CN101649322B - Separation clone of rice japonica type hybrid fertility gene S5-j and application thereof - Google Patents

Separation clone of rice japonica type hybrid fertility gene S5-j and application thereof Download PDF

Info

Publication number
CN101649322B
CN101649322B CN2009101488666A CN200910148866A CN101649322B CN 101649322 B CN101649322 B CN 101649322B CN 2009101488666 A CN2009101488666 A CN 2009101488666A CN 200910148866 A CN200910148866 A CN 200910148866A CN 101649322 B CN101649322 B CN 101649322B
Authority
CN
China
Prior art keywords
ser
leu
gly
ala
thr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2009101488666A
Other languages
Chinese (zh)
Other versions
CN101649322A (en
Inventor
张启发
欧阳亦聃
陈炯炯
丁寄花
刘克德
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN2009101488666A priority Critical patent/CN101649322B/en
Publication of CN101649322A publication Critical patent/CN101649322A/en
Application granted granted Critical
Publication of CN101649322B publication Critical patent/CN101649322B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention relates to the technical field of plant gene engineering, in particular to the separation clone and the function verification of rice japonica type hybrid fertility genes S5-j and the application in improved rice thereof. The separation clone of rice japonica type hybrid fertility gene S5-j comprises a japonica type hybrid fertility gene DNA sequence and the coded aspartyl protease thereof. Two subspecies of indica type rice and non glutinous rice have stronger heterosis among rice varieties, but the sterility of the indica type rice subspecies limits the utilization of the heterosis. The cloned japonica type hybrid fertility gene plays an important role for overcoming the hybrid sterility of the indica type rice subspecies.

