CN111004794A - Subtilisin E mutant with improved thermal stability and application thereof - Google Patents
Subtilisin E mutant with improved thermal stability and application thereof Download PDFInfo
- Publication number
- CN111004794A CN111004794A CN201911403670.7A CN201911403670A CN111004794A CN 111004794 A CN111004794 A CN 111004794A CN 201911403670 A CN201911403670 A CN 201911403670A CN 111004794 A CN111004794 A CN 111004794A
- Authority
- CN
- China
- Prior art keywords
- ala
- ser
- gly
- subtilisin
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Abstract
The invention discloses a subtilisin E mutant with improved thermal stability, belonging to the technical field of biological engineering. The invention mutates the subtilisin E with amino acid as shown in SEQ ID NO.1, mutates the encoded loop sequence SSGSS at position 158 and 162 to aspartic acid N, transfers the recombinant plasmid containing mutant gene into escherichia coli BL21(DE3) for expression, and obtains the subtilisin E mutant M21 with improved thermal stability. The half-life of mutant M21 at 55 ℃ was extended by 21.55min compared to the wild type.
Description
Technical Field
The invention relates to a subtilisin E mutant with improved thermal stability and application thereof, belonging to the technical field of biological engineering.
Background
Subtilisin E (subtilisin E), called subtilisin E for short, is an alkaline serine protease produced by microorganisms and capable of degrading protein substrates. Subtilisin E is a protease with broad substrate specificity, strong hydrolysis catalytic ability, and alkaline pH preference, and has wide applications in detergent, leather, and food industries. In particular in the dairy industry, they have great potential in the production of bioactive hydrolysates. With the development of industrialization, the performance and the yield of the subtilisin E produced by wild bacteria can not meet the market demand.
Most of wild bacteria for producing the subtilisin E obtained by screening at present are concentrated in the bacillus subtilis, and the wild bacteria have the defects of multiple extracellular secreted enzymes, poor substrate action specificity, unstable enzyme production and no contribution to industrial production. The gene engineering bacteria are adopted to strengthen gene transcription and translation, so that high-efficiency expression and active secretion are achieved, and the production strength of the subtilisin E can be effectively improved. The recombinant subtilisin E is generally subjected to performance modification, the extracellular enzyme activity is single, and the purification work of the downstream fermentation is simplified. In addition, the industrial application has strict requirements on the enzyme, such as high temperature environment which can greatly influence the activity of the subtilisin E. In order to reduce the production cost, the repeated utilization of the subtilisin E must be realized, and in addition, the fine chemical catalysis of the subtilisin E with high catalytic activity and strong substrate specificity is required. The screening and separation of subtilisin E from nature is far from meeting the industrial demand, so that the search for novel subtilisin E through molecular modification technology is a new research direction.
The present inventors previously expressed subtilisin E (SES7) derived from Bacillus subtilis S7 in a heterologous manner (patent publication No.: CN109837219A), and obtained subtilisin E with high solubility expression. However, in the intracellular expression of E.coli, the extracellular thermostability is poor. In order to further improve the performance properties of the enzyme, it is necessary to further improve the thermostability of subtilisin E.
Disclosure of Invention
The first purpose of the invention is to provide a subtilisin E mutant, which contains the amino acid sequence shown in SEQ ID NO. 3.
The amino acid sequence of the subtilisin E mutant is based on the amino acid sequence shown in SEQ ID NO.1, and based on the amino acid sequence shown in SEQ ID NO.1, the encoded loop sequence SSGSS at the 158 th and 162 th positions is mutated into aspartic acid N, and the obtained subtilisin E mutant is named as M21.
It is a second object of the present invention to provide a gene encoding the above subtilisin E mutant.
In one embodiment of the present invention, the nucleotide sequence of the gene encoding the above subtilisin E mutant is the sequence shown in SEQ ID NO. 11.
The third purpose of the invention is to provide a recombinant plasmid containing the gene.
In one embodiment of the present invention, the recombinant plasmid is constructed on the basis of any one of pET series plasmids, pGEX series plasmids, pPICZ series plasmids, pAN series plasmids, or pUB series plasmids.
The fourth purpose of the invention is to provide a genetically engineered bacterium for expressing the subtilisin E mutant.
In one embodiment of the present invention, the genetically engineered bacterium is a bacterium, yeast, or other fungus.
In one embodiment of the invention, the genetically engineered bacterium is e.coli BL21(DE3) as a host.
The fifth objective of the present invention is to provide a method for enhancing the thermal stability of subtilisin E, which comprises mutating the encoded loop sequence SSGSS at position 158-162 to aspartic acid N based on the amino acid sequence shown in SEQ ID NO. 1.
