CN110982831A - Application of gene AlgL23 with cold adaptability - Google Patents

Abstract

The invention discloses an application of a gene AlgL23 with cold adaptability. The enzyme activity can still have 48 percent of the maximum enzyme activity at 4 ℃, and the cold adaptability is relatively excellent.

Description

Application of gene AlgL23 with cold adaptability

Technical Field

The invention relates to the field of gene application, in particular to application of a gene AlgL23 with cold adaptability.

Background

Alginate is a most abundant alginate polysaccharide, and is formed by connecting two units of L-guluronic acid (α -L-guluronic acid, abbreviated as G) and D-mannuronic acid (β -D-mannuronic acid, abbreviated as M) through 1, 4-glycosidic bonds, and the combination of these three units is 3 kinds of polyguluronic acid fragments (Poly-guluronate, Poly-mannuronate, Poly-M) and mannuronic acid-guluronic acid mixed chimeric fragments (Poly-MG). presently, alginate degradation methods mainly include chemical degradation, physical degradation and enzyme, enzymatic degradation of alginate is more advantageous, high efficiency, non-toxic, more suitable for preparation of alginate oligosaccharides.

The algin lyase exists widely in nature, and the algin lyase exists in microorganisms, mollusks and algae in a water system, microorganisms, viruses and the like in a land system. At present, many genes of alginate lyase are cloned and sequenced, and a plurality of recombinant brown algae polysaccharide lyase gene engineering bacteria are constructed, but the expression level of the recombinant brown algae polysaccharide lyase gene engineering is lower, and the application of the enzyme is limited. Therefore, it is still a urgent need in the art to further obtain a fucoidan lyase having excellent properties by genetic engineering means.

Disclosure of Invention

The invention aims to provide an application of a gene AlgL23 with cold adaptability.

In order to achieve the above object, the present invention provides a use of a gene AlgL23 and/or a vector containing the gene AlgL23 having cold adaptability.

Further, the cold adaptability means that the enzyme activity is high at 4-55 ℃.

Further, the cold adaptability means that the enzyme activity can be relatively high at 4-50 ℃.

The invention also provides the application of the gene AlgL23 and/or the carrier containing the gene AlgL23 in producing reducing sugar by acting on kelp.

The DNA sequence of AlgL23 of the alginate lyase is obtained by designing a specific primer, the coding region of the gene is 2223bp in length, 740 amino acids are coded, 1-28 amino acids are signal peptides, and the theoretical molecular weight is 82.59 kDa. AlgL23 obtained by escherichia coli recombinant expression has higher enzyme activity and cold adaptability, the enzyme can still maintain better enzyme activity at low temperature, and the enzyme activity can keep approximately 48.94% of the maximum enzyme activity after reaction at 4 ℃. This is clearly very advantageous compared to enzymes of other origin.

As a preferred mode of embodiment, the temperature range of the catalytic hydrolysis of the alginate lyase is 4-50 ℃, the optimum temperature is 35 ℃, and the enzyme can still retain 55% of the residual activity after being treated for 60min at 40 ℃. The pH range of hydrolysis is 5-9, the optimum pH is 6, and the maximum enzyme activity can be kept above 55% after treatment for 2h under the condition of pH 5-7. Mn²⁺The promotion effect on the enzyme is obvious, Cu²⁺It has obvious inhibiting effect on the enzyme.

Drawings

FIG. 1 is a SDS-PAGE pattern of recombinant expression and purification of alginate lyase gene AlgL 23.

FIG. 2 is a graph showing the effect of temperature on the activity of alginate lyase AlgL23 according to the present invention;

FIG. 3 is a graph showing the effect of temperature on the stability of alginate lyase AlgL23 according to the present invention;

FIG. 4 is a graph showing the effect of pH on the activity of alginate lyase AlgL23 according to the present invention;

FIG. 5 is a graph showing the effect of pH on stability of alginate lyase AlgL23 according to the present invention;

FIG. 6 is a graph showing the effect of metal ions on the activity of alginate lyase AlgL 23;

FIG. 7 is a table of the effect of inhibitors and detergents on enzyme activity;

FIG. 8 is a graph showing the effect of alginate lyase AlgL23 on kelp powder.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Source of biological material

Pseudomonas carrageenonovora ASY5, the Chinese name of which is Pseudoalteromonas cervicalis, is separated from mansion mangrove soil leaf mold sample and is derived from China center for culture Collection of Industrial microorganisms and strains (CICC) with the preservation number of 23819.