Description

The separating clone of rice japonica type hybrid fertility gene S 5-j and application
Technical field
The present invention is dividing an application of application number 200710053552.9 patent application cases.The present invention relates to the plant gene engineering technology field.Be specifically related to a kind of separating clone, functional verification and the application in rice modification of japonica type hybrid fertility gene S 5-j.
Background technology
Paddy rice belongs to the Oryza (Oryzeae) of Gramineae (Gramineae), Agrostidoideae (Pooideae), is divided into two cultivation seed rice: Asia cultivated rice (Oryza sativa L.) and African cultivated rice (Oryza glaberrima).The Asia cultivated rice is divided into Xian subspecies (ssp.indica) and round-grained rice subspecies (ssp.japonica) again.Two subspecies exist evident difference in form and heredity, also exist simultaneously dysgenesia, subspecies indica and japonica hybrid often shows as sterile or half sterile (Kato S, Kosaka H, Hara S (1928) On the affinity of ricevarieties as shown by fertility of hybrid plants.Bull Sci Fac Agric Kyushu Univ, 3:132-147; Oka HI (1988) Origin of cultivated rice.Scientific Societies Press, Tokyo, Japan pp 181-209; Liu KD, Zhou ZQ, Xu CG, Zhang Q, Saghai Maroof MA (1996) An analysis of hybrid sterility in riceusing a diallel cross of 21 parents involving indica, japonica and wide compatibility varieties.Euphytica 90:275-280).Have than hybrid vigour stronger between rice varieties between the paddy rice indica and japonica subspecies, but the sterility of subspecies indica and japonica hybrid has limited its heterotic utilization.The investigator utilizes various genetic markers that the sterile phenomenon of paddy rice subspecies indica and japonica hybrid has been carried out extensive studies.Studies show that the site that influences the small ear fertility corresponds respectively to blastular fertility and pollen fertility, illustrate that male abortion and female abortion all have very important effect to the inter subspecific hybrid abortion.Research further shows, not affine mutual work often takes place in the gene of control paddy rice indica-japonica hybrid fertility under heterozygous state, make microgamete abortion or megagamete abortion, but these genes (in pure and mild parent) under homozygotic state do not influence the normal development of gamete.
Ikehashi and Araki (Ikehashi H, Araki H (1986) Genetics of F 1Sterility in remote crosses ofrice.In:IRRI (ed) Rice genetics.IRRI, Manila, pp 119-130) at first a site that influences hybrid fertile is positioned between the 6th chromosomal chromogene C and the glutinous trait gene wx, and called after S5.They point out that by the investigation to the fertility separating resulting S5 site is one group of multiple allelomorphos: S5-n (extensively affine), S5-i (long-grained nonglutinous rice), S5-j (japonica rice).Described gene symbol S represents hybrid sterility (Sterility), and on behalf of neutral type (neutral), n, i and j also claim the multiple allelomorphos of wide affinity type (wide-compatibility), indica type (indica) and round-grained rice type (japonica) respectively.Wherein, by the zygote that S5-n/S5-n, S5-n/S5-i, S5-n/S5-j combine, hybrid fertile is normal.And, then show as sterile or half sterile by the zygote that S5-j/S5-i forms.
In order in breeding of hybridized rice, effectively to overcome the problem of hybrid sterility, the present invention has obtained a plurality of allelotrope of paddy rice hybrid fertility gene S5 by map based cloning (map-based cloning) technology, comprise wide affinity type S5-n, indica type S5-i and round-grained rice type S5-j, verified the function of this gene by transgenic experiments.The separating clone of this gene makes the utilization of paddy rice subspecies indica and japonica hybrid advantage become possibility.Its functional study and application further improve the biological yield of hybrid rice with powerful hybrid vigour between better utilised paddy rice indica and japonica subspecies.
Summary of the invention
The objective of the invention is rice japonica type hybrid fertility gene S 5-j of separating clone from japonica rice, provide above-mentioned hybrid fertile gene coded protein, and this gene is carried out functional verification and the application in the paddy rice cross breeding breeding.Described gene and aspartyl protease gene order height homology, its biological function is the blastular fertility of control paddy rice long-grained nonglutinous rice and japonica rice hybrid.This gene causes japonica rice and the abortion of indica hybrid offspring megagamete, plays an important role with the biological yield that improves paddy rice to utilizing the hybrid vigour between indica and japonica subspecies.
The present invention relates to separate and use the dna fragmentation of the japonica type hybrid fertility gene S 5-j of a coding aspartyl protease, and this segmental mechanism of action is set forth.Wherein, described fragment perhaps is equivalent to the height homologous DNA sequence shown in the SEQ ID NO:2 basically shown in sequence table SEQ ID NO:2, and perhaps its function is equivalent to the subfragment of sequence shown in the SEQ ID NO:2.
Can adopt the dna fragmentation of the japonica type hybrid fertility gene S 5-j of having cloned to make probe, screening obtains gene of the present invention or homologous gene from cDNA and genomic library.Can adopt round pcr, from genome, mRNA and the cDNA of cultivated rice or wild-rice amplification obtain japonica type hybrid fertility gene S 5-j of the present invention and any interested section of DNA or with its homologous section of DNA.Equally also can take the method for chemosynthesis to obtain gene of the present invention or homologous gene.Adopt above technology, can separate the sequence that obtains comprising japonica type hybrid fertility gene S 5-j, with this sequence and any expression vector transformed plant that can guide foreign gene in plant, to express, can obtain the transfer-gen plant sterile to the indica hybrid offspring.Gene of the present invention can add any strong promoter or inducible promoter in being building up to plant expression vector the time before its transcription initiation Nucleotide.Gene of the present invention also can use enhanser in being building up to plant expression vector the time, and these enhanser zones can be ATG initiator codon and neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the translation of whole sequence.
The expression vector that carries japonica type hybrid fertility gene S 5-j of the present invention can be by using Ti-plasmids, plant viral vector, directly DNA transforms, microinjection, conventional biotechnological means such as electroporation imports vegetable cell (Weissbach (1998) Method for Plant MolecularBiology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant MolecularBiology (2 NdEdition)).
The present invention will be further described below in conjunction with specific embodiment.
Description of drawings
Sequence table SEQ ID No:1 shows be separating clone of the present invention include S5-n gene coding region sequence dna fragment.Sequence table SEQ IDNo:2 shows be separating clone of the present invention include S5-j gene coding region sequence dna fragment.Sequence table SEQ ID No:3 shows be separating clone of the present invention include S5-i gene coding region sequence dna fragment.
Fig. 1: S5 gene clone and isolation identification schema.
Fig. 2: long-grained nonglutinous rice, japonica rice and wide affine kind hybrid fertile synoptic diagram under the S5 genetic effect.
Fig. 3: complementary vector construction synoptic diagram.
Fig. 4: the structure of genetic transformation carrier pCAMBIA1301.
Fig. 5: T 1Can educate with negative plant (right side) small ear of transgenosis for transgenic positive plant (left side) small ear is sterile.
Fig. 6: T 1All can educate for negative plant (a) of transgenosis and transgenic positive plant (b) pollen.
Fig. 7: T 1Can educate and the abortion of transgenic positive plant (b) blastular for negative plant (a) blastular of transgenosis.Scale length 50 μ m.
Fig. 8: T 0For transgenic positive plant and negative plant (a) of transgenosis and T 1For transgenic positive plant and negative plant (b) blastular of transgenosis fertility, pollen fertility and small ear fertility diagram.
Fig. 9: wide affine kind, japonica rice and long-grained nonglutinous rice S5 gene cDNA structural representation.
Figure 10: wide affine kind, japonica rice and long-grained nonglutinous rice S5 protein structure synoptic diagram.
Figure 11: the S5 gene is the expression level synoptic diagram in the rice at whole growth periods different tissues.The chip data that uses comprises 25 kinds of different tissues under long-grained nonglutinous rice Zhenshan 97 and Minghui 63 different growing stages.
Figure 12: vitro detection S5 albumen absolute activity (a) and relative reactivity (b).Wherein absolute activity is blank determination with water, and relative reactivity is a blank determination with the highest point of this protein-active.White histogram signal proteolytic enzyme is active under condition of different pH, and dark histogram signal protease activity is suppressed by pepstatin A.
Figure 13: SDS-PAGE glue figure shows S5 albumen self montage activity under condition of different pH.
Figure 14: the expressive site of S5 gene in paddy rice determined in situ hybridization.(a) this gene is expressed at Ballila integument and sporocyte; (b) this gene is expressed in 02428 megarchidium and sporocyte; (c) this gene is expressed in the Ballila microsporocyte.Scale length is 25 μ m.
Embodiment
Following examples further define the present invention, and have described the method (the invention flow process as shown in Figure 1) that the present invention's separating clone on above-mentioned previous work basis includes the dna fragmentation and the checking S5 gene function of S5 gene complete coding section.According to following description and these embodiment, those skilled in the art can determine essential characteristic of the present invention, and under the situation that does not depart from spirit and scope of the invention, the present invention are made various changes and modification, so that its suitable various uses and condition.
Embodiment 1: separating clone includes the dna fragmentation of S5 constant gene segment C
1. utilize map based cloning technical evaluation paddy rice S5 gene
Three parents have been used when making up target group among the present invention: 02428, Nanjing 11 and Balilla.02428 is the wide affine kind of a round-grained rice type, be to select two japonica rice variety Yunnan crab paddy and Shanghai Ji Bang rice for use, handle with radioinduction respectively, and the storeroom that filters out through high light efficiency hybridization, (the Zou Jiangshi etc. that seed selection becomes from the offspring, wide affine choosing is 02428 Preliminary Exploitation at Hybrids of Indica and Japonica. Scientia Agricultura Sinica, and 1989,22:6-14).The middle Xian kind that Nanjing 11 is bred for the academy of agricultural sciences, Jiangsu belongs to the triumph Xian strain of deriving.Bali draws (Balilla) to draw from gondola round-grained rice type kind.