The sixth purpose of the invention is to provide a method for producing the subtilisin E, which is to culture the genetic engineering bacteria and induce to obtain the subtilisin E protein.
In one embodiment of the invention, the culture is to inoculate the monoclonal of the genetically engineered bacteria into LB culture medium, and culture for 8-14h at 35-39 ℃ to obtain seed liquid; inoculating the seed liquid to LB liquid culture medium according to the inoculation amount of 1-10%, culturing at 35-39 deg.C and 200-220rpm to OD6000.9-1.1, isopropyl- β -D-thiogalactopyranoside (IPTG) was added to the medium at a final concentration of 0.1-1.0mM, and induction-cultured at 15-17 ℃ for 12-16 h.
In one embodiment of the invention, the LB medium contains peptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L, pH 7.2.
The seventh purpose of the invention is to provide the application of the subtilisin E mutant in the fields of detergent, leather, dairy products or food.
The invention has the beneficial effects that:
the present invention provides subtilisin E mutant M21. The kcat/Km of the mutant M21 is the same as that of the wild-type subtilisin E and is 0.034min-1μM-1The half-life of mutant M21 at 55 ℃ was 73.3min, which was 21.55min greater than the wild-type 53.75 min. The subtilisin E mutant M21 of the present invention has more application value and potential than wild type subtilisin E.
Drawings
FIG. 1: a schematic representation of the construction of the M21/pET-24a (+) plasmid.
FIG. 2: SDS-PAGE gel electrophoresis of E.coli lysates from subtilisin E and mutant M21, wherein M represents the protein molecular weight standard, the different lane names represent the different muteins, and the arrows indicate the positions of the target protein bands.
FIG. 3: Lineweaver-Burk curve of subtilisin E and its mutant M21, a: SES 7; b: m21.
FIG. 4: residual (relative) enzyme activity and half-life assay at 55 ℃ for subtilisin E and mutant M21, a: SES 7; b: m21.
Detailed Description
Enzyme activity determination method
The activity of the subtilisin E enzyme is determined by a p-nitrophenol short peptide analogue (Suc-AAPF-pNA) color development method. The subtilisin E hydrolyzes the p-nitrophenol short peptide analogue to release p-nitrophenol under a certain condition, and generates a color reaction, the color depth of the subtilisin E can be in direct proportion to the release amount of the p-nitrophenol within a certain range, so that the color comparison can be carried out at the wavelength of 405nm, and the enzyme activity can be calculated.
Definition of enzyme activity unit: under the above conditions, the amount of enzyme per ml which catalyzes the decomposition of the short peptide analog paranitrophenol per minute was defined as one enzyme activity unit, with the unreacted sample as a blank.
(II) an enzymatic kinetic constant determination step:
A. and (3) carrying out enzymolysis reaction: mu.L of purified subtilisin E (0.02 mg/mL) and 900. mu.L of Tris-HCl buffer (50mM, pH9.0) containing Suc-AAPF-pNA at substrate concentration steps of 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5mg/mL were mixed well, reacted at 37 ℃ for 30 minutes, then 10. mu.L of 10mM PMSF was added rapidly to terminate the reaction, and the absorbance at 405nm was measured.
B. Calculation of enzymatic kinetic constants: calculated from the absorbance values, under these conditions only a small fraction (< 10%) of the substrate is converted to the product by subtilisin E, so kinetic constants can be calculated by linear regression using the Lineweaver-Burk plot.
(III) adopting an AKTA avant protein purifier to purify the recombinant protein
The subtilisin E and the mutant thereof both contain histidine tags, so the subtilisin E can be separated and purified by a nickel ion affinity chromatography purification column, and the specific steps are as follows:
(1) balancing: equilibrating the purification column with 5 volumes of 50mmol/L, pH 7.2, Tris-HCl buffer;
(2) loading: loading the pretreated sample at a flow rate of 0.5mL/min, wherein the loading volume is generally not more than 5 times of the column volume;
(3) and (3) elution: comprises eluting unadsorbed substances, heteroproteins and target proteins at the flow rate of 1.0mL/min, carrying out gradient elution on 50mmol/L eluent containing 300mM imidazole, pH 7.2 and Tris-HCl buffer solution, wherein the detection wavelength is 280nm, and collecting the eluent containing the enzymatic activity of subtilisin E in batches.
Example 1: construction of subtilisin E mutants
The mutants M20, M21 and M22 are constructed by taking subtilisin E (SES7) derived from Bacillus subtilis S7 as a parent enzyme. The subtilisin E is derived from Bacillus subtilis S7, and the amino acid sequence is shown in SEQ ID NO. 1. After the ArchDB database is analyzed, the fact that GN and N are used as loop turn sequences in a large number of structures is found, so that the invention mutates a loop sequence SSGSS at the 158-162 th site into aspartic acid GN on the basis of an amino acid sequence shown as SEQ ID NO.1 to obtain a mutant M20; on the basis of the amino acid sequence shown in SEQ ID NO.1, the loop sequence SSGSS at the 158-162 th site is mutated into N to obtain a mutant M21; on the basis of the amino acid sequence shown in SEQ ID NO.1, the invention deletes the loop sequence SSGSSS at position 158 and 162 to obtain a mutant M22.