Example 1: obtaining of alginate lyase AlgL23 gene with cold adaptability

Inoculating Pseudomonas carrageenovora ASY5 into artificial seawater culture medium, and shake culturing at 25 deg.C and 180r/min to OD₆₀₀1-1.5, taking 1mL of culture solution, and extracting genomic DNA of Pseudomonas carrageenovora ASY5 strain by using a rapid extraction kit (silica gel membrane centrifugation column method) for bacterial genomes of Donghai organisms.

The method for configuring the artificial seawater culture medium comprises the following steps:

artificial seaWater culture medium: 10g of beef extract, 10g of tryptone, 250mL of distilled water and 750mL of artificial seawater (NaCl37.51g, KCl 1.03g and CaCl)₂1.61g、MgCl₂·6H₂O 6.4g、NaHCO₃0.15g、MgSO₄·7H₂O4.67g, 1000mL of distilled water). Dissolving beef extract and tryptone in distilled water, adjusting pH to 7.8 with NaOH, heating and boiling for 10min, cooling, adjusting pH to 7.3 with NaOH, mixing with artificial seawater, and sterilizing at 121 deg.C for 20 min. The solid medium was supplemented with 20g of agar.

The Pseudomonas carrageenovora ASY5 strain genome DNA is used as a template, and a primer is designed for PCR amplification, wherein the primer sequence is as follows:

forward primer AlgL 23-F:

5’-CGCGGATCCATGATGAATTTATCTCGAAG-3’；SEQ ID NO:3；

reverse primer AlgL 23-R:

5’-CCGGAATTCCTCCTGAGTATTCTTCAACG-3’；SEQ ID NO:4。

the forward primer AlgL23-F is underlined the restriction enzyme site BamHI, and the reverse primer AlgL23-R is underlined the restriction enzyme EcoR I site. The high fidelity DNA polymerase PrimeSTAR HS was purchased from TaKaRa, Daii, China, and the PCR reagents were used according to the product instructions provided by this company.

The PCR reaction system comprises:

the PCR conditions were: 95 ℃ for 5 min; 15s at 94 ℃; 55 deg.C, 15s, 72 deg.C, 1min, 30 cycles, and finally 72 deg.C, 10 min.

The PCR product is the alginate lyase AlgL23 gene.

Example 2: sequence analysis

Homology search of nucleic acid sequence and amino acid sequence was performed in GenBank database using BLAST program of NCBI, and presence or absence of signal peptide of alginate lyase was predicted using Signal peptide prediction tool SignalP4.0 of SMART database, and physicochemical properties of protein were predicted using protparam tool of ExPASy.

The result of analysis by the biological software shows that the coding region of the gene AlgL23 has a length of 2223bp, and the nucleotide sequence is shown as SEQ ID NO: 1 is shown. The alginate lyase AlgL23 gene contains 740 amino acids in total, and the amino acid sequence is shown as SEQ ID NO: 2, respectively. Analysis with the protparam tool from ExPASy showed that the protein AlgL23 had a theoretical molecular weight of approximately 82.59kDa and a theoretical isoelectric point of 6.55. The analysis result of the signal peptide shows that 1-28 amino acids at the N end of the signal peptide are the signal peptide sequence.

SEQ ID NO: 1 is as follows:

ATGATGAATTTATCTCGAAGCAAAACATATTTTAAAACAGCCGGCGTAACTGCAGCCTTGTTATTATCTTTAAATGCACATGCTGTGCATCCTAATTTGGTAATCACTAACGACGATGTACAACACATGCGTCAAGCTATTAGCACTAACAGCGAGAGCCAATTTGCTACAGCGTTTGAGTCATTAAAAGCGCAGGTAGATGAGCAAATAGCACAACCTATCACTGTACCAGTTCCAAAAGATGGTGGTGGTGGTTATACCCATGAACGCCATAAAAAAAATTACCAACTGATGTACAACGCGGGCGTTATTTATCAGCTAAGTAAAGATGAAAAATACGCAAATTATGTTCGCGATATGCTACTTGCATACGCACAGTTATACCCAACGCTTGATGTACATCCAAAGCGTAAAGTGAAATCGCAAAACCCAGGTAAACTTTTTTGGCAAAGCCTGAATGAAGCTATGTGGCTTGTATACACTATTCAAGCATATGACCTAGTACATGACACGCTAAGCGCTGCGAATATAAAAACTATCGAAGATGATTTATTGCGCCCGGTTTCATTATTTATGTCTGAAGGGCAACCTTCTACGTTTAATAAAGTACACAACCATGGGACATGGGCTACAGCTGGTGTTGGTATGGCTGGTTATGTATTAGACGAGCCAGAGTGGGTAGAGAAATCATTATTTGATTTAAAAAAGTCGGGTAAGGGTGGTTTTGTTAAGCAGCTCGAAATGCTGTTTTCTCCCCAAGGCTATTACAATGAAGGGCCTTACTATCAACGTTTTGCATTATTACCATTTGTAACGTTTGCTAAAGCGATTGAAAACAACGAACCTCAAAGAAAGATATTTGAATACCGCGATGGCATATTATTAAAAGCAATCGATACGACTATTCAGCTTAGTTATAACGGTTTGTTTTTTCCTATAAACGATGCCATAAAAAGTAAAGGTATTGACACTATAGAGCTTGTGCAAGGGGTTACTGCGGCTTACGGTTTAACAAATGATGCGGGCTATTTAGATGTAGCTAAAAAGCAAAATCAAATTGTTTTAACGGGTGATGGCTTAAAAGTTGCTCAAGCTTTGGATAAAAGCCAAGAAAAGCCATACGTATTTAAATCCGTTGCTTTTGGTGATGGTAACGATGGTAAGCAAGGCGCTTTGGTTGTTATGCGCAGTGACGTAGGTGGCGATCAAGCATTGCTATTTAAACCTGCCGCACAAGGTTTAGGCCATGGTCATTTTGATAAGCTTACATGGCAGTTTTACGATCATGGTAATGAAATCGTATCTGATTACGGCGCTGCACGCTTTTTAAATGTAGAAGCTAAATATGGTGGTCGTTACTTACCTGAAAACGAGACTTATGCAAAGCATACAGTTGCACACAACACCGTTGTTGTTGATGAAACCACGCACTTTAATGCAAATGTTGAAGTGGGTAATAATAACCACCCAACGCTTAATTTTTTCGAAACCAATCAATACGGTACAGTATCAAGTGGGCAAATAAAAACAGCTTATAAAGGTGTTGAGTTAGAGCGTACTTTAGCGCTTGTTAACCTGCCAGAGCTTGACAGTACCATTGCTGTAGATATGTTTAATGTAACTGCAAATAAGGCACATCAGCTTGATTTACCGCTACATTATAAAGGTCAGTTAATTGATACAAGTTTTGAATTAACAGGTAACGCTAAGCAGTTATCAGCATTGGGTGATAAAAACGGATACCAGCATTTATGGCTTAAGGCACAGGCAAAACCTGAGCAAGGGCTAGCTAAGGTAACGTGGTTAAATGATAACGGACGTTTTTATACACAAACTAGTTTAGTTAAAGGAGATGAGTCGTTCCTATTTACTCAAATAGGCGCAAACGACCCGCACTTTAATTTACGTAACGAAAACGGTTTTATTCGCCGAGTAGATAGCGCTAAACAGCATAAGTTTATATCTATTTTAGAGCCGCATGGCGAGTACAACCCAAGTAAAGAATATACGCTAGAAGCAAATAGCAGAGTAACGGCACTTAACTACAGCGAACAAGATACGCTTACACTTGTTAATGTTGATATTAAGGGCAAATCTTATTTAGTTGCGATCAATAAAGCTGCACAAGCAAACCCTAGCAAGCACACTTTCACATATCAAAATAAAGCATTCACCTTAAATGGCCGTCTTGGCGTTTATGCGTTGAAGAATACTCAGGAGTAA

SEQ ID NO: 2 is as follows:

MMNLSRSKTYFKTAGVTAALLLSLNAHAVHPNLVITNDDVQHMRQAISTNSESQFATAFESLKAQVDEQIAQPITVPVPKDGGGGYTHERHKKNYQLMYNAGVIYQLSKDEKYANYVRDMLLAYAQLYPTLDVHPKRKVKSQNPGKLFWQSLNEAMWLVYTIQAYDLVHDTLSAANIKTIEDDLLRPVSLFMSEGQPSTFNKVHNHGTWATAGVGMAGYVLDEPEWVEKSLFDLKKSGKGGFVKQLEMLFSPQGYYNEGPYYQRFALLPFVTFAKAIENNEPQRKIFEYRDGILLKAIDTTIQLSYNGLFFPINDAIKSKGIDTIELVQGVTAAYGLTNDAGYLDVAKKQNQIVLTGDGLKVAQALDKSQEKPYVFKSVAFGDGNDGKQGALVVMRSDVGGDQALLFKPAAQGLGHGHFDKLTWQFYDHGNEIVSDYGAARFLNVEAKYGGRYLPENETYAKHTVAHNTVVVDETTHFNANVEVGNNNHPTLNFFETNQYGTVSSGQIKTAYKGVELERTLALVNLPELDSTIAVDMFNVTANKAHQLDLPLHYKGQLIDTSFELTGNAKQLSALGDKNGYQHLWLKAQAKPEQGLAKVTWLNDNGRFYTQTSLVKGDESFLFTQIGANDPHFNLRNENGFIRRVDSAKQHKFISILEPHGEYNPSKEYTLEANSRVTALNYSEQDTLTLVNVDIKGKSYLVAINKAAQANPSKHTFTYQNKAFTLNGRLGVYALKNTQE。