The present invention has made up three friendship F that comprise 7000 individual plants in previous work 1Large group.Spring in 1999 was prepared 11 cross combinations of 02428/ Nanjing in Lingshui, Hainan.Plant F in Wuhan summer in the same year 1For plant, screen positive individual plant.Winter in 1999,, and divide the container made of bamboo, wicker, ratten, etc. with base, Lingshui, hybrid rice container made of bamboo, wicker, ratten, etc. migration Hainan as far as possible.In 2000 springs, as female parent, hand over F with a large amount of preparations three of Balilla with 02428/ Nanjing, the 11 true hybrid rice container made of bamboo, wicker, ratten, etc.s 1Hybrid.Summer in 2000,, divide individual plant plant 02428/ Nanjing 11//Balilla three to hand over F in Hua Zhong Agriculture University (Wuhan) rice test field in paddy growth season 1Colony becomes seedling 7000 strains at last altogether.
Investigate 7000 strains three and hand over F 1The individual plant of all high setting percentages in the colony has obtained the setting percentage of strain more than 1000 altogether at the individual plant more than 70%.Therefrom picked at random 202 strain setting percentages carry out DNA extracting and labeled analysis at the true hybrid individual plant more than 70%, the molecule marker of S5 section is recombinated to exchange analyze.The extracting of DNA is carried out (Murray M G, Thompson W F (1980) Rapid isolation of high molecular weight plant DNA.Nucl Acids Res.8:4321-4325) by the CTAB method of Murray and Thompson.The rflp analysis of molecule marker, comprise that the DNA enzyme is cut, electrophoresis, commentaries on classics film and hybridization, undertaken by people's such as Liu (Liu K D et al. (1997) A genome-wideanalysis of wide compatibility in rice and the precise location of the S5 locus in the molecularmap.Theor Appl Genet.95:809-814) experimental arrangement.The S5 gene is limited between molecule marker N29 and the 23D12R, and the result is as shown in table 1.
Table 1 utilizes the location of 202 plant height setting percentage individual plants to wide compatibility gene
Figure G2009101488666D00031
Choose SSR mark RM253 or PCR-RFLP mark C11 and RG213 the individual plant of all high setting percentages is scanned, individual plant is used SSR mark RM276 and RM225 screens.Wherein, mark RM225, RM253 and C11 are positioned at the side of gene S5, and mark RG213 and RM276 are positioned at the opposite side of gene S5.Screened 44 strains altogether the individual plant of reorganization has taken place between mark.The molecule marker that utilizes the S5 section has carried out recombination analysis to the reorganization individual plant of this 44 plant height setting percentage, and the result shows that the S5 gene is limited between molecule marker 7B1 and the 15D2, and respectively there is a reorganization individual plant at two ends, and the recombinate information of individual plant of part is as shown in table 2.
Table 2 utilizes the gene type assay (partial data) of the molecule marker of S5 section to 44 strains reorganization individual plant
Figure G2009101488666D00032
aGenotype?0?of?each?locus?was?composed?of?an?allele?from?02428?and?an?allele?from?Balilla
bGenotype?1?of?each?locus?was?composed?of?an?allele?from?Nanjing?11?and?an?allele?from?Balilla
The above results with the S5 assignment of genes gene mapping on the DNA section of about 40kb between two subclone molecule marker 7B1 and the 15D2.Utilize the FGENSH software on the http://www.softberry.com website dna fragmentation of 40kb between molecule marker 7B1 and the 15D2 to be carried out the prediction of open reading frame (open reading frame:ORF), detected 5 complete ORF s altogether, Blaxt X homology analysis is found candidate gene ORF5 and aspartate protease (eukaryotic aspartyl protease) height homology.
2. the performance of the structure of genetic transformation carrier and transfer-gen plant
Gene S5 of the present invention site is one group of multiple allelomorphos: S5-n (extensively affine), S5-i (long-grained nonglutinous rice), S5-j (japonica rice).Wherein, by the zygote that S5-n/S5-n, S5-n/S5-i, S5-n/S5-j combine, hybrid fertile is normal.And, then show as sterile or half sterile (Fig. 2) by the zygote that S5-j/S5-i forms.According to the function of this gene, the applicant takes the long-grained nonglutinous rice fragment is transformed the strategy of japonica rice plant, verifies from the fertility phenotype of transfer-gen plant (genotype S5-j/S5-j+S5-i).This gene will produce sterile phenotype.
Complementary construction of carrier is: according to long-grained nonglutinous rice Nanjing 11 genome sequences design PCR primer ASPHF (5 '-TAAAAAGCTTCATCATGGGCTGCTGCTAGATGGA-3 ') and ASPHR (5 '-TGCTAAGCTTTACGAGGTCATGGGTTGAAGTCCT-3 ') the candidate gene section is increased out, the used reagent of complementary carrier external source pcr amplification reaction is from Takara company, reaction conditions is: 94 ℃, and 3min; 94 ℃, 1min, 60 ℃, 1min, 68 ℃, 6min, 30cycles; 72 ℃, 5min.
Complementary vector construction synoptic diagram as shown in Figure 3.The PCR product is directly cut with the HindIII enzyme, binary vector (Fig. 4) pCAMBIA1301 is (from Australian CAMBIA laboratory (Center for the Application of Molecular Biology to InternationalAgriculture), carry the agriculture bacillus mediated genetic transformation carrier of the corn strong promoter Ubiquitinl with composing type and overexpression feature) also adopt the HindIII enzyme to cut, connect behind the dephosphorylation.Transformed into escherichia coli DH10 β (available from Invitrogen company), screening positive clone.The employing agrobacterium mediation method transforms, agrobacterium strains is super virulent strain EHA105 (Sun X, Cao Y, Yang Z, Xu C, Li X, Wang S, Zhang Q (2004) Xa26, a gene conferring resistance to Xanthomonas oryzae pv.oryzae inrice, encoding a LRR receptor kinase-like protein.Plant J 37:517-527), genetically modified acceptor is japonica rice variety Balilla.
The key step of genetic transformation of the present invention, substratum and compound method thereof are as described below:
(1) reagent and solution abbreviation
The abbreviation of the used plant hormone of substratum is expressed as follows among the present invention: 6-BA (6-BenzylaminoPurine, 6-benzyladenine); CN (Carbenicillin, Pyocianil); KT (Kinetin, kinetin); NAA (Napthalene acetic acid, naphthylacetic acid); IAA (Indole-3-acetic acid, indolylacetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid, 2,4 dichlorophenoxyacetic acid); AS (Acetosringone, Syringylethanone); CH (Casein Enzymatic Hydrolysate, caseinhydrolysate); HN (Hygromycin B, Totomycin); DMSO (Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); N6max (N6 macroelement composition solution); N6mix (N6 trace element composition solution); MSmax (MS macroelement composition solution); MSmix (MS trace element composition solution)
(2) main solution formula
1) N6 substratum macroelement mother liquor (according to 10 times of concentrated solutions (10X) preparation)
Saltpetre (KNO 3) 28.3 grams
Potassium primary phosphate (KH 2PO 4) 4.0 grams
Ammonium sulfate ((NH 4) 2SO 4) 4.63 grams
Sal epsom (MgSO 47H 2O) 1.85 grams
Calcium chloride (CaCl 22H 2O) 1.66 grams
Mentioned reagent is dissolved one by one, be settled to 1000 milliliters with distilled water under the room temperature then.
2) N6 substratum trace element mother liquor (is prepared according to 100 times of concentrated solutions (100X)
Potassiumiodide (KI) 0.08 gram
Boric acid (H 3BO 3) 0.16 gram
Manganous sulfate (MnSO 44H 2O) 0.44 gram
Zinc sulfate (ZnSO 47H 2O) 0.15 gram
Mentioned reagent is at room temperature dissolved and be settled to 1000 milliliters with distilled water.
3) molysite (Fe 2EDTA) stock solution (according to the preparation of 100X concentrated solution)
With 3.73 gram b diammonium disodium edta (Na 2EDTA2H 2O) and 2.78 the gram FeSO 47H 2O dissolves respectively, mixes and is settled to 1000 milliliters with distilled water, bathes 2 hours to 70 ℃ of temperature, and 4 ℃ of preservations are standby.
4) VITAMIN stock solution (according to the preparation of 100X concentrated solution)
Nicotinic acid (Nicotinic acid) 0.1 gram
VITMAIN B1 (Thiamine HCl) 0.1 gram
Vitamin B6 (Pyridoxine HCl) 0.1 gram
Glycine (Glycine) 0.2 gram
Inositol (Inositol) 10 grams
Adding distil water is settled to 1000 milliliters, and 4 ℃ of preservations are standby.
5) MS substratum macroelement mother liquor (MSmax mother liquor) (according to the preparation of 10X concentrated solution)
Ammonium nitrate (NH 4NO 3) 16.5 grams
Saltpetre 19.0 grams
Potassium primary phosphate 1.7 grams
Sal epsom 3.7 grams
Calcium chloride 4.4 grams
Mentioned reagent is at room temperature dissolved, and be settled to 1000 milliliters with distilled water.
6) MS substratum trace element mother liquor (MSmin mother liquor) (according to the preparation of 100X concentrated solution)
Manganous sulfate (MnSO 44H 2O) 2.23 grams
Zinc sulfate (ZnSO 47H 2O) 0.86 gram
Boric acid (H 3BO 3) 0.62 gram
Potassiumiodide (KI) 0.083 gram
Sodium orthomolybdate (Na 2MoO 42H 2O) 0.025 gram
Copper sulfate (CuSO 45H 2O) 0.0025 gram
Cobalt chloride (CoCl 26H 2O) 0.0025 gram
Mentioned reagent is at room temperature dissolved, and be settled to 1000 milliliters with distilled water.
7) 2, the preparation of 4-D stock solution (1 mg/ml):
Weigh 2,100 milligrams of 4-D dissolved 5 minutes with 1 milliliter of 1N potassium hydroxide, added then to be settled to 100 milliliters after 10 ml distilled waters dissolve fully, preserved under room temperature.
8) preparation of 6-BA stock solution (1 mg/ml):
Weigh 100 milligrams of 6-BA,, be settled to 100 milliliters, room temperature preservation after adding the dissolving fully of 10 ml distilled waters then with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes.
9) preparation of naphthylacetic acid (NAA) stock solution (1 mg/ml):
Weigh 100 milligrams of NAA, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, be settled to 100 milliliters after adding the dissolving fully of 10 ml distilled waters then, 4 ℃ of preservations are standby.
10) preparation of indolylacetic acid (IAA) stock solution (1 mg/ml):
Weigh 100 milligrams of IAA, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, be settled to 100 milliliters after adding the dissolving fully of 10 ml distilled waters then, 4 ℃ of preservations are standby.
11) preparation of glucose stock solution (0.5 grams per milliliter):
Weigh glucose 125 grams, be settled to 250 milliliters with dissolved in distilled water then, the back 4 ℃ of preservations of sterilizing are standby.
12) preparation of AS stock solution:
Weigh AS 0.392 gram, add 10 milliliters of dissolvings of DMSO, divide to be filled in 1.5 milliliters of centrifuge tubes, 4 ℃ of preservations are standby.