Construction of subtilisin E mutants M20, M21 and M22: designing PCR primers (Table 1), carrying out enzyme digestion and connection on a gene coding the subtilisin E and pET-24a (+) to obtain a plasmid SES7/pET-24a (+), carrying out amplification by using the PCR primers by using the plasmid SES7/pET-24a (+) as a template to obtain mutant plasmids M20/pET-24a (+), M21/pET-24a (+) (see a figure 1) and M22/pET-24a (+), and carrying out nucleic acid electrophoresis and gel recovery.
PCR condition steps: firstly, pre-denaturation is carried out for 5min at 95 ℃; then 25 cycles were entered: denaturation at 98 deg.C for 10s, annealing at 55 deg.C for 10s, and extension at 72 deg.C for 8 min; finally, extension is carried out for 10min at 72 ℃, and heat preservation is carried out at 4 ℃.
Recovering the gene, digesting a template chain for 2 hours at 37 ℃ by adopting DpnI, carrying out room temperature ligation on T4 DNA ligase and T4 phosphokinase overnight (8-14 hours), and finally transferring into competent Escherichia coli E.coli BL21(DE3) for expression to obtain recombinant Escherichia coli.
TABLE 1 primer sequences for subtilisin E mutants
| Primer and method for producing the same | Sequence (5'-3') | Sequence numbering |
| F-M20 | GAAACGAAGGTGGCAATAGCACAGTCGGCTACCCTGC | SEQ ID NO.5 |
| R-M20 | GCAGGGTAGCCGACTGTGCTATTGCCACCTTCGTTTC | SEQ ID NO.6 |
| F-M21 | GAAACGAAGGTAATAGCACAGTCGGCTACCCTGC | SEQ ID NO.7 |
| R-M21 | GCAGGGTAGCCGACTGTGCTATTACCTTCGTTTC | SEQ ID NO.8 |
| F-M22 | GAAACGAAGGTAGCACAGTCGGCTACCCTGC | SEQ ID NO.9 |
| R-M22 | GCAGGGTAGCCGACTGTGCTACCTTCGTTTC | SEQ ID NO.10 |
Example 2: expression and purification of subtilisin E mutants
Selecting the recombinant Escherichia coli positive monoclonal obtained in example 1, and growing in LB liquid culture medium (containing 50. mu.g/mL ampicillin) overnight (8-14h) to obtain seed fermentation liquid; inoculating the seed fermentation broth into LB liquid medium (containing 50. mu.g/mL ampicillin) at an inoculum size of 10%, and shake-culturing at 37 deg.C for 2.5h to OD600About 1.0; adding IPTG at a final concentration of 0.05mM to induce the cells to express subtilisin E extracellularly, and continuing the fermentation at 18 ℃ overnight (8-14h) with shaking; the fermentation broth was centrifuged at 6000rpm for 1 hour at 4 ℃ to collect the cells, after disruption, the disrupted supernatant was collected and analyzed by SDS-PAGE, and the molecular weights of M21 and M6 were about 28kDa (FIG. 2). And purifying the recombinant protein by adopting an AKTA avant protein purifier.
Example 3: enzyme activity analysis method
Kinetic constants were calculated by linear regression using the Lineweaver-Burk plot, and the results are shown in fig. 3.
The results of the determination of the enzymatic kinetic parameters of subtilisin E and mutant M21 in the heterologous expression in E.coli are shown in Table 2.