example 3: recombinant expression and purification of the Gene AlgL23 in the E.coli BL21(DE3) Strain

The PCR product and pET-28a plasmid obtained in the example are subjected to double digestion by restriction enzymes EcoR I and BamHI, and the product fragments after digestion are recovered, the restriction enzymes EcoR I and BamHI are purchased from TaKaRa Biochemical company of Dalian China, and the system, temperature and time of the reaction between the enzyme and the substrate used in the digestion are operated according to the product instructions provided by the company, the PCR product subjected to double digestion by EcoRI and BamHI is ligated with the pET-28a plasmid vector subjected to double digestion likewise under the catalysis of T4 DNA ligase, the ligation product is transformed into Escherichia coli DH5 α strain, the Escherichia coli DH5 α strain is coated on a kanamycin solid culture medium containing 0.1mg/mL, inverted culture is carried out at 37 ℃ for 16h, positive transformants are picked up, the positive transformants are inoculated into a liquid LB culture medium containing 0.1mg/mL, the LB culture is carried out at 37 ℃ and 180R/min, the transformants are cultured for 12h, and the forward primer AlgL23-F and the reverse primer AlgL23-R are used for carrying out PCR verification of correct plasmid recombinant pET-28-AlgL plasmid.

Then, the recombinant plasmid pET-28a-AlgL23 is transformed into escherichia coli BL21(DE3), the escherichia coli BL21(DE3) is coated on LB solid culture medium containing 0.1mg/mL kanamycin, after inverted culture is carried out for 16h at 37 ℃, a positive transformant is picked up, the positive transformant is inoculated into liquid LB culture medium containing 0.1mg/mL kanamycin, the cultivation is carried out for 12h at 37 ℃, 180R/min, bacterial liquid PCR verification is carried out by using a forward primer AlgL23-F and a reverse primer AlgL23-R, an amplification product with the size of about 2200bp is obtained, the constructed recombinant plasmid is preliminarily proved to be correct, the constructed recombinant plasmid is sent to Xiamen platinum-Richiki biotechnology limited company for sequencing, the result shows that a gene AlgL23 shown in SEQ ID NO 1 is inserted into an EcoR I and BamHI enzyme cutting site of the pET-28a, and the inserting direction is correct, the constructed recombinant plasmid is further proved to be correct, the constructed recombinant plasmid named as pET-28a-AlgL23 a, the recombinant plasmid is obtained by using isopropyl thiogalactopsin (IPTG), the bacterial enzyme), the recombinant bacterium, the bacterial suspension is obtained by adding the bacterial suspension, the bacterial suspension is obtained, the suspension is obtained₂PO₄pH8.0), the bacterial liquid is processed by ultrasonic crushing until the bacterial liquid becomes semitransparent (the parameters are set to 300w, the ultrasonic time is 5s, the intermittent time is 5s, the total working time is 15min), and the temperature is 11000rpmAfter 20min, the supernatant was mixed with Ni-NTA Agarose previously equilibrated with lysis buffer, bound at 4 ℃ for 1 hour, and purified according to the instructions of the purification kit (from Qiagen). The purified protein was analyzed by SDS-PAGE and the molecular weight was about 83kDa, and the concentration of the protein was determined by Bradford assay to give a concentration of about 1.0mg/ml of recombinant alginate lyase (see FIG. 1 for the results), in FIG. 1, M is the protein Marker, lane 1 is the expression of empty vector pET-28a in E.coli BL21, lane 2 is the inducible expression of recombinant vector pET-28a-AlgL23 in E.coli BL21, and lanes 3-6 are the target protein AlgL23(82.59kDa) purified by Ni-NTA. As can be seen from FIG. 1, the target protein AlgL23 was induced and purified by Ni-NTA to obtain a higher purity.

