liquor (100X)

Fe ²⁺10 milliliters of EDTA stock solutions (100X)

10 milliliters of VITAMIN stock solutions (100X)

2 milliliters of 6-BA stock solutions

2 milliliters of KT stock solutions

0.2 milliliter of NAA stock solution

0.2 milliliter of IAA stock solution

CH 1 gram

Sucrose 30 grams

Phytagel 3 grams

Adding distil water to 900 milliliter, 1N potassium hydroxide is regulated pH value to 6.0.

Boil and be settled to 1000 milliliters, divide to install to 50 milliliters of triangular flasks (50 milliliters/bottle), seal, as stated above sterilization with distilled water.

9) root media

50 milliliters in MSmax mother liquor (10X)

5 milliliters in MSmix mother liquor (100X)

Fe ²⁺5 milliliters of EDTA stock solutions (100X)

5 milliliters of VITAMIN stock solutions (100X)

Sucrose 20 grams

Phytagel 3 grams

Adding distil water to 900 milliliter is regulated pH value to 5.8 with 1N potassium hydroxide.

Boil and be settled to 1000 milliliters, divide to install to (25 milliliters/pipe) in the pipe of taking root, seal, as stated above sterilization with distilled water.

(4) agriculture bacillus mediated genetic transformation step

4.1 callus of induce

1) sophisticated Ballila rice paddy seed is shelled, used 70% Ethanol Treatment then successively 1 minute, 0.15% mercury chloride (HgCl ₂) seed-coat sterilization 15 minutes;

2) wash seed 4-5 time with sterilization;

3) seed is placed on the inducing culture;

4) postvaccinal substratum is placed dark place cultivate 4 weeks, 25 ± 1 ℃ of temperature.

4.2 callus subculture

Select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put in dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down on the subculture medium.

4.3 pre-the cultivation

Select the embryo callus subculture of consolidation and relatively dry, be put in dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down on the pre-culture medium.

4.4 Agrobacterium is cultivated

1) (the LA culture medium preparation is with reference to J. Sa nurse Brooker etc. having the LA substratum that corresponding resistance selects, the molecular cloning experiment guide, the third edition, Jin Dongyan etc. (translating), Science Press, 2002, Beijing) went up the pre-Agrobacterium EHA105 of cultivation (this bacterial strain is from the agrobacterium strains of CAMBIA company public use) two days, 28 ℃ of temperature;

2) Agrobacterium is transferred in the suspension culture base, cultivated 2-3 hour on 28 ℃ of shaking tables.

4.5 Agrobacterium is infected

1) pre-incubated callus is transferred in the bottle of the bacterium of having gone out;

2) regulate the suspension of Agrobacterium to OD ₆₀₀0.8-1.0;

3) callus was soaked in agrobacterium suspension 30 minutes;

4) shifting callus blots to the good filter paper of sterilization; Be placed on then on the common substratum and cultivated temperature 19-20 ℃ 3 days.

4.6 callus washing and selection are cultivated

1) aqua sterilisa washing callus is to cannot see Agrobacterium;

2) be immersed in the aqua sterilisa that contains 400 milligrams/L Totomycin 30 minutes;

3) shifting callus blots to the good filter paper of sterilization;

4) shift callus to selecting to select on the substratum cultivation 2-3 time, each 2 weeks.

4.7 differentiation

1) kanamycin-resistant callus tissue is transferred on the pre-differentiation substratum in dark place cultivation 5-7 days;

2) callus that shifts pre-differentiation cultivation is to division culture medium, and illumination is cultivated down, 26 ℃ of temperature.

4.8 take root

1) cuts the root that differentiation phase produces;

Then it is transferred to and cultivates 2-3 week, 26 ℃ of temperature in the root media under the illumination.

4.9 transplant

Wash the residual substratum on the root off, the seedling that will have good root system changes the greenhouse over to, divides moistening at initial several Tian Bao water holding simultaneously.

The present invention obtains independent transgenosis T altogether ₀For rice plant 33 strains, comprise positive individual plant of 29 strains and the negative individual plant of 4 strains.The T that is obtained ₁Is example for rice plant with the B10 family, comprises positive individual plant of 15 strains and the negative individual plant of 14 strains.

The transgenic paddy rice positive and negative plant small ear fertility (Fig. 5) significant difference (t=7.4, P=0.0000); The negative average fertility of plant small ear of transgenic paddy rice (53.3%) is far above the small ear fertility of transgenic paddy rice positive plant 2.8%.The applicant has also detected T ₀Blastular fertility and pollen fertility for transgenic rice plant, pollen fertility no significant difference (see figure 6) in transgenic positive and negative rice plant wherein, and the negative plant blastular of transgenosis fertility be significantly higher than transgenic positive plant blastular fertility (Fig. 7) (t=12.33, P=0.0000).T ₀For transgenic positive plant and negative plant of transgenosis and T ₁For the negative plant blastular of transgenic positive plant and transgenosis fertility, pollen fertility and small ear fertility as shown in Figure 8, the result shows that the S5 site causes between the paddy rice indica and japonica subspecies that it is because due to the blastular abortion that fertility reduces.

The result shows that cloned genes S5 of the present invention is a wide affine gene between a mediation paddy rice indica and japonica subspecies.

3. the separating clone that contains the dna fragmentation of S5 constant gene segment C

Use the method for terminal rapid amplifying (RACE) of cDNA and PCR primer extension to obtain this full length gene cDNA respectively.Materials used is long-grained nonglutinous rice Nanjing 11, and the five phase blades that japonica rice Ballila and wide affine kind 02428 young fringe are grown are stand-by in-70 ℃ of refrigerators behind the liquid nitrogen freezing.Extract RNA (annotating: TRIZOL Reagent, Invitrogen Cat.No.15596-018) according to the described step of TRIZOL specification sheets, weaker concn to 1 μ g/ μ l ,-70 ℃ of preservations are stand-by.

RACE concrete steps: the SMART that uses Clontech ^TMRACE cDNA Amplification Kit, step is with reference to this test kit specification sheets.

5 ' end RACE primer S5-GSP1:CCGTTCCAACCAGAATAGTCGTGCT

S5-R1：ACCCGAACATGAGATCCATAAACGA

3 ' end RACE primer S5-GSP2:AAGATGGTGACAGACACGCTGAGGA

S5-RACE4：CAATCAACAGGCCAACCTACTCAC

UPM：Long(0.4M)：CTAATACGACTCACTATAGGGCAAGCAGTGGTA?TCAA?CGCAGAGT

Short(2μM)：CTAATACGACTCACTATAGGGC

NUPM：AAGCAGTGGTATCAACGCAGAGT

Wherein UPM and NUPM are provided by the mentioned reagent box.