TABLE 2 determination of the enzymatic kinetic parameters of subtilisin E and mutant M21
Example 4: thermostability of subtilisin E mutants
The purified subtilisin E and mutants M20, M21 and M22 were diluted with 50mM Tris-HCl buffer respectively to a protein content of 0.02mg/mL and a pH of 9.0, placed in a thermostatic water bath at 55 ℃, sampled every 15min, tested for residual enzyme activity and compared for stability, as shown in FIG. 4. The half-lives were observed using wild-type subtilisin E and mutant M21 as comparison subjects. The half-life of the wild-type subtilisin E (SES7) in the invention is 53.75min, the half-life of the mutant M20 is 0.15min, the half-life of the mutant M21 is 73.3min, and the half-life of the mutant M20 is 4.67 min.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> subtilisin E mutant with improved thermal stability and application thereof
<160>11
<170>PatentIn version 3.3
<210>1
<211>381
<212>PRT
<213>Bacillus subtilis
<400>1
Met Arg Ser Lys Lys Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu
1 5 10 15
Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala Ala Gly Lys
20 25 30
Ser Ser Thr Glu Lys Lys Tyr Ile Val Gly Phe Lys Gln Thr Met Ser
35 40 45
Ala Met Ser Ser Ala Lys Lys Lys Asp Val Ile Ser Glu Lys Gly Gly
50 55 60
Lys Val Gln Lys Gln Phe Lys Tyr Val Asn Ala Ala Ala Ala Thr Leu
65 70 75 80
Asp Glu Lys Ala Val Lys Glu Leu Lys Lys Asp Pro Ser Val Ala Tyr
85 90 95
Val Glu Glu Asp His Ile Ala His Glu Tyr Ala Gln Ser Val Pro Tyr
100 105 110
Gly Ile Ser Gln Ile Lys Ala Pro Ala Leu His Ser Gln Gly Tyr Thr
115 120 125
Gly Ser Asn Val Lys Val Ala Val Ile Asp Ser Gly Ile Asp Ser Ser
130 135 140
His Pro Asp Leu Asn Val Arg Gly Gly Ala Ser Phe Val Pro Ser Glu
145 150 155 160
Thr Asn Pro Tyr Gln Asp Gly Ser Ser His Gly Thr His Val Ala Gly
165 170 175
Thr Ile Ala Ala Leu Asn Asn Ser Ile Gly Val Leu Gly Val Ala Pro
180 185 190
Ser Ala Ser Leu Tyr Ala Val Lys Val Leu Asp Ser Thr Gly Ser Gly
195 200 205
Gln Tyr Ser Trp Ile Ile Asn Gly Ile Glu Trp Ala Ile Ser Asn Asn
210 215 220
Met Asp Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala
225 230 235 240
Leu Lys Thr Val Val Asp Lys Ala Val Ser Ser Gly Ile Val Val Ala
245 250 255
Ala Ala Ala Gly Asn Glu Gly Ser Ser Gly Ser Ser Ser Thr Val Gly
260 265 270
Tyr Pro Ala Lys Tyr Pro Ser Thr Ile Ala Val Gly Ala Val Asn Ser
275 280 285
Ser Asn Gln Arg Ala Ser Phe Ser Ser Ala Gly Ser Glu Leu Asp Val
290 295 300
Met Ala Pro Gly Val Ser Ile Gln Ser Thr Leu Pro Gly Gly Thr Tyr
305 310 315 320
Gly Ala Tyr Asn Gly Thr Ser Met Ala Thr Pro His Val Ala Gly Ala
325 330 335
Ala Ala Leu Ile Leu Ser Lys His Pro Thr Trp Thr Asn Ala Gln Val
340 345 350
Arg Asp Arg Leu Glu Ser Thr Ala Thr Tyr Leu Gly Asn Ser Phe Tyr
355 360 365
Tyr Gly Lys Gly Leu Ile Asn Val Gln Ala Ala Ala Gln
370 375 380
<210>2
<211>378
<212>PRT
<213> Artificial sequence
<400>2
Met Arg Ser Lys Lys Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu
1 5 10 15
Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala Ala Gly Lys
20 25 30
Ser Ser Thr Glu Lys Lys Tyr Ile Val Gly Phe Lys Gln Thr Met Ser
35 40 45
Ala Met Ser Ser Ala Lys Lys Lys Asp Val Ile Ser Glu Lys Gly Gly
5055 60
Lys Val Gln Lys Gln Phe Lys Tyr Val Asn Ala Ala Ala Ala Thr Leu
65 70 75 80
Asp Glu Lys Ala Val Lys Glu Leu Lys Lys Asp Pro Ser Val Ala Tyr
85 90 95
Val Glu Glu Asp His Ile Ala His Glu Tyr Ala Gln Ser Val Pro Tyr
100 105 110
Gly Ile Ser Gln Ile Lys Ala Pro Ala Leu His Ser Gln Gly Tyr Thr