Example 4: analysis of enzymatic Properties of recombinant alginate lyase

1. Determination of the activity of the recombinant enzyme:

200. mu.L of the purified recombinant algal polysaccharide lyase obtained in example 3 was mixed with 800. mu.L of sodium alginate (0.5%, pH8.0), reacted at 35 ℃ for 60min and then quenched in a boiling water bath, then 1mL of a DNS solution (the formulation of the DNS solution is that 10g of 3, 5-dinitrosalicylic acid was weighed and placed in 600mL of water, sodium hydroxide 10 was gradually added and dissolved in a 50 ℃ water bath, 200g of potassium sodium tartrate, 2g of phenol and 5g of anhydrous sodium sulfite were sequentially added, all dissolved and clarified and then cooled to room temperature, water was added to a constant volume of 1000mL, filtered, stored in a brown reagent bottle and used after being placed in the dark for 7 days) and reacted in a boiling water bath for 10min, and the absorbance was measured at 540 nm. Enzyme activity is defined as: under the above conditions, the amount of enzyme required to catalyze the production of 1. mu.g of reducing sugar (e.g., alginate oligosaccharide) per minute is one enzyme activity unit (U).

2. Effect of temperature on enzyme Activity and stability

The enzyme activity of the recombinant alginate lyase is determined after the reaction at the reaction temperature of 4 ℃, 10 ℃, 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃,50 ℃, 55 ℃ and 60 ℃, and the highest enzyme activity is 100 percent. When the temperature stability of the recombinant alginate lyase is measured, the enzyme solution is respectively treated for 0-180min at 30 ℃, 35 ℃ and 40 ℃, and the residual enzyme activity is measured at the optimal reaction temperature, wherein the enzyme activity in the untreated state is 100%. The optimum temperature measurement results are shown in FIG. 2: the alginate lyase AlgL23 reaches the maximum activity at 35 ℃, which shows that the optimum reaction temperature of the alginate lyase AlgL23 is 35 ℃, and the enzyme activity still has 48% of the maximum enzyme activity at 4 ℃, which shows that the enzyme can react at a lower temperature and has better cold adaptability. The temperature stability results are shown in figure 3, the enzyme is relatively stable at 30 ℃ and 35 ℃, 60 percent of enzyme activity is still retained after 2 hours of warm bath, and the enzyme activity is still 50 percent of the original enzyme activity after 1 hour of warm bath at 40 ℃.

3. Effect of pH on enzyme Activity and stability

Preparing a substrate by using buffer systems with different pH values, and measuring the enzyme activity at the optimal reaction temperature, wherein the highest enzyme activity is 100%. The buffer solution systems are respectively 50mmol/L of acetic acid-sodium acetate (pH 4-6), sodium dihydrogen phosphate-disodium hydrogen phosphate (pH 6-8), Tris-HCl (pH8-9) glycine-NaOH (pH 9-10). The study on the pH stability is carried out by mixing the enzyme solution with buffer solutions with different pH values in equal proportion, standing at 4 ℃ for 2h, and then measuring the residual enzyme activity, wherein the enzyme activity is 100% when the enzyme is not treated. As shown in FIG. 4, the activity of the recombinant alginate lyase was the highest at pH6.0, indicating that the optimum pH of the alginate lyase AlgL23 was 6.0. The pH stability results are shown in FIG. 5, the recombinant alginate lyase AlgL23 is relatively stable in the acidic (5-7) range, and the enzyme activity of more than 55% can be maintained after 2h treatment at 4 ℃.

4. Effect of Metal ions on enzyme Activity

Adding different metal ions (Mg) with final concentration of 1mmol/L or 10mmol/L into the enzyme solution²⁺、Sr²⁺、Mn²⁺、Fe²⁺、Ba²⁺、Cd²⁺、Fe³⁺、Ca²⁺、Cu²⁺) And after standing at 37 ℃ for 1h, determining the residual activity of the enzyme, and researching the influence of metal ions on the activity of the enzyme by taking the activity of the enzyme without adding metal ions as 100%. As shown in FIG. 6, the results show that the metal ion Mn²⁺The concentration of the Fe-Al-Cu-Al alloy is 1mmol/L and 10mmol/L, and the Fe-Al-Cu-Al alloy has obvious promotion effect on AlgL23³⁺Has slight promotion effect on enzyme activity when the concentration is 1mmol/L, and has slight promotion effect on enzyme activity when the concentration is increased to 10mmol/LA great inhibitory effect is produced. Cu²⁺、Mg²⁺、Sr²⁺、Ca²⁺、Ba²⁺All had varying degrees of inhibitory effect on AlgL 23. When the concentration is 10mmol/L, Cu²⁺Has very strong inhibition effect on enzyme activity, and almost completely inhibits the enzyme activity.