First round PCR reaction conditions:

94 ℃ of sex change 30 seconds, 72 ℃ 3 minutes, 5 circulations;

94 ℃ of sex change 30 seconds, 70 ℃ of annealing 30 seconds, 72 ℃ were extended 5 circulations 3 minutes;

94 ℃ of sex change 30 seconds, 65 ℃ of annealing 30 seconds, 72 ℃ were extended 27 circulations 3 minutes;

72 ℃ of final extensions 10 minutes.

5 ' RACE uses primer UPM+S5-GSP1

3 ' RACE uses primer UPM+S5-GSP2

Second takes turns the PCR reaction conditions:

94 ℃ of pre-sex change 4 minutes;

94 ℃ of sex change 1 minute, 59 ℃ of annealing 1 minute, 72 ℃ were extended 35 circulations 1 minute 20 seconds;

72 ℃ of final extensions 10 minutes.

5 ' RACE uses primer NUPM+S5-R1

3 ' RACE uses primer NUPM+S5-RACE4

PCR primer extension concrete steps: 20 μ l systems are adopted in reverse transcription, behind trace amount DNA among the described step removal of the DNaseI specification sheets RNA, press SuperScript ^TMThe described step operation of II specification sheets, product is stand-by in-20 ℃ of preservations.(annotate: Deoxyribonuclease I, Invitrogen Cat.No.18068-015; SuperScript ^TMII Reverse Transcriptase, Invitrogen Cat.No.18064-022) use above-mentioned reverse transcription product 1 μ l to be PCR as template.Use Takara Ex Taq (Takara code:DRR01AM) to be PCR, the PCR agents useful for same is all packed from Takara Ex Taq.

The PCR the primer is as follows:

F5-3：ATCAACCCATTTCCTTTCCTACG

F5-2：CTGCCCCTGAGCAAGCAAGAAAG

F19-3：AGCCGACGACGAGTTGGAGTGT

5F2：CCAAGATCTGCCGACGACGAGTTGGAGTGT

BDF2：GACGACGAGTTGGAGTGT

S5-F11：CAGCCGACGACGAGTTGGAGT

S5-F2：GTGCGGCGAGCTGAGGTACGAT

S5-GSP2：AAGATGGTGACAGACACGCTGAGGA

S5-RACE4：CAATCAACAGGCCAACCTACTCAC

R11：ATGTGTAGGATCTGCCGGGATCGA

BDR：CATTAGGAACAGGAAGTCGT

S5-R11：CTCTGCCCGTTGGCGATAAGC

S5-R2：TCTGGGTGGCAAAGCGAGTGC

S5-R33：ATGGCGGCACGGTCGTATCTT

R3-1：ACGTAAACATCTAGTAGTGGCTCA

R3-2：TTGGCACGAACGGTTCAAGAG

R3-3：GATCAGTTATTTGGGCAAACCAG

R3-4：GGTCCCAAATCAAGTACCGCTAG

R3-5：GCTCAACAATTAGGACATACGAC

Respectively RACE product and the order-checking of PCR product are obtained required full-length gene.

Embodiment 2:S5 gene is in the structural analysis of the different subspecies of paddy rice

The sequence that obtains of order-checking among the embodiment 1 is analyzed: the full-length cDNA of rice varieties 02428 (extensively affine), Ballila (japonica rice) and Nanjing 11 (long-grained nonglutinous rice) is respectively 1778bp, 1912bp and 1911bp, and its structure is formed (Fig. 9) by three exons and two introns.Long-grained nonglutinous rice and japonica rice have and only have the difference of three bases, wherein there is the disappearance of a single base in Nanjing 11 at 3 ' non-translational region, Nanjing 11 and Ballila have two single base polymorphismses (single nucleotide polymorphism in the coding region, SNP), these two SNP form two missense mutation (Figure 10) in proteins encoded.One 472 amino acid whose protein of S5 genes encoding, BLASTp are analyzed (http://www.ncbi.nlm.nih.gov/) and are shown this albumen and aspartyl protease height homology.PROSITE (http://www.expasy.ch/cgi-bin/prosite/) analyzes and finds that there are two avtive spots in this albumen at 129-140 amino acid and 334-345 amino acid.SignalP 3.0 (http://www.cbs.dtu.dk/cgi-bin/) software analysis shows that there is a signal peptide in S5 albumen, and it is cut in the albumen ripening process.

Embodiment 3: utilize chip data to detect S5 gene expression level in rice at whole growth periods

The present invention utilizes chip data (Database of the National Center of Plant Gene Research, available athttp: //crep.ncpgr.cn/.) detecting S5 gene expression level in the rice at whole growth periods different tissues, the chip data of use comprises the express spectra (Figure 11) of the 25 kinds of different tissues (table 3) under long-grained nonglutinous rice Zhenshan 97 and Minghui 63 different growing stages.The result shows that the S5 gene is in utmost point low expression level all in the time of infertility.

The corresponding rice tissue title of table 3 chip data

Embodiment 4:S5 albumen has the aspartyl protease activity

Aspartyl protease is activated under acidic conditions and its activity is suppressed (Rawlings ND by pepstatin A, Barrett AJ (1995) Families of aspartic peptidases, and those of unknown catalytic mechanism.Methods Enzymol.248:105-20).And whether gene of the present invention and aspartyl protease height homology are typical aspartyl proteases in order to verify gene S5 of the present invention, and external experiment of this example design verifies whether S5 albumen has this function.

Concrete implementation step is:

(1) prokaryotic expression carrier makes up

Design primer 5F1 (5 '-GGGAGATCTATGGTGATCTTGGAGCAGCCA-3 ', joint adds the BglII restriction enzyme site) and 5R (5 '-AGGCTCGAGCGACGATCAGCAAACGGCA-3 ' joint add the XhoI restriction enzyme site), (from the triumphant company that opens up in Beijing) is template pcr amplification total length with the fine full-length cDNA of Japan.The used reagent of pcr amplification reaction is from Takara company.Reaction conditions is: 94 ℃, and 5min; 94 ℃, 1min, 59 ℃, 1min, 72 ℃, 1.5min, 30cycles; 72 ℃, 5min.Product is building up to

In (available from Promega) carrier, sequence verification.Respectively external source is building up to (available from BioLabs) in the pMAL-c2x carrier then, carrier is cut with BamHI and XhoI enzyme.