115 120 125
Gly Ser Asn Val Lys Val Ala Val Ile Asp Ser Gly Ile Asp Ser Ser
130 135 140
His Pro Asp Leu Asn Val Arg Gly Gly Ala Ser Phe Val Pro Ser Glu
145 150 155 160
Thr Asn Pro Tyr Gln Asp Gly Ser Ser His Gly Thr His Val Ala Gly
165 170 175
Thr Ile Ala Ala Leu Asn Asn Ser Ile Gly Val Leu Gly Val Ala Pro
180 185 190
Ser Ala Ser Leu Tyr Ala Val Lys Val Leu Asp Ser Thr Gly Ser Gly
195 200 205
Gln Tyr Ser Trp Ile Ile Asn Gly Ile Glu Trp Ala Ile Ser Asn Asn
210 215 220
Met Asp Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala
225 230 235 240
Leu Lys Thr Val Val Asp Lys Ala Val Ser Ser Gly Ile Val Val Ala
245 250 255
Ala Ala Ala Gly Asn Glu Gly Gly Asn Ser Thr Val Gly Tyr Pro Ala
260 265 270
Lys Tyr Pro Ser Thr Ile Ala Val Gly Ala Val Asn Ser Ser Asn Gln
275 280 285
Arg Ala Ser Phe Ser Ser Ala Gly Ser Glu Leu Asp Val Met Ala Pro
290 295 300
Gly Val Ser Ile Gln Ser Thr Leu Pro Gly Gly Thr Tyr Gly Ala Tyr
305 310 315 320
Asn Gly Thr Ser Met Ala Thr Pro His Val Ala Gly Ala Ala Ala Leu
325 330 335
Ile Leu Ser Lys His Pro Thr Trp Thr Asn Ala Gln Val Arg Asp Arg
340 345 350
Leu Glu Ser Thr Ala Thr Tyr Leu Gly Asn Ser Phe Tyr Tyr Gly Lys
355 360 365
Gly Leu Ile Asn Val Gln Ala Ala Ala Gln
370 375
<210>3
<211>377
<212>PRT
<213> Artificial sequence
<400>3
Met Arg Ser Lys Lys Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu
1 5 10 15
Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala Ala Gly Lys
20 25 30
Ser Ser Thr Glu Lys Lys Tyr Ile Val Gly Phe Lys Gln Thr Met Ser
35 40 45
Ala Met Ser Ser Ala Lys Lys Lys Asp Val Ile Ser Glu Lys Gly Gly
50 55 60
Lys Val Gln Lys Gln Phe Lys Tyr Val Asn Ala Ala Ala Ala Thr Leu
65 70 75 80
Asp Glu Lys Ala Val Lys Glu Leu Lys Lys Asp Pro Ser Val Ala Tyr
85 90 95
Val Glu Glu Asp His Ile Ala His Glu Tyr Ala Gln Ser Val Pro Tyr
100 105 110
Gly Ile Ser Gln Ile Lys Ala Pro Ala Leu His Ser Gln Gly Tyr Thr
115 120 125
Gly Ser Asn Val Lys Val Ala Val Ile Asp Ser Gly Ile Asp Ser Ser
130135 140
His Pro Asp Leu Asn Val Arg Gly Gly Ala Ser Phe Val Pro Ser Glu
145 150 155 160
Thr Asn Pro Tyr Gln Asp Gly Ser Ser His Gly Thr His Val Ala Gly
165 170 175
Thr Ile Ala Ala Leu Asn Asn Ser Ile Gly Val Leu Gly Val Ala Pro
180 185 190
Ser Ala Ser Leu Tyr Ala Val Lys Val Leu Asp Ser Thr Gly Ser Gly
195 200 205
Gln Tyr Ser Trp Ile Ile Asn Gly Ile Glu Trp Ala Ile Ser Asn Asn
210 215 220
Met Asp Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala
225 230 235 240
Leu Lys Thr Val Val Asp Lys Ala Val Ser Ser Gly Ile Val Val Ala
245 250 255
Ala Ala Ala Gly Asn Glu Gly Asn Ser Thr Val Gly Tyr Pro Ala Lys
260 265 270
Tyr Pro Ser Thr Ile Ala Val Gly Ala Val Asn Ser Ser Asn Gln Arg
275 280 285
Ala Ser Phe Ser Ser Ala Gly Ser Glu Leu Asp Val Met Ala Pro Gly
290295 300
Val Ser Ile Gln Ser Thr Leu Pro Gly Gly Thr Tyr Gly Ala Tyr Asn
305 310 315 320
Gly Thr Ser Met Ala Thr Pro His Val Ala Gly Ala Ala Ala Leu Ile
325 330 335
Leu Ser Lys His Pro Thr Trp Thr Asn Ala Gln Val Arg Asp Arg Leu
340 345 350
Glu Ser Thr Ala Thr Tyr Leu Gly Asn Ser Phe Tyr Tyr Gly Lys Gly
355 360 365
Leu Ile Asn Val Gln Ala Ala Ala Gln
370 375
<210>4
<211>376
<212>PRT
<213> Artificial sequence
<400>4
Met Arg Ser Lys Lys Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu
1 5 10 15
Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala Ala Gly Lys
20 25 30
Ser Ser Thr Glu Lys Lys Tyr Ile Val Gly Phe Lys Gln Thr Met Ser
35 40 45
Ala Met Ser Ser Ala Lys Lys Lys Asp Val Ile Ser Glu Lys Gly Gly