5. Effect of inhibitors and detergents on enzyme Activity

Respectively adding 1mmol/L or 10mmol/L inhibitor (EDTA, DTT, mercaptoethanol, CTAB, Urea) and 1% or 10% (V/V) detergent (SDS, Tween 20, Tween 80, TritonX 100) into the enzyme solution, standing at 37 ℃ for 1h, measuring the residual activity of the enzyme, and researching the influence of the inhibitor and the detergent on the enzyme activity by taking the enzyme activity without the addition of the inhibitor or the detergent as 100%. As shown in FIG. 7, the alginate lyase AlgL23 was very resistant to SDS, and CTAB had a very strong inhibitory effect on AlgL 23. At a concentration of 10mM, alginate lyase AlgL23 was substantially inactivated. EDTA and Tween 80 also have obvious inhibition effect on AlgL23, and the activity of enzyme is greatly inhibited. The low-concentration urea slightly inhibits the enzyme activity, and the inhibition effect is obviously enhanced when the concentration is increased.

Example 5: recombinant alginate lyase AlgL23 acting on kelp powder

Washing the kelp slices with distilled water, airing the kelp slices outdoors for 1-2 days, drying the kelp slices in an oven, grinding the dried samples into powder, adding the powder into 0.05mol/L Tris-HCl (pH8.0) buffer solution, stirring the mixture for 10min at 50 ℃ to prepare 5mg/ml substrate, adding 10U of recombinant alginate lyase AlgL23 into 20ml substrate, carrying out enzymatic reaction at 35 ℃, and sampling every 1 h. The reaction was terminated by taking a sample in a boiling water bath for 10min, and then centrifuged at 12000rpm at 4 ℃ for 20min, and the content of reducing sugar in the supernatant was determined by the DNS method. After the reaction is carried out for 6 hours, 5U of recombinant alginate lyase AlgL23 is added into the reaction mixture, samples are taken every 2 hours, and after the reaction is carried out for 12 hours, the content of reducing sugar is not increased basically until the content reaches about 12.5mg (as shown in figure 8), and the results show that the recombinant alginate lyase AlgL23 can act on the kelp to generate the reducing sugar.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made in the above embodiments by those of ordinary skill in the art without departing from the principle and spirit of the present invention.