(2) protein induced expression

The expression vector that builds is transformed expression strain BL21 (available from Invitrogen company), reach at 0.6 o'clock Deng bacterium liquid OD value, add final concentration and be IPTG (isopropyl 1-thio-β-D-galactopyranoside), 37 ℃ of abduction delivering 3hrs then of 0.5mM.Collect thalline, add the long-pending PBS of monoploid and suspend, put-20 ℃ and spend the night.Dissolving in second day is placed on ice immediately, and adding final concentration is the PMSF of 1mM, supersound process, and the whole ultrasonic process is carried out on ice, is in native state to guarantee albumen.12000rpm after supersound process is finished, 4 ℃ of frozen centrifugations.Collect supernatant, with Amylose Resin (available from BioLabs) purifying.Purification step is with reference to pMAL ^TMProtein Fusion and PurificationInstruction Manual, Catalog#E8000S

(3) protease activity detects

The albumen of 20 μ l (10 μ g) purifying, add isopyknic pH damping fluid and 20 μ l FITC-casein (Protease FluorescentDetection Kit), 37 ℃ are reacted adding 100ul 0.6N trichoroacetic acid(TCA) (TCA) precipitation after 15 hours down, the centrifugal 10min of 12000rpm, suct 100ul clearly, add 2ml assay buffer, (Fluorescence spectrophotometer Hitachi850) measures with spectrophotofluorometer.Water is contrast.

The pH buffer formulation:

0.1M?Gly-HCl，pH2.5

0.1M?0.1M?sodium?citrate，pH3.0，pH3.5，pH?4.0；

0.1M?sodium?acetate，pH?5.0；

0.1M?sodium?phosphate，pH?6.0；

Whether (4) detect ASP is suppressed by pepstatin A inhibitor

Experimental procedure: adding final concentration in the target protein of 8 μ g purifying is 0.15mM pepstatin A, 4 ℃ hatch 1.5 hours after, the damping fluid that adds pH=3 is to final volume 40 μ l, and then adding substrate FITC-Casein 20 μ l (sigma, PF0100), after hatching 12 hours under 37 ℃, add 100 μ l 0.6NTCA precipitation, suct 100 μ l clearly, add 2ml assay buffer, (HitachiM850 fluorescence spectrophotometer Japan) measures with spectrophotofluorometer.The purifying protein that only contains label maltose binding protein (MBP) in contrast, each does three repetitions.

(5) self montage of aspartate protease forms ripe proteic initial analysis

The Asp10 μ l of prokaryotic expression purifying (20 μ g) adds the PH damping fluid of 1/2 volume, and 37 ℃ of reactions are spent the night, and adds the long-pending loading buffer of monoploid, poach 5min, and the 12%SDS-PAGE electrophoresis, the Coomassie blue dye liquor dyes glue.

The result shows this albumen activity the highest (Figure 12) under the condition of pH3.0, and is suppressed (Figure 12) fully by pepstatin A.Test and pass through self montage under the condition that shows this albumen pH 2.5-4.0 simultaneously, form maturation protein (Figure 13).

The above results shows gene of the present invention typical aspartyl protease of coding really.

Embodiment 5:S5 expression of gene position

In order to determine S5 expression of gene position, this example has used the RNA hybridization in situ technique.Determine that according to the rna probe hybridization signal gene of the present invention expresses (Figure 14) in megarchidium, integument, sporocyte and microsporocyte.

RNA in situ hybridization flow process is referring to Drews (Drews GN (1998) In situ hybridization.Methods Mol Biol 82:353-71Drews GN (1998) In situ hybridization.Methods Mol Biol 82:353-71).

Sequence table

＜110〉Hua Zhong Agriculture University

＜120〉separating clone of rice wide compatibility gene S 5 and application

<130>

<141>2007-10-10

<160>7

<170>PatentIn?version?3.1

<210>1

<211>1778

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(1778)

<223>

<220>

<221>5’UTR

<222>(1441)..(1778)

<223>

<220>

<221>3’UTR

<222>(1)..(21)

<223>

<220>

<221>CDS

<222>(22)..(1440)