50 55 60
Lys Val Gln Lys Gln Phe Lys Tyr Val Asn Ala Ala Ala Ala Thr Leu
65 70 75 80
Asp Glu Lys Ala Val Lys Glu Leu Lys Lys Asp Pro Ser Val Ala Tyr
85 90 95
Val Glu Glu Asp His Ile Ala His Glu Tyr Ala Gln Ser Val Pro Tyr
100 105 110
Gly Ile Ser Gln Ile Lys Ala Pro Ala Leu His Ser Gln Gly Tyr Thr
115 120 125
Gly Ser Asn Val Lys Val Ala Val Ile Asp Ser Gly Ile Asp Ser Ser
130 135 140
His Pro Asp Leu Asn Val Arg Gly Gly Ala Ser Phe Val Pro Ser Glu
145 150 155 160
Thr Asn Pro Tyr Gln Asp Gly Ser Ser His Gly Thr His Val Ala Gly
165 170 175
Thr Ile Ala Ala Leu Asn Asn Ser Ile Gly Val Leu Gly Val Ala Pro
180 185 190
Ser Ala Ser Leu Tyr Ala Val Lys Val Leu Asp Ser Thr Gly Ser Gly
195 200 205
Gln Tyr Ser Trp Ile Ile Asn Gly Ile Glu Trp Ala Ile Ser Asn Asn
210 215 220
Met Asp Val Ile Asn Met Ser Leu Gly Gly Pro Ser Gly Ser Thr Ala
225 230 235 240
Leu Lys Thr Val Val Asp Lys Ala Val Ser Ser Gly Ile Val Val Ala
245 250 255
Ala Ala Ala Gly Asn Glu Gly Ser Thr Val Gly Tyr Pro Ala Lys Tyr
260 265 270
Pro Ser Thr Ile Ala Val Gly Ala Val Asn Ser Ser Asn Gln Arg Ala
275 280 285
Ser Phe Ser Ser Ala Gly Ser Glu Leu Asp Val Met Ala Pro Gly Val
290 295 300
Ser Ile Gln Ser Thr Leu Pro Gly Gly Thr Tyr Gly Ala Tyr Asn Gly
305 310 315 320
Thr Ser Met Ala Thr Pro His Val Ala Gly Ala Ala Ala Leu Ile Leu
325 330 335
Ser Lys His Pro Thr Trp Thr Asn Ala Gln Val Arg Asp Arg Leu Glu
340 345 350
Ser Thr Ala Thr Tyr Leu Gly Asn Ser Phe Tyr Tyr Gly Lys Gly Leu
355 360 365
Ile Asn Val Gln Ala Ala Ala Gln
370 375
<210>5
<211>37
<212>DNA
<213> Artificial sequence
<400>5
gaaacgaagg tggcaatagc acagtcggct accctgc 37
<210>6
<211>37
<212>DNA
<213> Artificial sequence
<400>6
gcagggtagc cgactgtgct attgccacct tcgtttc 37
<210>7
<211>34
<212>DNA
<213> Artificial sequence
<400>7
gaaacgaagg taatagcaca gtcggctacc ctgc 34
<210>8
<211>34
<212>DNA
<213> Artificial sequence
<400>8
gcagggtagc cgactgtgct attaccttcg tttc 34
<210>9
<211>31
<212>DNA
<213> Artificial sequence
<400>9
gaaacgaagg tagcacagtc ggctaccctg c 31
<210>10
<211>31
<212>DNA
<213> Artificial sequence
<400>10
gcagggtagc cgactgtgct accttcgttt c 31
<210>11
<211>1099
<212>DNA
<213> Artificial sequence
<400>11
atggccggaa aaagcagtac agaaaagaaa tacattgtcg gatttaagca gacaatgagt 60
gccatgagtt ccgccaagaa aaaggatgtt atttctgaaa aaggcggaaa ggttcaaaag 120
caatttaagt atgttaacgc ggccgcagca acattggatg aaaaagctgt aaaagaattg 180
aaaaaagatc cgagcgttgc atatgtggaa gaagatcata ttgcacatga atatgcgcaa 240
tctgttcctt atggcatttc tcaaattaaa gcgccggctc ttcactctca aggctacaca 300
ggctctaacg taaaagtagc tgttatcgac agcggaattg actcttctca tcctgactta 360
aacgtcagag gcggagcaag cttcgtacct tctgaaacaa acccatacca ggacggcagt 420
tctcacggta cgcatgtagc cggtacgatt gccgctctta ataactcaat cggtgttctg 480
ggcgtagcgc caagcgcatc attatatgca gtaaaagtgc ttgattcaac aggaagcggc 540
caatatagct ggattattaa cggcattgaa tgggccattt ccaacaatat ggatgttatt 600
aacatgagcc tcggcggacc ttctggttct acagcgctga aaacagtcgt tgataaagcc 660
gtttccagcg gtatcgtcgt tgctgccgct gcaggaaacg aaggtaatag cacagtcggc 720
taccctgcaa aatatccttc tactattgcg gtaggtgcgg taaacagcag caaccaaaga 780
gcttcattct caagcgcagg ttctgagctt gatgtgatgg ctcctggcgt atccatccaa 840
agcacacttc ctggaggcac ttacggtgct tacaacggca cgtccatggc gactcctcac 900
gttgccggag cagcagcgct aattctttct aagcatccga cttggactaa cgcacaagtc 960
cgtgatcgtt tagaaagcac tgcaacatat cttggaaact ctttctacta tggaaaaggg 1020
ttaatcaacg tacaagcagc tgcacaatca ctcgagcacc accaccacca ccactgagat 1080
ccggctgcta acaaagccc 1099
Claims (10)