SEQUENCE LISTING

<110> college university

Application of <120> gene AlgL23 in cold adaptability

<130>JMDXL-19036-CNI

<160>4

<170>PatentIn version 3.5

<210>1

<211>2223

<212>DNA

<213>Pseudoalteromonas carrageenovora ASY5

<400>1

atgatgaatt tatctcgaag caaaacatat tttaaaacag ccggcgtaac tgcagccttg 60

ttattatctt taaatgcaca tgctgtgcat cctaatttgg taatcactaa cgacgatgta 120

caacacatgc gtcaagctat tagcactaac agcgagagcc aatttgctac agcgtttgag 180

tcattaaaag cgcaggtaga tgagcaaata gcacaaccta tcactgtacc agttccaaaa 240

gatggtggtg gtggttatac ccatgaacgc cataaaaaaa attaccaact gatgtacaac 300

gcgggcgtta tttatcagct aagtaaagat gaaaaatacg caaattatgt tcgcgatatg 360

ctacttgcat acgcacagtt atacccaacg cttgatgtac atccaaagcg taaagtgaaa 420

tcgcaaaacc caggtaaact tttttggcaa agcctgaatg aagctatgtg gcttgtatac 480

actattcaag catatgacct agtacatgac acgctaagcg ctgcgaatat aaaaactatc 540

gaagatgatt tattgcgccc ggtttcatta tttatgtctg aagggcaacc ttctacgttt 600

aataaagtac acaaccatgg gacatgggct acagctggtg ttggtatggc tggttatgta 660

ttagacgagc cagagtgggt agagaaatca ttatttgatt taaaaaagtc gggtaagggt 720

ggttttgtta agcagctcga aatgctgttt tctccccaag gctattacaa tgaagggcct 780

tactatcaac gttttgcatt attaccattt gtaacgtttg ctaaagcgat tgaaaacaac 840

gaacctcaaa gaaagatatt tgaataccgc gatggcatat tattaaaagc aatcgatacg 900

actattcagc ttagttataa cggtttgttt tttcctataa acgatgccat aaaaagtaaa 960

ggtattgaca ctatagagct tgtgcaaggg gttactgcgg cttacggttt aacaaatgat 1020

gcgggctatt tagatgtagc taaaaagcaa aatcaaattg ttttaacggg tgatggctta 1080

aaagttgctc aagctttgga taaaagccaa gaaaagccat acgtatttaa atccgttgct 1140

tttggtgatg gtaacgatgg taagcaaggc gctttggttg ttatgcgcag tgacgtaggt 1200

ggcgatcaag cattgctatt taaacctgcc gcacaaggtt taggccatgg tcattttgat 1260

aagcttacat ggcagtttta cgatcatggt aatgaaatcg tatctgatta cggcgctgca 1320

cgctttttaa atgtagaagc taaatatggt ggtcgttact tacctgaaaa cgagacttat 1380

gcaaagcata cagttgcaca caacaccgtt gttgttgatg aaaccacgca ctttaatgca 1440

aatgttgaag tgggtaataa taaccaccca acgcttaatt ttttcgaaac caatcaatac 1500

ggtacagtat caagtgggca aataaaaaca gcttataaag gtgttgagtt agagcgtact 1560

ttagcgcttg ttaacctgcc agagcttgac agtaccattg ctgtagatat gtttaatgta 1620

actgcaaata aggcacatca gcttgattta ccgctacatt ataaaggtca gttaattgat 1680

acaagttttg aattaacagg taacgctaag cagttatcag cattgggtga taaaaacgga 1740

taccagcatt tatggcttaa ggcacaggca aaacctgagc aagggctagc taaggtaacg 1800

tggttaaatg ataacggacg tttttataca caaactagtt tagttaaagg agatgagtcg 1860

ttcctattta ctcaaatagg cgcaaacgac ccgcacttta atttacgtaa cgaaaacggt 1920

tttattcgcc gagtagatag cgctaaacag cataagttta tatctatttt agagccgcat 1980

ggcgagtaca acccaagtaa agaatatacg ctagaagcaa atagcagagt aacggcactt 2040

aactacagcg aacaagatac gcttacactt gttaatgttg atattaaggg caaatcttat 2100

ttagttgcga tcaataaagc tgcacaagca aaccctagca agcacacttt cacatatcaa 2160

aataaagcat tcaccttaaa tggccgtctt ggcgtttatg cgttgaagaa tactcaggag 2220

taa 2223

<210>2

<211>740

<212>PRT

<213>Pseudoalteromonas carrageenovora ASY5

<400>2

Met Met Asn Leu Ser Arg Ser Lys Thr Tyr Phe Lys Thr Ala Gly Val

Thr Ala Ala Leu Leu Leu Ser Leu Asn Ala His Ala Val His Pro Asn

Leu Val Ile Thr Asn Asp Asp Val Gln His Met Arg Gln Ala Ile Ser

Thr Asn Ser Glu Ser Gln Phe Ala Thr Ala Phe Glu Ser Leu Lys Ala

Gln Val Asp Glu Gln Ile Ala Gln Pro Ile Thr Val Pro Val Pro Lys

Asp Gly Gly Gly Gly Tyr Thr His Glu Arg His Lys Lys Asn Tyr Gln