<223>

<400>1

atcaacccat?ttcctttcct?a?cgt?ttg?act?gcc?tgc?ctg?ccc?ctg?agc?aag 51

Arg?Leu?Thr?Ala?Cys?Leu?Pro?Leu?Ser?Lys

1 5 10

caa?gaa?aga?aag?aaa?gaa?ggg?att?aaa?ttt?gct?taa?tcc?ggc?gcc?aca 99

Gln?Glu?Arg?Lys?Lys?Glu?Gly?Ile?Lys?Phe?Ala Ser?Gly?Ala?Thr

15 20 25

gca?gcc?gac?gac?gag?ttg?gag?tgt?ccc?tcc?tcc?atc?ttc?gat?cac?gct 147

Ala?Ala?Asp?Asp?Glu?Leu?Glu?Cys?Pro?Ser?Ser?Ile?Phe?Asp?His?Ala

30 35 40

gtg?aac?tct?caa?ggc?gcc?att?cag?ttc?ccc?gtg?ttc?cac?aag?aag?cac 195

Val?Asn?Ser?Gln?Gly?Ala?Ile?Gln?Phe?Pro?Val?Phe?His?Lys?Lys?His

45 50 55

caa?tgc?ctc?cgc?cca?tgg?tct?gtc?cgt?gca?acc?cag?gca?tcc?tcg?acc 243

Gln?Cys?Leu?Arg?Pro?Trp?Ser?Val?Arg?Ala?Thr?Gln?Ala?Ser?Ser?Thr

60 65 70

gga?gca?tca?gga?gca?gga?aaa?gga?gga?gga?ttg?aac?aat?cta?cag?gaa 291

Gly?Ala?Ser?Gly?Ala?Gly?Lys?Gly?Gly?Gly?Leu?Asn?Asn?Leu?Gln?Glu

75 80 85

gag?gag?atc?act?tca?tca?agt?agt?aca?aaa?atc?gac?gtg?atc?gaa?gac 339

Glu?Glu?Ile?Thr?Ser?Ser?Ser?Ser?Thr?Lys?Ile?Asp?Val?Ile?Glu?Asp

90 95 100 105

agc?agc?atc?aac?gac?ttc?ctg?ttc?cta?atg?gcc?gtc?agt?ctg?ggc?aag 387

Ser?Ser?Ile?Asn?Asp?Phe?Leu?Phe?Leu?Met?Ala?Val?Ser?Leu?Gly?Lys

110 115 120

cca?ccg?gtt?gtg?aac?ctg?gtg?gcg?atc?gac?acg?gga?tcc?acc?ctc?tcg 435

Pro?Pro?Val?Val?Asn?Leu?Val?Ala?Ile?Asp?Thr?Gly?Ser?Thr?Leu?Ser

125 130 135

tgg?gtg?caa?tgc?cag?ccg?tgc?gcg?gtg?cac?tgc?cac?acg?cag?tcc?gcg 483

Trp?Val?Gln?Cys?Gln?Pro?Cys?Ala?Val?His?Cys?His?Thr?Gln?Ser?Ala

140 145 150

aag?gcc?ggc?ccg?ata?ttc?gat?ccc?ggc?aga?tcc?tac?aca?tcc?cgg?cga 531

Lys?Ala?Gly?Pro?Ile?Phe?Asp?Pro?Gly?Arg?Ser?Tyr?Thr?Ser?Arg?Arg

155 160 165

gtt?cgc?tgc?tcg?tcg?gtc?aag?tgc?ggc?gag?ctg?agg?tac?gat?ctg?cgg 579

Val?Arg?Cys?Ser?Ser?Val?Lys?Cys?Gly?Glu?Leu?Arg?Tyr?Asp?Leu?Arg

170 175 180 185

ctc?cag?caa?gcc?aat?tgc?atg?gag?aag?gaa?gac?agc?tgc?acg?tac?agc 627

Leu?Gln?Gln?Ala?Asn?Cys?Met?Glu?Lys?Glu?Asp?Ser?Cys?Thr?Tyr?Ser

190 195 200

gtc?acg?tac?ggg?aac?ggg?tgg?gcg?tac?agc?gtg?ggc?aag?atg?gtg?aca 675

Val?Thr?Tyr?Gly?Asn?Gly?Trp?Ala?Tyr?Ser?Val?Gly?Lys?Met?Val?Thr

205 210 215

gac?acg?ctg?agg?att?ggg?gac?tcg?ttt?atg?gat?ctc?atg?ttc?ggg?tgc 723

Asp?Thr?Leu?Arg?Ile?Gly?Asp?Ser?Phe?Met?Asp?Leu?Met?Phe?Gly?Cys

220 225 230

agc?atg?gat?gtc?aag?tac?agc?gaa?ttc?gag?gcc?ggc?atc?ttt?ggt?ttc 771

Ser?Met?Asp?Val?Lys?Tyr?Ser?Glu?Phe?Glu?Ala?Gly?Ile?Phe?Gly?Phe

235 240 245

ggc?agc?agc?agc?ttc?tct?ttc?ttc?gag?cag?ctg?gca?ggg?tac?cct?gat 819

Gly?Ser?Ser?Ser?Phe?Ser?Phe?Phe?Glu?Gln?Leu?Ala?Gly?Tyr?Pro?Asp

250 255 260 265

att?ctg?agt?tac?aag?gca?ttc?agc?tac?tgc?ttg?ccc?act?gac?gag?acc 867

Ile?Leu?Ser?Tyr?Lys?Ala?Phe?Ser?Tyr?Cys?Leu?Pro?Thr?Asp?Glu?Thr

270 275 280

aag?ccc?gga?tac?atg?atc?ctg?gga?aga?tac?gac?cgt?gcc?gcc?atg?gat 915

Lys?Pro?Gly?Tyr?Met?Ile?Leu?Gly?Arg?Tyr?Asp?Arg?Ala?Ala?Met?Asp

285 290 295

ggg?ggt?tac?act?cct?ctc?ttc?cgg?tca?atc?aac?agg?cca?acc?tac?tca 963

Gly?Gly?Tyr?Thr?Pro?Leu?Phe?Arg?Ser?Ile?Asn?Arg?Pro?Thr?Tyr?Ser

300 305 310

ctg?acg?atg?gag?atg?ctt?atc?gcc?aac?ggg?cag?aga?ttg?gtg?aca?tcg 1011

Leu?Thr?Met?Glu?Met?Leu?Ile?Ala?Asn?Gly?Gln?Arg?Leu?Val?Thr?Ser

315 320 325

tct?tcg?gag?atg?atc?gtc?gat?tcc?ggg?gcc?cag?agg?acg?tcc?ctg?tgg 1059

Ser?Ser?Glu?Met?Ile?Val?Asp?Ser?Gly?Ala?Gln?Arg?Thr?Ser?Leu?Trp

330 335 340 345

cct?tcc?act?ttt?gct?ctc?ctt?gac?aag?acc?atc?acg?cag?gca?atg?tcg 1107

Pro?Ser?Thr?Phe?Ala?Leu?Leu?Asp?Lys?Thr?Ile?Thr?Gln?Ala?Met?Ser

350 355 360

tcg?att?ggg?tat?cac?cgg?aca?tca?aga?gcg?cgc?caa?gaa?tca?tac?atc 1155

Ser?Ile?Gly?Tyr?His?Arg?Thr?Ser?Arg?Ala?Arg?Gln?Glu?Ser?Tyr?Ile

365 370 375

tgc?tac?tta?tcg?gag?cac?gac?tat?tct?ggt?tgg?aac?ggc?acc?atc?acg 1203

Cys?Tyr?Leu?Ser?Glu?His?Asp?Tyr?Ser?Gly?Trp?Asn?Gly?Thr?Ile?Thr

380 385 390

ccc?ttc?tcc?aac?tgg?tcc?gcc?ttg?cct?ctg?ctg?gag?atc?ggc?ttc?gcc 1251

Pro?Phe?Ser?Asn?Trp?Ser?Ala?Leu?Pro?Leu?Leu?Glu?Ile?Gly?Phe?Ala

395 400 405

ggc?ggt?gct?gca?ctc?gct?ttg?cca?ccc?aga?aac?gtc?ttc?tac?aac?gat 1299

Gly?Gly?Ala?Ala?Leu?Ala?Leu?Pro?Pro?Arg?Asn?Val?Phe?Tyr?Asn?Asp

410 415 420 425

cca?cac?cgc?ggt?ttg?tgc?atg?acc?ttt?gct?cag?aat?cct?gct?ctc?agg 1347

Pro?His?Arg?Gly?Leu?Cys?Met?Thr?Phe?Ala?Gln?Asn?Pro?Ala?Leu?Arg

430 435 440

tct?cag?ata?ctg?ggg?aac?agg?gtt?act?cga?tcc?ttc?gga?aca?acc?ttc 1395

Ser?Gln?Ile?Leu?Gly?Asn?Arg?Val?Thr?Arg?Ser?Phe?Gly?Thr?Thr?Phe

445 450 455

gac?atc?cag?ggg?aaa?caa?ttc?ggc?ttc?aaa?tat?gcc?gct?tgc?tga 1440

Asp?Ile?Gln?Gly?Lys?Gln?Phe?Gly?Phe?Lys?Tyr?Ala?Ala?Cys

460 465 470