13) 1N potassium hydroxide stock solution
Weigh potassium hydroxide 5.6 grams, be settled to 100 milliliters with dissolved in distilled water, room temperature preservation is standby.
(3) be used for the culture medium prescription that rice genetic transforms
1) inducing culture
100 milliliters in N6max mother liquor (getting the 10X concentrated solution that has prepared, down together)
10 milliliters in N6mix mother liquor (getting the 100X concentrated solution that has prepared, down together)
Fe 2+10 milliliters of EDTA stock solutions (getting the 100X concentrated solution that has prepared, down together)
10 milliliters of VITAMIN stock solutions (getting the 100X concentrated solution that has prepared, down together)
2,2.5 milliliters of 4-D stock solutions (get above-mentioned prepare)
Proline(Pro) (Proline) 0.3 gram
CH 0.6 gram
Sucrose 30 grams
Phytagel 3 grams
Adding distil water to 900 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, boil and be settled to 1000 milliliters, divide and install to 50 milliliters of triangular flasks (25 milliliters/bottle), sterilization according to a conventional method after sealing (for example sterilized 25 minutes down for 121 ℃, following medium sterilization method is identical with the sterilising method of basal culture medium).
2) subculture medium
100 milliliters in N6max mother liquor (10X)
10 milliliters in N6mix mother liquor (100X)
Fe 2+10 milliliters of EDTA stock solutions (100X)
10 milliliters of VITAMIN stock solutions (100X)
2,2.0 milliliters of 4-D stock solutions
Proline(Pro) 0.5 gram
CH 0.6 gram
Sucrose 30 grams
Phytagel 3 grams
Adding distil water to 900 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, boils and is settled to 1000 milliliters, divides to install to 50 milliliters of triangular flasks (25 milliliters/bottle), seals, as stated above sterilization.
3) pre-culture medium
12.5 milliliters in N6max mother liquor (10X)
1.25 milliliters in N6mix mother liquor (100X)
Fe 2+2.5 milliliters of EDTA stock solutions (100X)
2.5 milliliters of VITAMIN stock solutions (100X)
2,0.75 milliliter of 4-D stock solution
CH 0.15 gram
Sucrose 5 grams
Agar powder 1.75 grams
Adding distil water to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.6, seals, as stated above sterilization.
Use preceding heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/ware) in the culture dish are poured in packing into.
4) be total to substratum
12.5 milliliters in N6max mother liquor (10X)
1.25 milliliters in N6mix mother liquor (100X)
Fe 2+2.5 milliliters of EDTA stock solutions (100X)
2.5 milliliters of VITAMIN stock solutions (100X)
2,0.75 milliliter of 4-D stock solution
CH 0.2 gram
Sucrose 5 grams
Agar powder 1.75 grams
Adding distil water to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.6, seals, as stated above sterilization.
Use preceding heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/every ware) in the culture dish are poured in packing into.
5) suspension culture base
5 milliliters in N6max mother liquor (10X)
0.5 milliliter in N6mix mother liquor (100X)
Fe 2+0.5 milliliter of EDTA stock solution (100X)
1 milliliter of VITAMIN stock solution (100X)
2,0.2 milliliter of 4-D stock solution
CH 0.08 gram
Sucrose 2 grams
Adding distil water to 100 milliliter is regulated pH value to 5.4, divides in the triangular flask that installs to two 100 milliliters, seals, as stated above sterilization.
Add 1 milliliter of aseptic glucose stock solution and 100 microlitre AS stock solutions before using.
6) select substratum
25 milliliters in N6max mother liquor (10X)
2.5 milliliters in N6mix mother liquor (100X)
Fe 2+2.5 milliliters of EDTA stock solutions (100X)
2.5 milliliters of VITAMIN stock solutions (100X)
2,0.625 milliliter of 4-D stock solution
CH 0.15 gram
Sucrose 7.5 grams
Agar powder 1.75 grams
Adding distil water to 250 milliliter is regulated pH value to 6.0, seals, as stated above sterilization.
Dissolving substratum before using adds 250 microlitre HN (50 mg/ml) and (25 milliliters/ware) in the culture dish are poured in 400 microlitre CN (250 mg/ml) packing into.(annotate: selecting substratum Pyocianil concentration for the first time is 400 mg/litre, and selecting substratum Pyocianil concentration for the second time and later on is 250 mg/litre).
7) break up substratum in advance
25 milliliters in N6max mother liquor (10X)
2.5 milliliters in N6mix mother liquor (100X)
Fe 2+2.5 milliliters of EDTA stock solutions (100X)
2.5 milliliters of VITAMIN stock solutions (100X)
0.5 milliliter of 6-BA stock solution
0.5 milliliter of KT stock solution
NAA stock solution 50 microlitres
IAA stock solution 50 microlitres
CH 0.15 gram
Sucrose 7.5 grams
Agar powder 1.75 grams
Adding distil water to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, seals, as stated above sterilization.
Dissolving substratum before using, 250 microlitre HN (50 mg/ml), 250 microlitre CN (250 mg/ml), (25 milliliters/ware) in the culture dish are poured in packing into.
8) division culture medium
100 milliliters in N6max mother liquor (10X)
10 milliliters in N6mix mother liquor (100X)
Fe 2+10 milliliters of EDTA stock solutions (100X)
10 milliliters of VITAMIN stock solutions (100X)
2 milliliters of 6-BA stock solutions
2 milliliters of KT stock solutions
0.2 milliliter of NAA stock solution
0.2 milliliter of IAA stock solution
CH 1 gram
Sucrose 30 grams
Phytagel 3 grams
Adding distil water to 900 milliliter, 1N potassium hydroxide is regulated pH value to 6.0.
Boil and be settled to 1000 milliliters, divide to install to 50 milliliters of triangular flasks (50 milliliters/bottle), seal, as stated above sterilization with distilled water.
9) root media
50 milliliters in MSmax mother liquor (10X)
5 milliliters in MSmix mother liquor (100X)
Fe 2+5 milliliters of EDTA stock solutions (100X)
5 milliliters of VITAMIN stock solutions (100X)
Sucrose 20 grams
Phytagel 3 grams
Adding distil water to 900 milliliter is regulated pH value to 5.8 with 1N potassium hydroxide.
Boil and be settled to 1000 milliliters, divide to install to (25 milliliters/pipe) in the pipe of taking root, seal, as stated above sterilization with distilled water.
(4) agriculture bacillus mediated genetic transformation step
4.1 callus of induce
1) sophisticated Ballila rice paddy seed is shelled, used 70% Ethanol Treatment then successively 1 minute, 0.15% mercury chloride (HgCl 2) seed-coat sterilization 15 minutes;
2) wash seed 4-5 time with sterilization;
3) seed is placed on the inducing culture;
4) postvaccinal substratum is placed dark place cultivate 4 weeks, 25 ± 1 ℃ of temperature.
4.2 callus subculture
Select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put in dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down on the subculture medium.
4.3 pre-the cultivation
Select the embryo callus subculture of consolidation and relatively dry, be put in dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down on the pre-culture medium.
4.4 Agrobacterium is cultivated
1) (the LA culture medium preparation is with reference to J. Sa nurse Brooker etc. having the LA substratum that corresponding resistance selects, the molecular cloning experiment guide, the third edition, Jin Dongyan etc. (translating), Science Press, 2002, Beijing) went up the pre-Agrobacterium EHA105 of cultivation (this bacterial strain is from the agrobacterium strains of CAMBIA company public use) two days, 28 ℃ of temperature;
2) Agrobacterium is transferred in the suspension culture base, cultivated 2-3 hour on 28 ℃ of shaking tables.
4.5 Agrobacterium is infected
1) pre-incubated callus is transferred in the bottle of the bacterium of having gone out;
2) regulate the suspension of Agrobacterium to OD 6000.8-1.0;
3) callus was soaked in agrobacterium suspension 30 minutes;
4) shifting callus blots to the good filter paper of sterilization; Be placed on then on the common substratum and cultivated temperature 19-20 ℃ 3 days.
4.6 callus washing and selection are cultivated
1) aqua sterilisa washing callus is to cannot see Agrobacterium;
2) be immersed in the aqua sterilisa that contains 400 milligrams/L Totomycin 30 minutes;
3) shifting callus blots to the good filter paper of sterilization;
4) shift callus to selecting to select on the substratum cultivation 2-3 time, each 2 weeks.
4.7 differentiation
1) kanamycin-resistant callus tissue is transferred on the pre-differentiation substratum in dark place cultivation 5-7 days;
2) callus that shifts pre-differentiation cultivation is to division culture medium, and illumination is cultivated down, 26 ℃ of temperature.
4.8 take root
1) cuts the root that differentiation phase produces;
Then it is transferred to and cultivates 2-3 week, 26 ℃ of temperature in the root media under the illumination.
4.9 transplant
Wash the residual substratum on the root off, the seedling that will have good root system changes the greenhouse over to, divides moistening at initial several Tian Bao water holding simultaneously.
The present invention obtains independent transgenosis T altogether 0For rice plant 33 strains, comprise positive individual plant of 29 strains and the negative individual plant of 4 strains.The T that is obtained 1Is example for rice plant with the B10 family, comprises positive individual plant of 15 strains and the negative individual plant of 14 strains.
The transgenic paddy rice positive and negative plant small ear fertility (Fig. 5) significant difference (t=7.4, P=0.0000); The negative average fertility of plant small ear of transgenic paddy rice (53.3%) is far above the small ear fertility of transgenic paddy rice positive plant 2.8%.The applicant has also detected T 0Blastular fertility and pollen fertility for transgenic rice plant, pollen fertility no significant difference (see figure 6) in transgenic positive and negative rice plant wherein, and the negative plant blastular of transgenosis fertility be significantly higher than transgenic positive plant blastular fertility (Fig. 7) (t=12.33, P=0.0000).T 0For transgenic positive plant and negative plant of transgenosis and T 1For the negative plant blastular of transgenic positive plant and transgenosis fertility, pollen fertility and small ear fertility as shown in Figure 8, the result shows that japonica type hybrid fertility gene S 5-j that the present invention clones participates in decision japonica rice and long-grained nonglutinous rice inter-subspecies hybrid offspring's megagamete fertility, to cause the blastular abortion, and then cause hybrid fertile to reduce.
3. the separating clone that contains the dna fragmentation of S5 constant gene segment C
Use the method for terminal rapid amplifying (RACE) of cDNA and PCR primer extension to obtain this full length gene cDNA respectively.Materials used is long-grained nonglutinous rice Nanjing 11, and the five phase blades that japonica rice Ballila and wide affine kind 02428 young fringe are grown are stand-by in-70 ℃ of refrigerators behind the liquid nitrogen freezing.Extract RNA (annotating: TRIZOL Reagent, Invitrogen Cat.No.15596-018) according to the described step of TRIZOL specification sheets, weaker concn to 1 μ g/ μ l ,-70 ℃ of preservations are stand-by.
RACE concrete steps: the SMART that uses Clontech TMRACE cDNA Amplification Kit, step is with reference to this test kit specification sheets.
5 ' end RACE primer S5-GSP1:CCGTTCCAACCAGAATAGTCGTGCT
S5-R1：ACCCGAACATGAGATCCATAAACGA
3 ' end RACE primer S5-GSP2:AAGATGGTGACAGACACGCTGAGGA
S5-RACE4：CAATCAACAGGCCAACCTACTCAC
UPM：Long(0.4M)：CTAATACGACTCACTATAGGGCAAGCAGTGGTA?TCAA?CGCAGAGT
Short(2μM)：CTAATACGACTCACTATAGGGC
NUPM：AAGCAGTGGTATCAACGCAGAGT
Wherein UPM and NUPM are provided by the mentioned reagent box.
First round PCR reaction conditions:
94 ℃ of sex change 30 seconds, 72 ℃ 3 minutes, 5 circulations;
94 ℃ of sex change 30 seconds, 70 ℃ of annealing 30 seconds, 72 ℃ were extended 5 circulations 3 minutes;
94 ℃ of sex change 30 seconds, 65 ℃ of annealing 30 seconds, 72 ℃ were extended 27 circulations 3 minutes;
72 ℃ of final extensions 10 minutes.
5 ' RACE uses primer UPM+S5-GSP1
3 ' RACE uses primer UPM+S5-GSP2
Second takes turns the PCR reaction conditions:
94 ℃ of pre-sex change 4 minutes;
94 ℃ of sex change 1 minute, 59 ℃ of annealing 1 minute, 72 ℃ were extended 35 circulations 1 minute 20 seconds;
72 ℃ of final extensions 10 minutes.
5 ' RACE uses primer NUPM+S5-R1
3 ' RACE uses primer NUPM+S5-RACE4
PCR primer extension concrete steps: 20 μ l systems are adopted in reverse transcription, behind trace amount DNA among the described step removal of the DNaseI specification sheets RNA, press SuperScript TMThe described step operation of II specification sheets, product is stand-by in-20 ℃ of preservations.(annotate: Deoxyribonuclease I, Invitrogen Cat.No.18068-015; SuperScript TMII Reverse Transcriptase, Invitrogen Cat.No.18064-022) use above-mentioned reverse transcription product 1 μ l to be PCR as template.Use Takara Ex Taq (Takara code:DRR01AM) to be PCR, the PCR agents useful for same is all packed from Takara Ex Taq.
The PCR the primer is as follows:
F5-3：ATCAACCCATTTCCTTTCCTACG
F5-2：CTGCCCCTGAGCAAGCAAGAAAG
F19-3：AGCCGACGACGAGTTGGAGTGT
5F2：CCAAGATCTGCCGACGACGAGTTGGAGTGT
BDF2：GACGACGAGTTGGAGTGT
S5-F11：CAGCCGACGACGAGTTGGAGT
S5-F2：GTGCGGCGAGCTGAGGTACGAT
S5-GSP2：AAGATGGTGACAGACACGCTGAGGA
S5-RACE4：CAATCAACAGGCCAACCTACTCAC
R11：ATGTGTAGGATCTGCCGGGATCGA
BDR：CATTAGGAACAGGAAGTCGT
S5-R11：CTCTGCCCGTTGGCGATAAGC
S5-R2：TCTGGGTGGCAAAGCGAGTGC
S5-R33：ATGGCGGCACGGTCGTATCTT
R3-1：ACGTAAACATCTAGTAGTGGCTCA
R3-2：TTGGCACGAACGGTTCAAGAG
R3-3：GATCAGTTATTTGGGCAAACCAG
R3-4：GGTCCCAAATCAAGTACCGCTAG
R3-5：GCTCAACAATTAGGACATACGAC
Respectively RACE product and the order-checking of PCR product are obtained required full-length gene.
Embodiment 2:S5 gene is in the structural analysis of the different subspecies of paddy rice
The sequence that obtains of order-checking among the embodiment 1 is analyzed: the full-length cDNA of rice varieties 02428 (extensively affine), Ballila (japonica rice) and Nanjing 11 (long-grained nonglutinous rice) is respectively 1778bp, 1912bp and 1911bp, and its structure is formed (Fig. 9) by three exons and two introns.Long-grained nonglutinous rice and japonica rice have and only have the difference of three bases, wherein there is the disappearance of a single base in Nanjing 11 at 3 ' non-translational region, Nanjing 11 and Ballila have two single base polymorphismses (single nucleotide polymorphism in the coding region, SNP), these two SNP form two missense mutation (Figure 10) in proteins encoded.One 472 amino acid whose protein of S5 genes encoding, BLASTp are analyzed (http://www.ncbi.nlm.nih.gov/) and are shown this albumen and aspartyl protease height homology.PROSITE (http://www.expasy.ch/cgi-bin/prosite/) analyzes and finds that there are two avtive spots in this albumen at 129-140 amino acid and 334-345 amino acid.SignalP 3.0 (http://www.cbs.dtu.dk/cgi-bin/) software analysis shows that there is a signal peptide in S5 albumen, and it is cut in the albumen ripening process.
Embodiment 3: utilize chip data to detect S5 gene expression level in rice at whole growth periods
The present invention utilizes chip data (Database of the National Center of Plant Gene Research, available athttp: //crep.ncpgr.cn/.) detecting S5 gene expression level in the rice at whole growth periods different tissues, the chip data of use comprises the express spectra (Figure 11) of the 25 kinds of different tissues (table 3) under long-grained nonglutinous rice Zhenshan 97 and Minghui 63 different growing stages.The result shows that the S5 gene is in utmost point low expression level all in the time of infertility.
The corresponding rice tissue title of table 3 chip data
Embodiment 4:S5 albumen has the aspartyl protease activity
Aspartyl protease is activated under acidic conditions and its activity is suppressed (Rawlings ND by pepstatin A, Barrett AJ (1995) Families of aspartic peptidases, and those of unknown catalytic mechanism.Methods Enzymol.248:105-20).And gene of the present invention and aspartyl protease height homology, in order to verify the gene S5 of the present invention typical aspartyl protease of whether encoding, external experiment of this example design verifies whether S5 albumen has this function.
Concrete implementation step is:
(1) prokaryotic expression carrier makes up
Design primer 5F1 (5 '-GGGAGATCTATGGTGATCTTGGAGCAGCCA-3 ', joint adds the BglII restriction enzyme site) and 5R (5 '-AGGCTCGAGCGACGATCAGCAAACGGCA-3 ' joint add the XhoI restriction enzyme site), (from the triumphant company that opens up in Beijing) is template pcr amplification total length with the fine full-length cDNA of Japan.The used reagent of pcr amplification reaction is from Takara company.Reaction conditions is: 94 ℃, and 5min; 94 ℃, 1min, 59 ℃, 1min, 72 ℃, 1.5min, 30cycles; 72 ℃, 5min.Product is building up to
Figure G2009101488666D00112
In-T (available from the Promega) carrier, sequence verification.Respectively external source is building up to (available from BioLabs) in the pMAL-c2x carrier then, carrier is cut with BamHI and XhoI enzyme.
(2) protein induced expression
The expression vector that builds is transformed expression strain BL21 (available from Invitrogen company), reach at 0.6 o'clock Deng bacterium liquid OD value, add final concentration and be IPTG (isopropyl 1-thio-β-D-galactopyranoside), 37 ℃ of abduction delivering 3hrs then of 0.5mM.Collect thalline, add the long-pending PBS of monoploid and suspend, put-20 ℃ and spend the night.Dissolving in second day is placed on ice immediately, and adding final concentration is the PMSF of 1mM, supersound process, and the whole ultrasonic process is carried out on ice, is in native state to guarantee albumen.12000rpm after supersound process is finished, 4 ℃ of frozen centrifugations.Collect supernatant, with Amylose Resin (available from BioLabs) purifying.Purification step is with reference to pMAL TMProtein Fusion and PurificationInstruction Manual, Catalog #E8000S
(3) protease activity detects
The albumen of 20 μ l (10 μ g) purifying, add isopyknic pH damping fluid and 20 μ l FITC-casein (Protease FluorescentDetection Kit), 37 ℃ are reacted adding 100ul 0.6N TCA (trichoroacetic acid(TCA)) precipitation after 15 hours down, the centrifugal 10min of 12000rpm, suct 100ul clearly, add 2ml assay buffer, (Fluorescence spectrophotometer Hitachi850) measures with spectrophotofluorometer.Water is contrast.
The pH buffer formulation:
0.1M?Gly-HCl，pH2.5
0.1M?0.1M?sodium?citrate，pH3.0，pH3.5，pH?4.0；
0.1M?sodium?acetate，pH?5.0；
0.1M?sodium?phosphate，pH?6.0；
Whether (4) detect ASP is suppressed by pepstatin A inhibitor
Experimental procedure: adding final concentration in the target protein of 8 μ g purifying is 0.15mM pepstatin A, 4 ℃ hatch 1.5 hours after, the damping fluid that adds pH=3 is to final volume 40 μ l, and then adding substrate FITC-Casein 20 μ l (sigma, PF0100), after hatching 12 hours under 37 ℃, add 100 μ l 0.6NTCA precipitation, suct 100 μ l clearly, add 2ml assay buffer, (HitachiM850 fluorescence spectrophotometer Japan) measures with spectrophotofluorometer.The purifying protein that only contains label MBP (maltose binding protein) in contrast, each does three repetitions.
(5) self montage of aspartate protease forms ripe proteic initial analysis
The Asp10 μ l of prokaryotic expression purifying (20 μ g) adds the PH damping fluid of 1/2 volume, and 37 ℃ of reactions are spent the night, and adds the long-pending loading buffer of monoploid, poach 5min, and the 12%SDS-PAGE electrophoresis, the Coomassie blue dye liquor dyes glue.
The result shows this albumen activity the highest (Figure 12) under the condition of pH3.0, and is suppressed (Figure 12) fully by pepstatin A.Test and pass through self montage under the condition that shows this albumen pH 2.5-4.0 simultaneously, form maturation protein (Figure 13).
The above results shows gene of the present invention typical aspartyl protease of coding really.
Embodiment 5:S5 expression of gene position
In order to determine S5 expression of gene position, this example has used the RNA hybridization in situ technique.Determine that according to the rna probe hybridization signal gene of the present invention expresses (Figure 14) in megarchidium, integument, sporocyte and microsporocyte.
RNA in situ hybridization flow process is referring to Drews (Drews GN (1998) In situ hybridization.Methods Mol Biol 82:353-71Drews GN (1998) In situ hybridization.Methods Mol Biol 82:353-71).
Sequence table
＜110〉Hua Zhong Agriculture University
＜120〉separating clone of japonica type hybrid fertility gene S 5-j and application
<130>
<141>2007-10-10
<160>7
<170>PatentIn?version?3.1
<210>1
<211>1778
<212>DNA
＜213〉paddy rice (Oryza sativa)
<220>
<221>gene
<222>(1)..(1778)
<223>
<220>
<221>5’UTR
<222>(1441)..(1778)
<223>
<220>
<221>3’UTR
<222>(1)..(21)
<223>
<220>
<221>CDS
<222>(22)..(1440)
<223>
<400>1
atcaacccat?ttcctttcct?a?cgt?ttg?act?gcc?tgc?ctg?ccc?ctg?agc?aag 51
Arg?Leu?Thr?Ala?Cys?Leu?Pro?Leu?Ser?Lys
1 5 10
caa?gaa?aga?aag?aaa?gaa?ggg?att?aaa?ttt?gct?taa?tcc?ggc?gcc?aca 99
Gln?Glu?Arg?Lys?Lys?Glu?Gly?Ile?Lys?Phe?Ala Ser?Gly?Ala?Thr
15 20 25
gca?gcc?gac?gac?gag?ttg?gag?tgt?ccc?tcc?tcc?atc?ttc?gat?cac?gct 147
Ala?Ala?Asp?Asp?Glu?Leu?Glu?Cys?Pro?Ser?Ser?Ile?Phe?Asp?His?Ala
30 35 40
gtg?aac?tct?caa?ggc?gcc?att?cag?ttc?ccc?gtg?ttc?cac?aag?aag?cac 195
Val?Asn?Ser?Gln?Gly?Ala?Ile?Gln?Phe?Pro?Val?Phe?His?Lys?Lys?His
45 50 55
caa?tgc?ctc?cgc?cca?tgg?tct?gtc?cgt?gca?acc?cag?gca?tcc?tcg?acc 243
Gln?Cys?Leu?Arg?Pro?Trp?Ser?Val?Arg?Ala?Thr?Gln?Ala?Ser?Ser?Thr
60 65 70
gga?gca?tca?gga?gca?gga?aaa?gga?gga?gga?ttg?aac?aat?cta?cag?gaa 291
Gly?Ala?Ser?Gly?Ala?Gly?Lys?Gly?Gly?Gly?Leu?Asn?Asn?Leu?Gln?Glu
75 80 85
gag?gag?atc?act?tca?tca?agt?agt?aca?aaa?atc?gac?gtg?atc?gaa?gac 339
Glu?Glu?Ile?Thr?Ser?Ser?Ser?Ser?Thr?Lys?Ile?Asp?Val?Ile?Glu?Asp
90 95 100 105
agc?agc?atc?aac?gac?ttc?ctg?ttc?cta?atg?gcc?gtc?agt?ctg?ggc?aag 387
Ser?Ser?Ile?Asn?Asp?Phe?Leu?Phe?Leu?Met?Ala?Val?Ser?Leu?Gly?Lys
110 115 120
cca?ccg?gtt?gtg?aac?ctg?gtg?gcg?atc?gac?acg?gga?tcc?acc?ctc?tcg 435
Pro?Pro?Val?Val?Asn?Leu?Val?Ala?Ile?Asp?Thr?Gly?Ser?Thr?Leu?Ser
125 130 135