Leu Met Tyr Asn Ala Gly Val Ile Tyr Gln Leu Ser Lys Asp Glu Lys

Tyr Ala Asn Tyr Val Arg Asp Met Leu LeuAla Tyr Ala Gln Leu Tyr

Pro Thr Leu Asp Val His Pro Lys Arg Lys Val Lys Ser Gln Asn Pro

Gly Lys Leu Phe Trp Gln Ser Leu Asn Glu Ala Met Trp Leu Val Tyr

Thr Ile Gln Ala Tyr Asp Leu Val His Asp Thr Leu Ser Ala Ala Asn

Ile Lys Thr Ile Glu Asp Asp Leu Leu Arg Pro Val Ser Leu Phe Met

Ser Glu Gly Gln Pro Ser Thr Phe Asn Lys Val His Asn His Gly Thr

Trp Ala Thr Ala Gly Val Gly Met Ala Gly Tyr Val Leu Asp Glu Pro

Glu Trp Val Glu Lys Ser Leu Phe Asp Leu Lys Lys Ser Gly Lys Gly

Gly Phe Val Lys Gln Leu Glu Met Leu Phe Ser Pro Gln Gly Tyr Tyr

Asn Glu Gly Pro Tyr Tyr Gln Arg Phe Ala Leu Leu Pro Phe Val Thr

Phe Ala Lys Ala Ile Glu Asn Asn Glu Pro Gln Arg Lys Ile Phe Glu

Tyr Arg Asp Gly Ile Leu Leu Lys Ala Ile Asp Thr Thr Ile Gln Leu

Ser Tyr Asn Gly Leu Phe Phe Pro Ile Asn Asp Ala Ile Lys Ser Lys

Gly Ile Asp Thr Ile Glu Leu Val Gln Gly Val Thr Ala Ala Tyr Gly

Leu Thr Asn Asp Ala Gly Tyr Leu Asp Val Ala Lys Lys Gln Asn Gln

Ile Val Leu Thr Gly Asp Gly Leu Lys Val Ala Gln Ala Leu Asp Lys

Ser Gln Glu Lys Pro Tyr Val Phe Lys Ser Val Ala Phe Gly Asp Gly

Asn Asp Gly Lys Gln Gly Ala Leu Val Val Met Arg Ser Asp Val Gly

Gly Asp Gln Ala Leu Leu Phe Lys Pro Ala Ala Gln Gly Leu Gly His

Gly His Phe Asp Lys Leu Thr Trp Gln Phe Tyr Asp His Gly Asn Glu

Ile Val Ser Asp Tyr Gly Ala Ala Arg Phe Leu Asn Val Glu Ala Lys

Tyr Gly Gly Arg Tyr Leu Pro Glu Asn Glu Thr Tyr Ala Lys His Thr

Val Ala His Asn Thr Val Val Val Asp Glu Thr Thr His Phe Asn Ala

Asn Val Glu Val Gly Asn Asn Asn His Pro Thr Leu Asn Phe Phe Glu

Thr Asn Gln Tyr Gly Thr Val Ser Ser Gly Gln Ile Lys Thr Ala Tyr

Lys Gly Val Glu Leu Glu Arg Thr Leu Ala Leu Val Asn Leu Pro Glu

Leu Asp Ser Thr Ile Ala Val Asp Met Phe Asn Val Thr Ala Asn Lys

Ala His Gln Leu Asp Leu Pro Leu His Tyr Lys Gly Gln Leu Ile Asp

Thr Ser Phe Glu Leu Thr Gly Asn Ala Lys Gln Leu Ser Ala Leu Gly

Asp Lys Asn Gly Tyr Gln His Leu Trp Leu Lys Ala Gln Ala Lys Pro

Glu Gln Gly Leu Ala Lys Val Thr Trp Leu Asn Asp Asn Gly Arg Phe

Tyr Thr Gln Thr Ser Leu Val Lys Gly Asp Glu Ser Phe Leu Phe Thr

Gln Ile Gly Ala Asn Asp Pro His Phe Asn Leu Arg Asn Glu Asn Gly

Phe Ile Arg Arg Val Asp Ser Ala Lys Gln His Lys Phe Ile Ser Ile

Leu Glu Pro His Gly Glu Tyr Asn Pro Ser Lys Glu Tyr Thr Leu Glu

Ala Asn Ser Arg Val Thr Ala Leu Asn Tyr Ser Glu Gln Asp Thr Leu

Thr Leu Val Asn Val Asp Ile Lys Gly Lys Ser Tyr Leu Val Ala Ile

Asn Lys Ala Ala Gln Ala Asn Pro Ser Lys His Thr Phe Thr Tyr Gln

Asn Lys Ala Phe Thr Leu Asn Gly Arg Leu Gly Val Tyr Ala Leu Lys

Asn Thr Gln Glu

<210>3

<211>29

<212>DNA

<213> Artificial Synthesis

<400>3

cgcggatcca tgatgaattt atctcgaag 29

<210>4

<211>29

<212>DNA

<213> Artificial Synthesis

<400>4

ccggaattcc tcctgagtat tcttcaacg 29

Claims (4)

1. The gene AlgL23 and/or the vector containing the gene AlgL23 have cold-adapted uses.

2. The use according to claim 1, wherein the cold adaptability is such that the enzyme activity is greater at 4-55 ℃, the highest enzyme activity at 35 ℃ is 100%, and the enzyme activity at 4 ℃ is 48% of the maximum enzyme activity.

3. The use according to claim 2, wherein cold acclimation is greater enzymatic activity at 4-50 ℃.

4. The gene AlgL23 and/or the vector containing the gene AlgL23 have the application of acting on kelp to generate reducing sugar.

Images