tcgtcgatta?ttcctcatcc?tatgatatat?cttatagctt?gcgggtcgat?taattagctg 1500

gtttgcccaa?ataactgatc?ggattggagt?cttctcccgc?gctacactac?ccctagctgc 1560

gatcgtatca?caagctagcg?gtacttgatt?tgggacctaa?ttcgttcaaa?aaaaacttgg 1620

cagcttaatt?tgggacctag?tagctagctg?agccactact?agatgtttac?gtaccagcta 1680

tccgtcgttt?gtttgtgtct?cctgtgcttg?tgctaaacct?atctcttgaa?ccgttcgtgc 1740

caacttaatt?atttggtcgt?atgtcctaat?tgttgatc 1778

<210>2

<211>21

<212>PRT

＜213〉paddy rice (Oryza sativa)

<400>2

Arg?Leu?Thr?Ala?Cys?Leu?Pro?Leu?Ser?Lys?Gln?Glu?Arg?Lys?Lys?Glu

1 5 10 15

Gly?Ile?Lys?Phe?Ala

20

<210>3

<211>450

<212>PRT

＜213〉paddy rice (Oryza sativa)

<400>3

Ser?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu?Glu?Cys?Pro?Ser?Ser?Ile

1 5 10 15

Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala?Ile?Gln?Phe?Pro?Val?Phe

20 25 30

His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp?Ser?Val?Arg?Ala?Thr?Gln

35 40 45

Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly?Lys?Gly?Gly?Gly?Leu?Asn

50 55 60

Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser?Ser?Ser?Thr?Lys?Ile?Asp

65 70 75 80

Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe?Leu?Phe?Leu?Met?Ala?Val

85 90 95

Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu?Val?Ala?Ile?Asp?Thr?Gly

100 105 110

Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro?Cys?Ala?Val?His?Cys?His

115 120 125

Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe?Asp?Pro?Gly?Arg?Ser?Tyr

130 135 140

Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val?Lys?Cys?Gly?Glu?Leu?Arg

145 150 155 160

Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys?Met?Glu?Lys?Glu?Asp?Ser

165 170 175

Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly?Trp?Ala?Tyr?Ser?Val?Gly

180 185 190

Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly?Asp?Ser?Phe?Met?Asp?Leu

195 200 205

Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr?Ser?Glu?Phe?Glu?Ala?Gly

210 215 220

Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser?Phe?Phe?Glu?Gln?Leu?Ala

225 230 235 240

Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala?Phe?Ser?Tyr?Cys?Leu?Pro

245 250 255

Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile?Leu?Gly?Arg?Tyr?Asp?Arg

260 265 270

Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu?Phe?Arg?Ser?Ile?Asn?Arg

275 280 285

Pro?Thr?Tyr?Ser?Leu?Thr?Met?Glu?Met?Leu?Ile?Ala?Asn?Gly?Gln?Arg

290 295 300

Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val?Asp?Ser?Gly?Ala?Gln?Arg

305 310 315 320

Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu?Leu?Asp?Lys?Thr?Ile?Thr

325 330 335

Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg?Thr?Ser?Arg?Ala?Arg?Gln

340 345 350

Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His?Asp?Tyr?Ser?Gly?Trp?Asn

355 360 365

Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser?Ala?Leu?Pro?Leu?Leu?Glu

370 375 380

Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala?Leu?Pro?Pro?Arg?Asn?Val

385 390 395 400

Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys?Met?Thr?Phe?Ala?Gln?Asn

405 410 415

Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn?Arg?Val?Thr?Arg?Ser?Phe

420 425 430

Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln?Phe?Gly?Phe?Lys?Tyr?Ala

435 440 445

Ala?Cys

450

<210>4

<211>1912

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(1912)

<223>

<220>

<221>5’UTR

<222>(1577)..(1912)

<223>

<220>

<221>3’UTR

<222>(1)..(157)

<223>

<220>

<221>CDS

<222>(158)..(1576)

<223>

<400>4

atcaacccat?ttcctttcct?acgtttgact?gcctgcctgc?ccctgagcaa?gcaagaaaga 60

aagaaagaag?ggattaaatt?tgctcgctcc?tacgaatcct?gcccctgagt?aacaatgact 120

gacttttaat?ttgtttgcag?ctagggtggg?gatcgag?atg?gtg?atc?ttg?gag?cag 175

Met?Val?Ile?Leu?Glu?Gln

1 5

cca?cag?ctg?ctc?ctt?ctt?ctt?ctt?ctt?ctt?gta?gca?gct?gca?gct?gca 223

Pro?Gln?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Val?Ala?Ala?Ala?Ala?Ala

10 15 20

acc?ggc?gcc?aca?gca?gcc?gac?gac?gag?ttg?gag?tgt?ccc?tcc?tcc?atc 271

Thr?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu?Glu?Cys?Pro?Ser?Ser?Ile

25 30 35

ttc?gat?cac?gct?gtg?aac?tct?caa?ggc?gcc?att?cag?ttc?ccc?gtg?ttc 319

Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala?Ile?Gln?Phe?Pro?Val?Phe

40 45 50

cac?aag?aag?cac?caa?tgc?ctc?cgc?cca?tgg?tct?gtc?cgt?gca?acc?cag 367

His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp?Ser?Val?Arg?Ala?Thr?Gln

55 60 65 70

gca?tcc?tcg?acc?gga?gca?tca?gga?gca?gga?aaa?gga?gga?gga?ttg?aac 415

Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly?Lys?Gly?Gly?Gly?Leu?Asn

75 80 85

aat?cta?cag?gaa?gag?gag?atc?act?tca?tca?agt?agt?aca?aaa?atc?gac 463

Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser?Ser?Ser?Thr?Lys?Ile?Asp

90 95 100

gtg?atc?gaa?gac?agc?agc?atc?aac?gac?ttc?ctg?ttc?cta?atg?gcc?gtc 511

Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe?Leu?Phe?Leu?Met?Ala?Val

105 110 115

agt?ctg?ggc?aag?cca?ccg?gtt?gtg?aac?ctg?gtg?gcg?atc?gac?acg?gga 559

Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu?Val?Ala?Ile?Asp?Thr?Gly

120 125 130

tcc?acc?ctc?tcg?tgg?gtg?caa?tgc?cag?ccg?tgc?gcg?gtg?cac?tgc?cac 607

Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro?Cys?Ala?Val?His?Cys?His

135 140 145 150

acg?cag?tcc?gcg?aag?gcc?ggc?ccg?ata?ttc?gat?ccc?ggc?aga?tcc?tac 655

Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe?Asp?Pro?Gly?Arg?Ser?Tyr

155 160 165

aca?tcc?cgg?cga?gtt?cgc?tgc?tcg?tcg?gtc?aag?tgc?ggc?gag?ctg?agg 703

Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val?Lys?Cys?Gly?Glu?Leu?Arg

170 175 180

tac?gat?ctg?cgg?ctc?cag?caa?gcc?aat?tgc?atg?gag?aag?gaa?gac?agc 751

Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys?Met?Glu?Lys?Glu?Asp?Ser

185 190 195

tgc?acg?tac?agc?gtc?acg?tac?ggg?aac?ggg?tgg?gcg?tac?agc?gtg?ggc 799

Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly?Trp?Ala?Tyr?Ser?Val?Gly

200 205 210

aag?atg?gtg?aca?gac?acg?ctg?agg?att?ggg?gac?tcg?ttt?atg?gat?ctc 847

Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly?Asp?Ser?Phe?Met?Asp?Leu

215 220 225 230

atg?ttc?ggg?tgc?agc?atg?gat?gtc?aag?tac?agc?gaa?ttc?gag?gcc?ggc 895

Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr?Ser?Glu?Phe?Glu?Ala?Gly

235 240 245

atc?ttt?ggt?ttc?ggc?agc?agc?agc?ttc?tct?ttc?ttc?gag?cag?ctg?gca 943

Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser?Phe?Phe?Glu?Gln?Leu?Ala

250 255 260

ggg?tac?cct?gat?att?ctg?agt?tac?aag?gca?tta?agc?tac?tgc?ttg?ccc 991

Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala?Leu?Ser?Tyr?Cys?Leu?Pro

265 270 275

act?gac?gag?acc?aag?ccc?gga?tac?atg?atc?ctg?gga?aga?tac?gac?cgt 1039

Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile?Leu?Gly?Arg?Tyr?Asp?Arg

280 285 290

gcc?gcc?atg?gat?ggg?ggt?tac?act?cct?ctc?ttc?cgg?tca?atc?aac?agg 1087

Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu?Phe?Arg?Ser?Ile?Asn?Arg

295 300 305 310

cca?acc?tac?tca?ctg?acg?atg?gag?atg?ctt?atc?gcc?aac?ggg?cag?aga 1135

Pro?Thr?Tyr?Ser?Leu?Thr?Met?Glu?Met?Leu?Ile?Ala?Asn?Gly?Gln?Arg

315 320 325

ttg?gtg?aca?tcg?tct?tcg?gag?atg?atc?gtc?gat?tcc?ggg?gcc?cag?agg 1183

Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val?Asp?Ser?Gly?Ala?Gln?Arg

330 335 340

acg?tcc?ctg?tgg?cct?tcc?act?ttt?gct?ctc?ctt?gac?aag?acc?atc?acg 1231

Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu?Leu?Asp?Lys?Thr?Ile?Thr

345 350 355

cag?gca?atg?tcg?tcg?att?ggg?tat?cac?cgg?aca?tca?aga?gcg?cgc?caa 1279

Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg?Thr?Ser?Arg?Ala?Arg?Gln

360 365 370

gaa?tca?tac?atc?tgc?tac?tta?tcg?gag?cac?gac?tat?tct?ggt?tgg?aac 1327

Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His?Asp?Tyr?Ser?Gly?Trp?Asn

375 380 385 390

ggc?acc?atc?acg?ccc?ttc?tcc?aac?tgg?tcc?gcc?ttg?cct?ctg?ctg?gag 1375

Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser?Ala?Leu?Pro?Leu?Leu?Glu

395 400 405

atc?ggc?ttc?gcc?ggc?ggt?gct?gca?ctc?gct?ttg?cca?ccc?aga?aac?gtc 1423

Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala?Leu?Pro?Pro?Arg?Asn?Val

410 415 420

ttc?tac?aac?gat?cca?cac?cgc?ggt?ttg?tgc?atg?acc?ttt?gct?cag?aat 1471

Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys?Met?Thr?Phe?Ala?Gln?Asn

425 430 435

cct?gct?ctc?agg?tct?cag?ata?ctg?ggg?aac?agg?gtt?act?cga?tcc?ttc 1519

Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn?Arg?Val?Thr?Arg?Ser?Phe

440 445 450

gga?aca?acc?ttc?gac?atc?cag?ggg?aaa?caa?ttc?ggc?ttc?aaa?tat?gcc 1567

Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln?Phe?Gly?Phe?Lys?Tyr?Ala

455 460 465 470

gtt?tgc?tga?tcgtcgatta?ttcctcatcc?tatgatatct?tatagcttgc 1616

Val?Cys

gggtcgatta?attagctggt?ttgcccaaat?aactgatcgg?attggagtct?tctcccgcgc 1676

tacactaccc?ctagctgcga?tcgtatcaca?agctagcggt?acttgatttg?ggacctaatt 1736

cgttcaaaaa?aaacttggca?gcttaatttg?ggacctagta?gctagctgag?ccactactag 1796

atgtttacgt?accagctatc?cgtcgtttgt?ttgtgtctcc?tgtgcttgtg?ctaaacctat 1856

ctcttgaacc?gttcgtgcca?acttaattat?ttggtcgtat?gtcctaattg?ttgatc 1912

<210>5

<211>472

<212>PRT

＜213〉paddy rice (Oryza sativa)

<400>5

Met?Val?Ile?Leu?Glu?Gln?Pro?Gln?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Leu

1 5 10 15

Val?Ala?Ala?Ala?Ala?Ala?Thr?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu

20 25 30

Glu?Cys?Pro?Ser?Ser?Ile?Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala

35 40 45

Ile?Gln?Phe?Pro?Val?Phe?His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp

50 55 60

Ser?Val?Arg?Ala?Thr?Gln?Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly

65 70 75 80

Lys?Gly?Gly?Gly?Leu?Asn?Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser

85 90 95

Ser?Ser?Thr?Lys?Ile?Asp?Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe

100 105 110

Leu?Phe?Leu?Met?Ala?Val?Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu

115 120 125

Val?Ala?Ile?Asp?Thr?Gly?Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro

130 135 140

Cys?Ala?Val?His?Cys?His?Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe

145 150 155 160

Asp?Pro?Gly?Arg?Ser?Tyr?Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val

165 170 175

Lys?Cys?Gly?Glu?Leu?Arg?Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys

180 185 190

Met?Glu?Lys?Glu?Asp?Ser?Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly

195 200 205

Trp?Ala?Tyr?Ser?Val?Gly?Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly

210 215 220

Asp?Ser?Phe?Met?Asp?Leu?Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr

225 230 235 240

Ser?Glu?Phe?Glu?Ala?Gly?Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser

245 250 255

Phe?Phe?Glu?Gln?Leu?Ala?Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala

260 265 270

Leu?Ser?Tyr?Cys?Leu?Pro?Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile

275 280 285

Leu?Gly?Arg?Tyr?Asp?Arg?Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu

290 295 300

Phe?Arg?Ser?Ile?Asn?Arg?Pro?Thr?Tyr?Ser?Leu?Thr?Met?Glu?Met?Leu

305 310 315 320

Ile?Ala?Asn?Gly?Gln?Arg?Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val

325 330 335

Asp?Ser?Gly?Ala?Gln?Arg?Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu

340 345 350

Leu?Asp?Lys?Thr?Ile?Thr?Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg

355 360 365

Thr?Ser?Arg?Ala?Arg?Gln?Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His

370 375 380

Asp?Tyr?Ser?Gly?Trp?Ash?Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser

385 390 395 400

Ala?Leu?Pro?Leu?Leu?Glu?Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala

405 410 415

Leu?Pro?Pro?Arg?Asn?Val?Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys

420 425 430

Met?Thr?Phe?Ala?Gln?Asn?Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn

435 440 445

Arg?Val?Thr?Arg?Ser?Phe?Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln

450 455 460

Phe?Gly?Phe?Lys?Tyr?Ala?Val?Cys

465 470

<210>6

<211>1911

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(1911)

<223>

<220>

<221>5’UTR

<222>(1577)..(1911)

<223>

<220>

<221>3’UTR

<222>(1)..(157)

<223>

<220>

<221>CDS

<222>(158)..(1576)

<223>

<400>6

atcaacccat?ttcctttcct?acgtttgact?gcctgcctgc?ccctgagcaa?gcaagaaaga 60

aagaaagaag?ggattaaatt?tgctcgctcc?tacgaatcct?gcccctgagt?aacaatgact 120

gacttttaat?ttgtttgcag?ctagggtggg?gatcgag?atg?gtg?atc?ttg?gag?cag 175

Met?Val?Ile?Leu?Glu?Gln

1 5

cca?cag?ctg?ctc?ctt?ctt?ctt?ctt?ctt?ctt?gta?gca?gct?gca?gct?gca 223

Pro?Gln?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Val?Ala?Ala?Ala?Ala?Ala

10 15 20

acc?ggc?gcc?aca?gca?gcc?gac?gac?gag?ttg?gag?tgt?ccc?tcc?tcc?atc 271

Thr?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu?Glu?Cys?Pro?Ser?Ser?Ile

25 30 35

ttc?gat?cac?gct?gtg?aac?tct?caa?ggc?gcc?att?cag?ttc?ccc?gtg?ttc 319

Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala?Ile?Gln?Phe?Pro?Val?Phe

40 45 50

cac?aag?aag?cac?caa?tgc?ctc?cgc?cca?tgg?tct?gtc?cgt?gca?acc?cag 367

His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp?Ser?Val?Arg?Ala?Thr?Gln