tgg?gtg?caa?tgc?cag?ccg?tgc?gcg?gtg?cac?tgc?cac?acg?cag?tcc?gcg 483
Trp?Val?Gln?Cys?Gln?Pro?Cys?Ala?Val?His?Cys?His?Thr?Gln?Ser?Ala
140 145 150
aag?gcc?ggc?ccg?ata?ttc?gat?ccc?ggc?aga?tcc?tac?aca?tcc?cgg?cga 531
Lys?Ala?Gly?Pro?Ile?Phe?Asp?Pro?Gly?Arg?Ser?Tyr?Thr?Ser?Arg?Arg
155 160 165
gtt?cgc?tgc?tcg?tcg?gtc?aag?tgc?ggc?gag?ctg?agg?tac?gat?ctg?cgg 579
Val?Arg?Cys?Ser?Ser?Val?Lys?Cys?Gly?Glu?Leu?Arg?Tyr?Asp?Leu?Arg
170 175 180 185
ctc?cag?caa?gcc?aat?tgc?atg?gag?aag?gaa?gac?agc?tgc?acg?tac?agc 627
Leu?Gln?Gln?Ala?Asn?Cys?Met?Glu?Lys?Glu?Asp?Ser?Cys?Thr?Tyr?Ser
190 195 200
gtc?acg?tac?ggg?aac?ggg?tgg?gcg?tac?agc?gtg?ggc?aag?atg?gtg?aca 675
Val?Thr?Tyr?Gly?Asn?Gly?Trp?Ala?Tyr?Ser?Val?Gly?Lys?Met?Val?Thr
205 210 215
gac?acg?ctg?agg?att?ggg?gac?tcg?ttt?atg?gat?ctc?atg?ttc?ggg?tgc 723
Asp?Thr?Leu?Arg?Ile?Gly?Asp?Ser?Phe?Met?Asp?Leu?Met?Phe?Gly?Cys
220 225 230
agc?atg?gat?gtc?aag?tac?agc?gaa?ttc?gag?gcc?ggc?atc?ttt?ggt?ttc 771
Ser?Met?Asp?Val?Lys?Tyr?Ser?Glu?Phe?Glu?Ala?Gly?Ile?Phe?Gly?Phe
235 240 245
ggc?agc?agc?agc?ttc?tct?ttc?ttc?gag?cag?ctg?gca?ggg?tac?cct?gat 819
Gly?Ser?Ser?Ser?Phe?Ser?Phe?Phe?Glu?Gln?Leu?Ala?Gly?Tyr?Pro?Asp
250 255 260 265
att?ctg?agt?tac?aag?gca?ttc?agc?tac?tgc?ttg?ccc?act?gac?gag?acc 867
Ile?Leu?Ser?Tyr?Lys?Ala?Phe?Ser?Tyr?Cys?Leu?Pro?Thr?Asp?Glu?Thr
270 275 280
aag?ccc?gga?tac?atg?atc?ctg?gga?aga?tac?gac?cgt?gcc?gcc?atg?gat 915
Lys?Pro?Gly?Tyr?Met?Ile?Leu?Gly?Arg?Tyr?Asp?Arg?Ala?Ala?Met?Asp
285 290 295
ggg?ggt?tac?act?cct?ctc?ttc?cgg?tca?atc?aac?agg?cca?acc?tac?tca 963
Gly?Gly?Tyr?Thr?Pro?Leu?Phe?Arg?Ser?Ile?Asn?Arg?Pro?Thr?Tyr?Ser
300 305 310
ctg?acg?atg?gag?atg?ctt?atc?gcc?aac?ggg?cag?aga?ttg?gtg?aca?tcg 1011
Leu?Thr?Met?Glu?Met?Leu?Ile?Ala?Asn?Gly?Gln?Arg?Leu?Val?Thr?Ser
315 320 325
tct?tcg?gag?atg?atc?gtc?gat?tcc?ggg?gcc?cag?agg?acg?tcc?ctg?tgg 1059
Ser?Ser?Glu?Met?Ile?Val?Asp?Ser?Gly?Ala?Gln?Arg?Thr?Ser?Leu?Trp
330 335 340 345
cct?tcc?act?ttt?gct?ctc?ctt?gac?aag?acc?atc?acg?cag?gca?atg?tcg 1107
Pro?Ser?Thr?Phe?Ala?Leu?Leu?Asp?Lys?Thr?Ile?Thr?Gln?Ala?Met?Ser
350 355 360
tcg?att?ggg?tat?cac?cgg?aca?tca?aga?gcg?cgc?caa?gaa?tca?tac?atc 1155
Ser?Ile?Gly?Tyr?His?Arg?Thr?Ser?Arg?Ala?Arg?Gln?Glu?Ser?Tyr?Ile
365 370 375
tgc?tac?tta?tcg?gag?cac?gac?tat?tct?ggt?tgg?aac?ggc?acc?atc?acg 1203
Cys?Tyr?Leu?Ser?Glu?His?Asp?Tyr?Ser?Gly?Trp?Asn?Gly?Thr?Ile?Thr
380 385 390
ccc?ttc?tcc?aac?tgg?tcc?gcc?ttg?cct?ctg?ctg?gag?atc?ggc?ttc?gcc 1251
Pro?Phe?Ser?Asn?Trp?Ser?Ala?Leu?Pro?Leu?Leu?Glu?Ile?Gly?Phe?Ala
395 400 405
ggc?ggt?gct?gca?ctc?gct?ttg?cca?ccc?aga?aac?gtc?ttc?tac?aac?gat 1299
Gly?Gly?Ala?Ala?Leu?Ala?Leu?Pro?Pro?Arg?Asn?Val?Phe?Tyr?Asn?Asp
410 415 420 425
cca?cac?cgc?ggt?ttg?tgc?atg?acc?ttt?gct?cag?aat?cct?gct?ctc?agg 1347
Pro?His?Arg?Gly?Leu?Cys?Met?Thr?Phe?Ala?Gln?Asn?Pro?Ala?Leu?Arg
430 435 440
tct?cag?ata?ctg?ggg?aac?agg?gtt?act?cga?tcc?ttc?gga?aca?acc?ttc 1395
Ser?Gln?Ile?Leu?Gly?Asn?Arg?Val?Thr?Arg?Ser?Phe?Gly?Thr?Thr?Phe
445 450 455
gac?atc?cag?ggg?aaa?caa?ttc?ggc?ttc?aaa?tat?gcc?gct?tgc?tga 1440
Asp?Ile?Gln?Gly?Lys?Gln?Phe?Gly?Phe?Lys?Tyr?Ala?Ala?Cys
460 465 470
tcgtcgatta?ttcctcatcc?tatgatatat?cttatagctt?gcgggtcgat?taattagctg 1500
gtttgcccaa?ataactgatc?ggattggagt?cttctcccgc?gctacactac?ccctagctgc 1560
gatcgtatca?caagctagcg?gtacttgatt?tgggacctaa?ttcgttcaaa?aaaaacttgg 1620
cagcttaatt?tgggacctag?tagctagctg?agccactact?agatgtttac?gtaccagcta 1680
tccgtcgttt?gtttgtgtct?cctgtgcttg?tgctaaacct?atctcttgaa?ccgttcgtgc 1740
caacttaatt?atttggtcgt?atgtcctaat?tgttgatc 1778
<210>2
<211>21
<212>PRT
＜213〉paddy rice (Oryza sativa)
<400>2
Arg?Leu?Thr?Ala?Cys?Leu?Pro?Leu?Ser?Lys?Gln?Glu?Arg?Lys?Lys?Glu
1 5 10 15
Gly?Ile?Lys?Phe?Ala
20
<210>3
<211>450
<212>PRT
＜213〉paddy rice (Oryza sativa)
<400>3
Ser?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu?Glu?Cys?Pro?Ser?Ser?Ile
1 5 10 15
Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala?Ile?Gln?Phe?Pro?Val?Phe
20 25 30
His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp?Ser?Val?Arg?Ala?Thr?Gln
35 40 45
Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly?Lys?Gly?Gly?Gly?Leu?Asn
50 55 60
Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser?Ser?Ser?Thr?Lys?Ile?Asp
65 70 75 80
Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe?Leu?Phe?Leu?Met?Ala?Val
85 90 95
Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu?Val?Ala?Ile?Asp?Thr?Gly
100 105 110
Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro?Cys?Ala?Val?His?Cys?His
115 120 125
Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe?Asp?Pro?Gly?Arg?Ser?Tyr
130 135 140
Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val?Lys?Cys?Gly?Glu?Leu?Arg
145 150 155 160
Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys?Met?Glu?Lys?Glu?Asp?Ser
165 170 175
Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly?Trp?Ala?Tyr?Ser?Val?Gly
180 185 190
Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly?Asp?Ser?Phe?Met?Asp?Leu
195 200 205
Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr?Ser?Glu?Phe?Glu?Ala?Gly
210 215 220
Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser?Phe?Phe?Glu?Gln?Leu?Ala
225 230 235 240
Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala?Phe?Ser?Tyr?Cys?Leu?Pro
245 250 255
Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile?Leu?Gly?Arg?Tyr?Asp?Arg
260 265 270
Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu?Phe?Arg?Ser?Ile?Asn?Arg
275 280 285
Pro?Thr?Tvr?Ser?Leu?Thr?Met?Glu?Met?Leu?Ile?Ala?Asn?Gly?Gln?Arg
290 295 300
Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val?Asp?Ser?Gly?Ala?Gln?Arg
305 310 315 320
Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu?Leu?Asp?Lys?Thr?Ile?Thr
325 330 335
Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg?Thr?Ser?Arg?Ala?Arg?Gln
340 345 350
Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His?Asp?Tyr?Ser?Gly?Trp?Asn
355 360 365
Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser?Ala?Leu?Pro?Leu?Leu?Glu
370 375 380
Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala?Leu?Pro?Pro?Arg?Asn?Val
385 390 395 400
Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys?Met?Thr?Phe?Ala?Gln?Asn
405 410 415
Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn?Arg?Val?Thr?Arg?Ser?Phe
420 425 430
Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln?Phe?Gly?Phe?Lys?Tyr?Ala
435 440 445
Ala?Cys
450
<210>4
<211>1912
<212>DNA
＜213〉paddy rice (Oryza sativa)
<220>
<221>gene
<222>(1)..(1912)
<223>
<220>
<221>5’UTR
<222>(1577)..(1912)
<223>
<220>
<221>3’UTR
<222>(1)..(157)
<223>
<220>
<221>CDS
<222>(158)..(1576)
<223>
<400>4
atcaacccat?ttcctttcct?acgtttgact?gcctgcctgc?ccctgagcaa?gcaagaaaga 60
aagaaagaag?ggattaaatt?tgctcgctcc?tacgaatcct?gcccctgagt?aacaatgact 120
gacttttaat?ttgtttgcag?ctagggtggg?gatcgag?atg?gtg?atc?ttg?gag?cag 175
Met?Val?Ile?Leu?Glu?Gln
1 5
cca?cag?ctg?ctc?ctt?ctt?ctt?ctt?ctt?ctt?gta?gca?gct?gca?gct?gca 223
Pro?Gln?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Val?Ala?Ala?Ala?Ala?Ala
10 15 20
acc?ggc?gcc?aca?gca?gcc?gac?gac?gag?ttg?gag?tgt?ccc?tcc?tcc?atc 271
Thr?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu?Glu?Cys?Pro?Ser?Ser?Ile
25 30 35
ttc?gat?cac?gct?gtg?aac?tct?caa?ggc?gcc?att?cag?ttc?ccc?gtg?ttc 319
Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala?Ile?Gln?Phe?Pro?Val?Phe
40 45 50
cac?aag?aag?cac?caa?tgc?ctc?cgc?cca?tgg?tct?gtc?cgt?gca?acc?cag 367
His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp?Ser?Val?Arg?Ala?Thr?Gln
55 60 65 70
gca?tcc?tcg?acc?gga?gca?tca?gga?gca?gga?aaa?gga?gga?gga?ttg?aac 415
Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly?Lys?Gly?Gly?Gly?Leu?Asn
75 80 85
aat?cta?cag?gaa?gag?gag?atc?act?tca?tca?agt?agt?aca?aaa?atc?gac 463
Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser?Ser?Ser?Thr?Lys?Ile?Asp
90 95 100
gtg?atc?gaa?gac?agc?agc?atc?aac?gac?ttc?ctg?ttc?cta?atg?gcc?gtc 511
Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe?Leu?Phe?Leu?Met?Ala?Val
105 110 115
agt?ctg?ggc?aag?cca?ccg?gtt?gtg?aac?ctg?gtg?gcg?atc?gac?acg?gga 559
Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu?Val?Ala?Ile?Asp?Thr?Gly
120 125 130
tcc?acc?ctc?tcg?tgg?gtg?caa?tgc?cag?ccg?tgc?gcg?gtg?cac?tgc?cac 607
Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro?Cys?Ala?Val?His?Cys?His
135 140 145 150
acg?cag?tcc?gcg?aag?gcc?ggc?ccg?ata?ttc?gat?ccc?ggc?aga?tcc?tac 655
Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe?Asp?Pro?Gly?Arg?Ser?Tyr
155 160 165
aca?tcc?cgg?cga?gtt?cgc?tgc?tcg?tcg?gtc?aag?tgc?ggc?gag?ctg?agg 703
Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val?Lys?Cys?Gly?Glu?Leu?Arg
170 175 180
tac?gat?ctg?cgg?ctc?cag?caa?gcc?aat?tgc?atg?gag?aag?gaa?gac?agc 751
Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys?Met?Glu?Lys?Glu?Asp?Ser
185 190 195
tgc?acg?tac?agc?gtc?acg?tac?ggg?aac?ggg?tgg?gcg?tac?agc?gtg?ggc 799
Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly?Trp?Ala?Tyr?Ser?Val?Gly
200 205 210
aag?atg?gtg?aca?gac?acg?ctg?agg?att?ggg?gac?tcg?ttt?atg?gat?ctc 847
Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly?Asp?Ser?Phe?Met?Asp?Leu
215 220 225 230
atg?ttc?ggg?tgc?agc?atg?gat?gtc?aag?tac?agc?gaa?ttc?gag?gcc?ggc 895
Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr?Ser?Glu?Phe?Glu?Ala?Gly
235 240 245
atc?ttt?ggt?ttc?ggc?agc?agc?agc?ttc?tct?ttc?ttc?gag?cag?ctg?gca 943
Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser?Phe?Phe?Glu?Gln?Leu?Ala
250 255 260
ggg?tac?cct?gat?att?ctg?agt?tac?aag?gca?tta?agc?tac?tgc?ttg?ccc 991
Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala?Leu?Ser?Tyr?Cys?Leu?Pro
265 270 275
act?gac?gag?acc?aag?ccc?gga?tac?atg?atc?ctg?gga?aga?tac?gac?cgt 1039
Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile?Leu?Gly?Arg?Tyr?Asp?Arg
280 285 290
gcc?gcc?atg?gat?ggg?ggt?tac?act?cct?ctc?ttc?cgg?tca?atc?aac?agg 1087
Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu?Phe?Arg?Ser?Ile?Asn?Arg
295 300 305 310
cca?acc?tac?tca?ctg?acg?atg?gag?atg?ctt?atc?gcc?aac?ggg?cag?aga 1135
Pro?Thr?Tyr?Ser?Leu?Thr?Met?Glu?Met?Leu?Ile?Ala?Asn?Gly?Gln?Arg
315 320 325
ttg?gtg?aca?tcg?tct?tcg?gag?atg?atc?gtc?gat?tcc?ggg?gcc?cag?agg 1183
Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val?Asp?Ser?Gly?Ala?Gln?Arg
330 335 340
acg?tcc?ctg?tgg?cct?tcc?act?ttt?gct?ctc?ctt?gac?aag?acc?atc?acg 1231
Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu?Leu?Asp?Lys?Thr?Ile?Thr
345 350 355
cag?gca?atg?tcg?tcg?att?ggg?tat?cac?cgg?aca?tca?aga?gcg?cgc?caa 1279
Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg?Thr?Ser?Arg?Ala?Arg?Gln
360 365 370
gaa?tca?tac?atc?tgc?tac?tta?tcg?gag?cac?gac?tat?tct?ggt?tgg?aac 1327
Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His?Asp?Tyr?Ser?Gly?Trp?Asn
375 380 385 390
ggc?acc?atc?acg?ccc?ttc?tcc?aac?tgg?tcc?gcc?ttg?cct?ctg?ctg?gag 1375
Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser?Ala?Leu?Pro?Leu?Leu?Glu
395 400 405
atc?ggc?ttc?gcc?ggc?ggt?gct?gca?ctc?gct?ttg?cca?ccc?aga?aac?gtc 1423
Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala?Leu?Pro?Pro?Arg?Asn?Val
410 415 420
ttc?tac?aac?gat?cca?cac?cgc?ggt?ttg?tgc?atg?acc?ttt?gct?cag?aat 1471
Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys?Met?Thr?Phe?Ala?Gln?Asn
425 430 435
cct?gct?ctc?agg?tct?cag?ata?ctg?ggg?aac?agg?gtt?act?cga?tcc?ttc 1519
Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn?Arg?Val?Thr?Arg?Ser?Phe
440 445 450
gga?aca?acc?ttc?gac?atc?cag?ggg?aaa?caa?ttc?ggc?ttc?aaa?tat?gcc 1567
Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln?Phe?Gly?Phe?Lys?Tyr?Ala
455 460 465 470
gtt?tgc?tga?tcgtcgatta?ttcctcatcc?tatgatatct?tatagcttgc 1616
Val?Cys
gggtcgatta?attagctggt?ttgcccaaat?aactgatcgg?attggagtct?tctcccgcgc 1676
tacactaccc?ctagctgcga?tcgtatcaca?agctagcggt?acttgatttg?ggacctaatt 1736
cgttcaaaaa?aaacttggca?gcttaatttg?ggacctagta?gctagctgag?ccactactag 1796
atgtttacgt?accagctatc?cgtcgtttgt?ttgtgtctcc?tgtgcttgtg?ctaaacctat 1856
ctcttgaacc?gttcgtgcca?acttaattat?ttggtcgtat?gtcctaattg?ttgatc 1912
<210>5
<211>472
<212>PRT
＜213〉paddy rice (Oryza sativa)
<400>5
Met?Val?Ile?Leu?Glu?Gln?Pro?Gln?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Leu
1 5 10 15
Val?Ala?Ala?Ala?Ala?Ala?Thr?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu
20 25 30
Glu?Cys?Pro?Ser?Ser?Ile?Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala
35 40 45
Ile?Gln?Phe?Pro?Val?Phe?His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp
50 55 60
Ser?Val?Arg?Ala?Thr?Gln?Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly
65 70 75 80
Lys?Gly?Gly?Gly?Leu?Asn?Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser
85 90 95
Ser?Ser?Thr?Lys?Ile?Asp?Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe
100 105 110
Leu?Phe?Leu?Met?Ala?Val?Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu
115 120 125
Val?Ala?Ile?Asp?Thr?Gly?Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro
130 135 140
Cys?Ala?Val?His?Cys?His?Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe
145 150 155 160
Asp?Pro?Gly?Arg?Ser?Tyr?Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val
165 170 175
Lys?Cys?Gly?Glu?Leu?Arg?Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys
180 185 190
Met?Glu?Lys?Glu?Asp?Ser?Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly
195 200 205
Trp?Ala?Tyr?Ser?Val?Gly?Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly
210 215 220
Asp?Ser?Phe?Met?Asp?Leu?Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr
225 230 235 240
Ser?Glu?Phe?Glu?Ala?Gly?Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser
245 250 255
Phe?Phe?Glu?Gln?Leu?Ala?Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala
260 265 270
Leu?Ser?Tyr?Cys?Leu?Pro?Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile
275 280 285
Leu?Gly?Arg?Tyr?Asp?Arg?Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu
290 295 300
Phe?Arg?Ser?Ile?Asn?Arg?Pro?Thr?Tyr?Ser?Leu?Thr?Met?Glu?Met?Leu
305 310 315 320
Ile?Ala?Asn?Gly?Gln?Arg?Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val
325 330 335
Asp?Ser?Gly?Ala?Gln?Arg?Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu
340 345 350
Leu?Asp?Lys?Thr?Ile?Thr?Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg
355 360 365
Thr?Ser?Arg?Ala?Arg?Gln?Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His
370 375 380
Asp?Tyr?Ser?Gly?Trp?Asn?Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser
385 390 395 400
Ala?Leu?Pro?Leu?Leu?Glu?Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala
405 410 415
Leu?Pro?Pro?Arg?Asn?Val?Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys
420 425 430
Met?Thr?Phe?Ala?Gln?Asn?Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn
435 440 445
Arg?Val?Thr?Arg?Ser?Phe?Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln
450 455 460
Phe?Gly?Phe?Lys?Tyr?Ala?Val?Cys
465 470
<210>6
<211>1911
<212>DNA
＜213〉paddy rice (Oryza sativa)
<220>
<221>gene
<222>(1)..(1911)
<223>
<220>
<221>5’UTR
<222>(1577)..(1911)
<223>
<220>
<221>3’UTR
<222>(1)..(157)
<223>
<220>
<221>CDS
<222>(158)..(1576)
<223>
<400>6
atcaacccat?ttcctttcct?acgtttgact?gcctgcctgc?ccctgagcaa?gcaagaaaga 60
aagaaagaag?ggattaaatt?tgctcgctcc?tacgaatcct?gcccctgagt?aacaatgact 120
gacttttaat?ttgtttgcag?ctagggtggg?gatcgag?atg?gtg?atc?ttg?gag?cag 175
Met?Val?Ile?Leu?Glu?Gln
1 5
cca?cag?ctg?ctc?ctt?ctt?ctt?ctt?ctt?ctt?gta?gca?gct?gca?gct?gca 223
Pro?Gln?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Val?Ala?Ala?Ala?Ala?Ala
10 15 20
acc?ggc?gcc?aca?gca?gcc?gac?gac?gag?ttg?gag?tgt?ccc?tcc?tcc?atc 271
Thr?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu?Glu?Cys?Pro?Ser?Ser?Ile
25 30 35
ttc?gat?cac?gct?gtg?aac?tct?caa?ggc?gcc?att?cag?ttc?ccc?gtg?ttc 319
Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala?Ile?Gln?Phe?Pro?Val?Phe
40 45 50
cac?aag?aag?cac?caa?tgc?ctc?cgc?cca?tgg?tct?gtc?cgt?gca?acc?cag 367
His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp?Ser?Val?Arg?Ala?Thr?Gln
55 60 65 70
gca?tcc?tcg?acc?gga?gca?tca?gga?gca?gga?aaa?gga?gga?gga?ttg?aac 415
Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly?Lys?Gly?Gly?Gly?Leu?Asn
75 80 85
aat?cta?cag?gaa?gag?gag?atc?act?tca?tca?agt?agt?aca?aaa?atc?gac 463
Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser?Ser?Ser?Thr?Lys?Ile?Asp
90 95 100
gtg?atc?gaa?gac?agc?agc?atc?aac?gac?ttc?ctg?ttc?cta?atg?gcc?gtc 511
Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe?Leu?Phe?Leu?Met?Ala?Val
105 110 115
agt?ctg?ggc?aag?cca?ccg?gtt?gtg?aac?ctg?gtg?gcg?atc?gac?acg?gga 559
Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu?Val?Ala?Ile?Asp?Thr?Gly
120 125 130
tcc?acc?ctc?tcg?tgg?gtg?caa?tgc?cag?ccg?tgc?gcg?gtg?cac?tgc?cac 607
Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro?Cys?Ala?Val?His?Cys?His
135 140 145 150
acg?cag?tcc?gcg?aag?gcc?ggc?ccg?ata?ttc?gat?ccc?ggc?aga?tcc?tac 655
Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe?Asp?Pro?Gly?Arg?Ser?Tyr
155 160 165
aca?tcc?cgg?cga?gtt?cgc?tgc?tcg?tcg?gtc?aag?tgc?ggc?gag?ctg?agg 703
Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val?Lys?Cys?Gly?Glu?Leu?Arg
170 175 180
tac?gat?ctg?cgg?ctc?cag?caa?gcc?aat?tgc?atg?gag?aag?gaa?gac?agc 751
Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys?Met?Glu?Lys?Glu?Asp?Ser
185 190 195
tgc?acg?tac?agc?gtc?acg?tac?ggg?aac?ggg?tgg?gcg?tac?agc?gtg?ggc 799
Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly?Trp?Ala?Tyr?Ser?Val?Gly
200 205 210
aag?atg?gtg?aca?gac?acg?ctg?agg?att?ggg?gac?tcg?ttt?atg?gat?ctc 847
Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly?Asp?Ser?Phe?Met?Asp?Leu
215 220 225 230
atg?ttc?ggg?tgc?agc?atg?gat?gtc?aag?tac?agc?gaa?ttc?gag?gcc?ggc 895
Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr?Ser?Glu?Phe?Glu?Ala?Gly
235 240 245
atc?ttt?ggt?ttc?ggc?agc?agc?agc?ttc?tct?ttc?ttc?gag?cag?ctg?gca 943
Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser?Phe?Phe?Glu?Gln?Leu?Ala
250 255 260
ggg?tac?cct?gat?att?ctg?agt?tac?aag?gca?ttc?agc?tac?tgc?ttg?ccc 991
Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala?Phe?Ser?Tyr?Cys?Leu?Pro
265 270 275
act?gac?gag?acc?aag?ccc?gga?tac?atg?atc?ctg?gga?aga?tac?gac?cgt 1039
Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile?Leu?Gly?Arg?Tyr?Asp?Arg
280 285 290
gcc?gcc?atg?gat?ggg?ggt?tac?act?cct?ctc?ttc?cgg?tca?atc?aac?agg 1087
Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu?Phe?Arg?Ser?Ile?Asn?Arg
295 300 305 310
cca?acc?tac?tca?ctg?acg?atg?gag?atg?ctt?atc?gcc?aac?ggg?cag?aga 1135
Pro?Thr?Tyr?Ser?Leu?Thr?Met?Glu?Met?Leu?Ile?Ala?Asn?Gly?Gln?Arg
315 320 325
ttg?gtg?aca?tcg?tct?tcg?gag?atg?atc?gtc?gat?tcc?ggg?gcc?cag?agg 1183
Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val?Asp?Ser?Gly?Ala?Gln?Arg
330 335 340
acg?tcc?ctg?tgg?cct?tcc?act?ttt?gct?ctc?ctt?gac?aag?acc?atc?acg 1231
Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu?Leu?Asp?Lys?Thr?Ile?Thr
345 350 355
cag?gca?atg?tcg?tcg?att?ggg?tat?cac?cgg?aca?tca?aga?gcg?cgc?caa 1279
Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg?Thr?Ser?Arg?Ala?Arg?Gln
360 365 370
gaa?tca?tac?atc?tgc?tac?tta?tcg?gag?cac?gac?tat?tct?ggt?tgg?aac 1327
Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His?Asp?Tyr?Ser?Gly?Trp?Asn
375 380 385 390
ggc?acc?atc?acg?ccc?ttc?tcc?aac?tgg?tcc?gcc?ttg?cct?ctg?ctg?gag 1375
Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser?Ala?Leu?Pro?Leu?Leu?Glu
395 400 405
atc?ggc?ttc?gcc?ggc?ggt?gct?gca?ctc?gct?ttg?cca?ccc?aga?aac?gtc 1423
Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala?Leu?Pro?Pro?Arg?Asn?Val
410 415 420
ttc?tac?aac?gat?cca?cac?cgc?ggt?ttg?tgc?atg?acc?ttt?gct?cag?aat 1471
Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys?Met?Thr?Phe?Ala?Gln?Asn
425 430 435
cct?gct?ctc?agg?tct?cag?ata?ctg?ggg?aac?agg?gtt?act?cga?tcc?ttc 1519
Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn?Arg?Val?Thr?Arg?Ser?Phe
440 445 450
gga?aca?acc?ttc?gac?atc?cag?ggg?aaa?caa?ttc?ggc?ttc?aaa?tat?gcc 1567
Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln?Phe?Gly?Phe?Lys?Tyr?Ala
455 460 465 470
gct?tgc?tga?tcgtcgatta?ttcctcatcc?tatgatatct?tatagcttgc 1616
Ala?Cys
gggtcgatta?attagctggt?ttgcccaaat?aactgatcgg?attggagtct?tctcccgcgc 1676
tacactaccc?ctagctgcga?tcgtatcaca?agctagcggt?acttgatttg?ggacctaatt 1736
cgttcaaaaa?aacttggcag?cttaatttgg?gacctagtag?ctagctgagc?cactactaga 1796
tgtttacgta?ccagctatcc?gtcgtttgtt?tgtgtctcct?gtgcttgtgc?taaacctatc 1856
tcttgaaccg?ttcgtgccaa?cttaattatt?tggtcgtatg?tcctaattgt?tgatc 1911
<210>7
<211>472
<212>PRT
＜213〉paddy rice (Oryza sativa)
<400>7
Met?Val?Ile?Leu?Glu?Gln?Pro?Gln?Leu?Leu?Leu?Leu?Leu?Leu?Leu?Leu
1 5 10 15
Val?Ala?Ala?Ala?Ala?Ala?Thr?Gly?Ala?Thr?Ala?Ala?Asp?Asp?Glu?Leu
20 25 30
Glu?Cys?Pro?Ser?Ser?Ile?Phe?Asp?His?Ala?Val?Asn?Ser?Gln?Gly?Ala
35 40 45
Ile?Gln?Phe?Pro?Val?Phe?His?Lys?Lys?His?Gln?Cys?Leu?Arg?Pro?Trp
50 55 60
Ser?Val?Arg?Ala?Thr?Gln?Ala?Ser?Ser?Thr?Gly?Ala?Ser?Gly?Ala?Gly
65 70 75 80
Lys?Gly?Gly?Gly?Leu?Asn?Asn?Leu?Gln?Glu?Glu?Glu?Ile?Thr?Ser?Ser
85 90 95
Ser?Ser?Thr?Lys?Ile?Asp?Val?Ile?Glu?Asp?Ser?Ser?Ile?Asn?Asp?Phe
100 105 110
Leu?Phe?Leu?Met?Ala?Val?Ser?Leu?Gly?Lys?Pro?Pro?Val?Val?Asn?Leu
115 120 125
Val?Ala?Ile?Asp?Thr?Gly?Ser?Thr?Leu?Ser?Trp?Val?Gln?Cys?Gln?Pro
130 135 140
Cys?Ala?Val?His?Cys?His?Thr?Gln?Ser?Ala?Lys?Ala?Gly?Pro?Ile?Phe
145 150 155 160
Asp?Pro?Gly?Arg?Ser?Tyr?Thr?Ser?Arg?Arg?Val?Arg?Cys?Ser?Ser?Val
165 170 175
Lys?Cys?Gly?Glu?Leu?Arg?Tyr?Asp?Leu?Arg?Leu?Gln?Gln?Ala?Asn?Cys
180 185 190
Met?Glu?Lys?Glu?Asp?Ser?Cys?Thr?Tyr?Ser?Val?Thr?Tyr?Gly?Asn?Gly
195 200 205
Trp?Ala?Tyr?Ser?Val?Gly?Lys?Met?Val?Thr?Asp?Thr?Leu?Arg?Ile?Gly
210 215 220
Asp?Ser?Phe?Met?Asp?Leu?Met?Phe?Gly?Cys?Ser?Met?Asp?Val?Lys?Tyr
225 230 235 240
Ser?Glu?Phe?Glu?Ala?Gly?Ile?Phe?Gly?Phe?Gly?Ser?Ser?Ser?Phe?Ser
245 250 255
Phe?Phe?Glu?Gln?Leu?Ala?Gly?Tyr?Pro?Asp?Ile?Leu?Ser?Tyr?Lys?Ala
260 265 270
Phe?Ser?Tyr?Cys?Leu?Pro?Thr?Asp?Glu?Thr?Lys?Pro?Gly?Tyr?Met?Ile
275 280 285
Leu?Gly?Arg?Tyr?Asp?Arg?Ala?Ala?Met?Asp?Gly?Gly?Tyr?Thr?Pro?Leu
290 295 300
Phe?Arg?Ser?Ile?Asn?Arg?Pro?Thr?Tyr?Ser?Leu?Thr?Met?Glu?Met?Leu
305 310 315 320
Ile?Ala?Asn?Gly?Gln?Arg?Leu?Val?Thr?Ser?Ser?Ser?Glu?Met?Ile?Val
325 330 335
Asp?Ser?Gly?Ala?Gln?Arg?Thr?Ser?Leu?Trp?Pro?Ser?Thr?Phe?Ala?Leu
340 345 350
Leu?Asp?Lys?Thr?Ile?Thr?Gln?Ala?Met?Ser?Ser?Ile?Gly?Tyr?His?Arg
355 360 365
Thr?Ser?Arg?Ala?Arg?Gln?Glu?Ser?Tyr?Ile?Cys?Tyr?Leu?Ser?Glu?His
370 375 380
Asp?Tyr?Ser?Gly?Trp?Asn?Gly?Thr?Ile?Thr?Pro?Phe?Ser?Asn?Trp?Ser
385 390 395 400
Ala?Leu?Pro?Leu?Leu?Glu?Ile?Gly?Phe?Ala?Gly?Gly?Ala?Ala?Leu?Ala
405 410 415
Leu?Pro?Pro?Arg?Asn?Val?Phe?Tyr?Asn?Asp?Pro?His?Arg?Gly?Leu?Cys
420 425 430
Met?Thr?Phe?Ala?Gln?Asn?Pro?Ala?Leu?Arg?Ser?Gln?Ile?Leu?Gly?Asn
435 440 445
Arg?Val?Thr?Arg?Ser?Phe?Gly?Thr?Thr?Phe?Asp?Ile?Gln?Gly?Lys?Gln
450 455 460
Phe?Gly?Phe?Lys?Tyr?Ala?Ala?Cys
465 470

Claims (3)

1. the Japonica rice hybrid fertility gene S 5-j of separating clone, its nucleotide sequence is shown in 1-1912 position among the sequence table SEQ ID NO:4.
2. the described gene of claim 1, its amino acid sequence coded is shown in sequence table SEQ ID NO:5.
3. claim 1 or the 2 described genes application in paddy rice cross breeding breeding and improvement.
CN2009101488666A 2007-10-15 2007-10-15 Separation clone of rice japonica type hybrid fertility gene S5-j and application thereof Expired - Fee Related CN101649322B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2009101488666A CN101649322B (en) 2007-10-15 2007-10-15 Separation clone of rice japonica type hybrid fertility gene S5-j and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2009101488666A CN101649322B (en) 2007-10-15 2007-10-15 Separation clone of rice japonica type hybrid fertility gene S5-j and application thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN2007100535529A Division CN101200725B (en) 2007-10-15 2007-10-15 Separating clone of rice wide compatibility gene S5 and uses thereof

Publications (2)

Publication Number Publication Date
CN101649322A CN101649322A (en) 2010-02-17
CN101649322B true CN101649322B (en) 2011-11-16

Family

ID=41671648

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2009101488666A Expired - Fee Related CN101649322B (en) 2007-10-15 2007-10-15 Separation clone of rice japonica type hybrid fertility gene S5-j and application thereof

Country Status (1)

Country Link
CN (1) CN101649322B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103421827B (en) * 2012-06-11 2015-02-11 华中农业大学 Paddy rice hybrid embryo sac fertility gene and use thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
吕川根等.两系法亚种间杂交稻育种的若干思考.《中国农业科学导报》.2007, *

Also Published As

Publication number Publication date
CN101649322A (en) 2010-02-17

Similar Documents

Publication Publication Date Title
CN100554424C (en) A kind of control rice grain output, clone and the application of the pleiotropic gene Ghd7 of heading stage and plant height
JP4864710B2 (en) Method for enhancing stress tolerance in plants and method
CN111902547B (en) Methods for identifying, selecting and producing disease-resistant crops
CN101880671B (en) Cloning and application of major gene GS5 capable of controlling width and weight of rice grain
CN107245480B (en) Acetolactate synthase mutant protein with herbicide resistance and application thereof
CN101200725B (en) Separating clone of rice wide compatibility gene S5 and uses thereof
CN102634522B (en) Gene for controlling rice fertility, encoded protein and application thereof
AU2016371385B2 (en) Compositions and methods for manipulating the development of plants
CN109112140A (en) Application of the OsSN28 gene in control rice high temperature resistant
CN103421802B (en) Pleiotropic gene GDS7 for controlling weight and length of paddy rice grain and spikelet number of each panicle
CN101037696B (en) Paddy cool injury gene and application
CN103421820B (en) Control clone and the application thereof of rice panicle type gene PM1 for one
CN108794607A (en) A kind of yield gene OsAFB6 and the application in adjusting and controlling rice florescence and grains per panicle
CN101892246B (en) Clone and application of pleiotropic gene Ghd8 for controlling yield, florescence and plant height of rice grain
CN101649322B (en) Separation clone of rice japonica type hybrid fertility gene S5-j and application thereof
CN101684469B (en) Isolating, cloning and application of rice indica hybrid fertile gene S5-i
CN100445383C (en) Rice starter expressed by induction of chilo simplex eating speciality and its use
CN100451121C (en) Gene for controlling rice ear sprouting period and its uses
JP2023017954A (en) Brassica event mon94100 and methods of use thereof
CN109112137A (en) A kind of gene SNG1 and its application of control rice grain size and grain weight
US11516980B2 (en) Genetic basis for Pythium resistance
WO2021061830A1 (en) Herbicide resistant plants and methods of making and using
US11795469B2 (en) Scaevola plants with radially symmetrical flowers
CN104830871B (en) A kind of paddy gene OsAP2 6 and preparation method and application
CN116121266B (en) Application of rice gene qSS7 in drought resistance

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20111116