1. A subtilisin E mutant characterized by comprising the amino acid sequence shown in SEQ ID NO. 3.
2. A gene encoding the subtilisin E mutant of claim 1.
3. A recombinant plasmid containing the gene of claim 2.
4. The recombinant plasmid according to claim 3, wherein the recombinant plasmid is constructed on the basis of any one of pET series plasmids, pGEX series plasmids, pPICZ series plasmids, pAN series plasmids, or pUB series plasmids.
5. A genetically engineered bacterium that expresses the subtilisin E mutant of claim 1.
6. The genetically engineered bacterium of claim 5, wherein the genetically engineered bacterium is a bacterium, yeast, or other fungus.
7. A method for enhancing the thermal stability of subtilisin E is characterized in that, based on the amino acid sequence shown in SEQ ID NO.1, the SSGSS of the loop sequence at position 158-162 is mutated into aspartic acid N.
8. A method for producing subtilisin E, which comprises culturing the genetically engineered bacteria of claim 5 or 6, and inducing to obtain subtilisin E protein.
9. The method as claimed in claim 8, wherein the culturing is carried out by inoculating the genetically engineered bacteria into LB culture medium, culturing at 35-39 ℃ for 8-14h to obtain seed liquid; inoculating the seed liquid to LB liquid culture medium according to the inoculation amount of 1-10%, culturing at 35-39 deg.C and 200-220rpm to OD6000.9-1.1, adding IPTG with final concentration of 0.1-1.0mM, and inducing culture at 15-17 deg.C for 12-16 h.
10. Use of the subtilisin E mutant of claim 1 in the field of detergents, leather, dairy products, or food.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911403670.7A CN111004794B (en) | 2019-12-30 | 2019-12-30 | Subtilisin E mutant with improved thermal stability and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911403670.7A CN111004794B (en) | 2019-12-30 | 2019-12-30 | Subtilisin E mutant with improved thermal stability and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111004794A true CN111004794A (en) | 2020-04-14 |
| CN111004794B CN111004794B (en) | 2022-07-22 |
Family
ID=70119643
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911403670.7A Active CN111004794B (en) | 2019-12-30 | 2019-12-30 | Subtilisin E mutant with improved thermal stability and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111004794B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999009183A1 (en) * | 1997-08-19 | 1999-02-25 | Genencor International, Inc. | MUTANT α-AMYLASE COMPRISING MODIFICATION AT RESIDUES CORRESPONDING TO A210, H405 AND/OR T412 IN $i(BACILLUS LICHENIFORMIS) |
| CN101314034A (en) * | 2007-05-30 | 2008-12-03 | 复旦大学 | Recombined nattokinase oral preparation, preparation method and application thereof |
| JP2012115219A (en) * | 2010-12-02 | 2012-06-21 | Kao Corp | Method for producing endoglucanase |
| CN103289980A (en) * | 2006-07-05 | 2013-09-11 | 催化剂生物科学公司 | Protease screening methods and proteases indentified thererby |
| CN105176951A (en) * | 2015-09-04 | 2015-12-23 | 青岛蔚蓝生物集团有限公司 | Novel alkaline protease mutant |
| CN105992817A (en) * | 2014-02-07 | 2016-10-05 | 帝斯曼知识产权资产管理有限公司 | Improved bacillus host |
| CN109837219A (en) * | 2017-11-24 | 2019-06-04 | 江南大学 | A kind of hydrolysis cow's milk anaphylactogen beta lactoglobulin protease isolating and purifying and applying |
| CN112852788A (en) * | 2019-11-26 | 2021-05-28 | 江南大学 | Subtilisin E mutant with improved alkaline substrate selectivity and application thereof |
-
2019
- 2019-12-30 CN CN201911403670.7A patent/CN111004794B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999009183A1 (en) * | 1997-08-19 | 1999-02-25 | Genencor International, Inc. | MUTANT α-AMYLASE COMPRISING MODIFICATION AT RESIDUES CORRESPONDING TO A210, H405 AND/OR T412 IN $i(BACILLUS LICHENIFORMIS) |
| CN103289980A (en) * | 2006-07-05 | 2013-09-11 | 催化剂生物科学公司 | Protease screening methods and proteases indentified thererby |