55 60 65 70

gca?tcc?tcg?acc?gga?gca?tca?gga?gca?gga?aaa?gga?gga?gga?ttg?aac 415

Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly?Lys?Gly?Gly?Gly?Leu?Asn

75 80 85

aat?cta?cag?gaa?gag?gag?atc?act?tca?tca?agt?agt?aca?aaa?atc?gac 463

Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser?Ser?Ser?Thr?Lys?Ile?Asp

90 95 100

gtg?atc?gaa?gac?agc?agc?atc?aac?gac?ttc?ctg?ttc?cta?atg?gcc?gtc 511

Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe?Leu?Phe?Leu?Met?Ala?Val

105 110 115

agt?ctg?ggc?aag?cca?ccg?gtt?gtg?aac?ctg?gtg?gcg?atc?gac?acg?gga 559

Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu?Val?Ala?Ile?Asp?Thr?Gly

120 125 130

tcc?acc?ctc?tcg?tgg?gtg?caa?tgc?cag?ccg?tgc?gcg?gtg?cac?tgc?cac 607

Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro?Cys?Ala?Val?His?Cys?His

135 140 145 150

acg?cag?tcc?gcg?aag?gcc?ggc?ccg?ata?ttc?gat?ccc?ggc?aga?tcc?tac 655

Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe?Asp?Pro?Gly?Arg?Ser?Tyr

155 160 165

aca?tcc?cgg?cga?gtt?cgc?tgc?tcg?tcg?gtc?aag?tgc?ggc?gag?ctg?agg 703

Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val?Lys?Cys?Gly?Glu?Leu?Arg

170 175 180

tac?gat?ctg?cgg?ctc?cag?caa?gcc?aat?tgc?atg?gag?aag?gaa?gac?agc 751

Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys?Met?Glu?Lys?Glu?Asp?Ser

185 190 195

tgc?acg?tac?agc?gtc?acg?tac?ggg?aac?ggg?tgg?gcg?tac?agc?gtg?ggc 799

Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly?Trp?Ala?Tyr?Ser?Val?Gly

200 205 210

aag?atg?gtg?aca?gac?acg?ctg?agg?att?ggg?gac?tcg?ttt?atg?gat?ctc 847

Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly?Asp?Ser?Phe?Met?Asp?Leu

215 220 225 230

atg?ttc?ggg?tgc?agc?atg?gat?gtc?aag?tac?agc?gaa?ttc?gag?gcc?ggc 895

Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr?Ser?Glu?Phe?Glu?Ala?Gly

235 240 245

atc?ttt?ggt?ttc?ggc?agc?agc?agc?ttc?tct?ttc?ttc?gag?cag?ctg?gca 943

Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser?Phe?Phe?Glu?Gln?Leu?Ala

250 255 260

ggg?tac?cct?gat?att?ctg?agt?tac?aag?gca?ttc?agc?tac?tgc?ttg?ccc 991

Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala?Phe?Ser?Tyr?Cys?Leu?Pro

265 270 275

act?gac?gag?acc?aag?ccc?gga?tac?atg?atc?ctg?gga?aga?tac?gac?cgt 1039

Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile?Leu?Gly?Arg?Tyr?Asp?Arg

280 285 290

gcc?gcc?atg?gat?ggg?ggt?tac?act?cct?ctc?ttc?cgg?tca?atc?aac?agg 1087

Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu?Phe?Arg?Ser?Ile?Asn?Arg

295 300 305 310

cca?acc?tac?tca?ctg?acg?atg?gag?atg?ctt?atc?gcc?aac?ggg?cag?aga 1135

Pro?Thr?Tyr?Ser?Leu?Thr?Met?Glu?Met?Leu?Ile?Ala?Asn?Gly?Gln?Arg

315 320 325

ttg?gtg?aca?tcg?tct?tcg?gag?atg?atc?gtc?gat?tcc?ggg?gcc?cag?agg 1183

Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val?Asp?Ser?Gly?Ala?Gln?Arg

330 335 340

acg?tcc?ctg?tgg?cct?tcc?act?ttt?gct?ctc?ctt?gac?aag?acc?atc?acg 1231

Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu?Leu?Asp?Lys?Thr?Ile?Thr

345 350 355

cag?gca?atg?tcg?tcg?att?ggg?tat?cac?cgg?aca?tca?aga?gcg?cgc?caa 1279

Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg?Thr?Ser?Arg?Ala?Arg?Gln

360 365 370

gaa?tca?tac?atc?tgc?tac?tta?tcg?gag?cac?gac?tat?tct?ggt?tgg?aac 1327

Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His?Asp?Tyr?Ser?Gly?Trp?Asn

375 380 385 390

ggc?acc?atc?acg?ccc?ttc?tcc?aac?tgg?tcc?gcc?ttg?cct?ctg?ctg?gag 1375

Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser?Ala?Leu?Pro?Leu?Leu?Glu

395 400 405

atc?ggc?ttc?gcc?ggc?ggt?gct?gca?ctc?gct?ttg?cca?ccc?aga?aac?gtc 1423

Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala?Leu?Pro?Pro?Arg?Asn?Val

410 415 420

ttc?tac?aac?gat?cca?cac?cgc?ggt?ttg?tgc?atg?acc?ttt?gct?cag?aat 1471

Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys?Met?Thr?Phe?Ala?Gln?Asn

425 430 435

cct?gct?ctc?agg?tct?cag?ata?ctg?ggg?aac?agg?gtt?act?cga?tcc?ttc 1519

Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn?Arg?Val?Thr?Arg?Ser?Phe

440 445 450

gga?aca?acc?ttc?gac?atc?cag?ggg?aaa?caa?ttc?ggc?ttc?aaa?tat?gcc 1567

Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln?Phe?Gly?Phe?Lys?Tyr?Ala

455 460 465 470

gct?tgc?tga?tcgtcgatta?ttcctcatcc?tatgatatct?tatagcttgc 1616

Ala?Cys

gggtcgatta?attagctggt?ttgcccaaat?aactgatcgg?attggagtct?tctcccgcgc 1676

tacactaccc?ctagctgcga?tcgtatcaca?agctagcggt?acttgatttg?ggacctaatt 1736

cgttcaaaaa?aacttggcag?cttaatttgg?gacctagtag?ctagctgagc?cactactaga 1796

tgtttacgta?ccagctatcc?gtcgtttgtt?tgtgtctcct?gtgcttgtgc?taaacctatc 1856

tcttgaaccg?ttcgtgccaa?cttaattatt?tggtcgtatg?tcctaattgt?tgatc 1911

<210>7

<211>472

<212>PRT

＜213〉paddy rice (Oryza sativa)

<400>7

Met?Val?Ile?Leu?Glu?Gln?Pro?Gln?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Leu

1 5 10 15

Val?Ala?Ala?Ala?Ala?Ala?Thr?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu

20 25 30

Glu?Cys?Pro?Ser?Ser?Ile?Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala

35 40 45

Ile?Gln?Phe?Pro?Val?Phe?His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp

50 55 60

Ser?Val?Arg?Ala?Thr?Gln?Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly

65 70 75 80

Lys?Gly?Gly?Gly?Leu?Asn?Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser

85 90 95

Ser?Ser?Thr?Lys?Ile?Asp?Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe

100 105 110

Leu?Phe?Leu?Met?Ala?Val?Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu

115 120 125

Val?Ala?Ile?Asp?Thr?Gly?Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro

130 135 140

Cys?Ala?Val?His?Cys?His?Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe

145 150 155 160

Asp?Pro?Gly?Arg?Ser?Tyr?Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val

165 170 175

Lys?Cys?Gly?Glu?Leu?Arg?Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys

180 185 190

Met?Glu?Lys?Glu?Asp?Ser?Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly

195 200 205

Trp?Ala?Tyr?Ser?Val?Gly?Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly

210 215 220

Asp?Ser?Phe?Met?Asp?Leu?Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr

225 230 235 240

Ser?Glu?Phe?Glu?Ala?Gly?Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser

245 250 255

Phe?Phe?Glu?Gln?Leu?Ala?Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala

260 265 270

Phe?Ser?Tyr?Cys?Leu?Pro?Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile

275 280 285

Leu?Gly?Arg?Tyr?Asp?Arg?Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu

290 295 300

Phe?Arg?Ser?Ile?Asn?Arg?Pro?Thr?Tyr?Ser?Leu?Thr?Met?Glu?Met?Leu

305 310 315 320

Ile?Ala?Asn?Gly?Gln?Arg?Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val

325 330 335

Asp?Ser?Gly?Ala?Gln?Arg?Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu

340 345 350

Leu?Asp?Lys?Thr?Ile?Thr?Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg

355 360 365

Thr?Ser?Arg?Ala?Arg?Gln?Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His

370 375 380

Asp?Tyr?Ser?Gly?Trp?Asn?Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser

385 390 395 400

Ala?Leu?Pro?Leu?Leu?Glu?Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala

405 410 415

Leu?Pro?Pro?Arg?Asn?Val?Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys

420 425 430

Met?Thr?Phe?Ala?Gln?Asn?Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn

435 440 445

Arg?Val?Thr?Arg?Ser?Phe?Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln

450 455 460

Phe?Gly?Phe?Lys?Tyr?Ala?Ala?Cys

465 470

Claims (2)

1. the paddy rice indica and japonica subspecies wide compatibility gene S 5-n of separating clone, it is the nucleotide sequence shown in the 1-1778 position among (a) SEQ ID NO:1, or (b) coding and the identical proteinic nucleotide sequence of (a) encoded protein matter.

2. the application of the described gene S5-n of claim 1 in rice modification.

Images