| CN101314034A (en) * | 2007-05-30 | 2008-12-03 | 复旦大学 | Recombined nattokinase oral preparation, preparation method and application thereof |
| JP2012115219A (en) * | 2010-12-02 | 2012-06-21 | Kao Corp | Method for producing endoglucanase |
| CN105992817A (en) * | 2014-02-07 | 2016-10-05 | 帝斯曼知识产权资产管理有限公司 | Improved bacillus host |
| CN105176951A (en) * | 2015-09-04 | 2015-12-23 | 青岛蔚蓝生物集团有限公司 | Novel alkaline protease mutant |
| CN109837219A (en) * | 2017-11-24 | 2019-06-04 | 江南大学 | A kind of hydrolysis cow's milk anaphylactogen beta lactoglobulin protease isolating and purifying and applying |
| CN112852788A (en) * | 2019-11-26 | 2021-05-28 | 江南大学 | Subtilisin E mutant with improved alkaline substrate selectivity and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| BARBIERI,G.等: "MULTISPECIES: subtilisin AprE [Bacillus]", 《GENBANK DATABASE》 * |
| KARLYSHEV,A.V.等: "peptidase S8 [Bacillus subtilis]", 《GENBANK DATABASE》 * |
| TANG, HENG等: "Enhancing subtilisin thermostability through a modified normalized B-factor analysis and loop-grafting strategy", 《JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| TANG, HENG等: "Insight into subtilisin E-S7 cleavage pattern based on crystal structure and hydrolysates peptide analysis", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
| 汤恒: "高效降解β-乳球蛋白的蛋白酶的性能优化及结构解析", 《中国博士学位论文全文数据库（电子期刊）工程科技Ⅰ辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111004794B (en) | 2022-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2019085468A1 (en) | Keratinase mutant having improved thermal stability, and application thereof | |
| CN107475228B (en) | Keratinase mutant with improved substrate specificity and preparation method thereof | |
| CN112941094B (en) | Active mutant enzyme and method for producing soluble mutant protein | |
| CN110938616B (en) | Mutant of nitrile hydratase derived from hot spring thermokalite bacillus | |
| CN109971734B (en) | PH-insensitive high-temperature-tolerant HSL family lipid hydrolase and application thereof | |
| CN112831483B (en) | 5-amino-acetopropionic acid synthetase mutant and host cell and application thereof | |
| CN113862233B (en) | Method for improving acid stability of glucose oxidase, mutant Q241E/R499E, gene and application | |
| CN112458072B (en) | Alkaline protease mutant and preparation thereof | |
| CN107794275B (en) | Recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof | |
| CN111073871B (en) | DNA polymerase mutant with improved thermal stability as well as construction method and application thereof | |
| CN111944790B (en) | Neutral protease gene, neutral protease, preparation method and application thereof | |
| CN109072215A (en) | A kind of Cephalosporin C acylase mutant and its application | |
| CN111004794B (en) | Subtilisin E mutant with improved thermal stability and application thereof | |
| CN111575265B (en) | Keratinase mutant with improved thermal stability | |
| CN117625581A (en) | N-acetylglucosaminidase mutant Ea2F and application thereof | |
| CN111139229B (en) | Novel GDSL family lipid hydrolase EII-2 and encoding gene and application thereof | |
| CN112852788B (en) | Subtilisin E mutant with improved alkaline substrate selectivity and application thereof | |
| CN115058408B (en) | Metagenome-derived high-specific-activity acid-resistant D-psicose 3-epimerase and encoding gene and application thereof | |
| EP2173873B1 (en) | Protein and dna sequence encoding a cold adapted subtilisin-like activity | |
| CN110592119A (en) | Novel pullulanase derived from paenibacillus and gene and application thereof | |
| CN109897842B (en) | Amylase mutant ZDAMIA, and coding gene and application thereof | |
| CN112301014B (en) | Esterase mutant with improved thermal stability and application thereof | |
| CN107937374B (en) | Nattokinase with improved thermal stability | |
| CN114621944B (en) | Arginine deiminase mutant with improved enzyme activity | |
| CN113073107B (en) | Mannase gene AbMan5, recombinant expression plasmid, recombinant expression strain, mannase and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |